G10-098

151
High-density fluorescence in situ hybridization
signal detection on barley (Hordeum vulgare L.)
chromosomes with improved probe screening and
reprobing procedures
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Akio Kato
Abstract: The barley (Hordeum vulgare L.) genome was screened to identify sequences that could be used for fluorescence in situ hybridization (FISH). From 2000 transformed bacterium colonies carrying barley clones, 56 colonies were selected on the basis of the patterns that their PCR products produced when subjected to agarose gel electrophoresis. Among
them, 42 (75%) exhibited fluorescent signals on barley chromosomes after in situ hybridization using the directly labeled
PCR products. Sequencing revealed seven clones, pHv-365, pHv-177, pHv-1112, pHv-689, pHv-1476, pHv-1889, and
pHv-1972, to be newly identified FISH-positive sequences. The remainder possess previously described sequences such as
5S, GAA microsatellite, centromere repeats, HVT01, and pHvMWG2315 (324 bp repeat). It is shown here that a combination of five probes, which produce strong signals on barley chromosomes, pHv-38 (5S), pHv-365, pHv-961 (HVT01),
GAA, and TAG microsatellites, offer unequivocal recognition of each chromosome. The combination of three probes, i.e.,
pHv-1123 (barley 324 bp repeat), GAA, and TAG, decorated entire chromosomes with fine dotted signals and was useful
for detecting the break points of aberrant chromosomes. The signals’ distributions of pHv-177, pHv-1112, and TAG were
highly polymorphic. An improved reprobing procedure and its usefulness are also discussed.
Key words: multicolor fluorescence in situ hybridization, genomic TA cloning, reprobing, barley.
Résumé : Le génome de l’orge (Hordeum vulgare L.) a été criblé pour identifier des séquences pouvant servir en hybridation in situ en fluorescence. À partir de 2000 colonies bactériennes transformées contenant des clones d’orge, 56 colonies
ont été retenues en raison de leur amplicon PCR suite à une électrophorèse sur gel d’agarose. Parmi ceux-ci, 42 (75 %)
présentaient des signaux fluorescents sur des chromosomes d’orge après hybridation in situ à l’aide des produits PCR marqués. Le séquençage a montré que sept clones, pHv-365, pHv-177, pHv-1112, pHv-689, pHv-1476, pHv-1889 et pHv1972, constituaient de nouvelles sondes FISH. Les autres clones contenaient diverses séquences déjà décrites comme
l’ADNr 5S, le microsatellite GAA, des répétitions centromériques, HVT01, pHvMWG2315 (répétition de 324 pb). Les auteurs montrent qu’une combinaison de cinq sondes produisant de forts signaux d’hybridation sur les chromosomes de
l’orge, pHv-38 (5S), pHv-365, pHv-961 (HVT01) ainsi que les microsatellites GAA et TAG, permettent d’identifier clairement chacun des chromosomes. La combinaison de trois sondes, soit pHv-1123 (répétition de 324 pb), GAA et TAG, permet de décorer les chromosomes entiers d’un signal ponctuel fin et d’ainsi détecter les cassures chez les chromosomes
aberrants. La distribution des signaux obtenus avec les sondes pHv-177, pHv-1112 et TAG était très polymorphe. Les auteurs présentent également une méthode améliorée de re-hybridation des lames et discutent de l’utilité de celle-ci.
Mots-clés : hybridation in situ en fluorescence multicolore, clonage génomique TA, re-hybridation, orge.
[Traduit par la Rédaction]
Introduction
In barley (Hordeum vulgare L.) (2n = 14), seven pairs of
chromosomes were identified using an N- or C-banding
technique in the late 1970s to early 1990s (Kakeda et al.
1991). Experiments to identify all barley chromosomes by
Received 30 July 2010. Accepted 23 September 2010. Published
on the NRC Research Press Web site at genome.nrc.ca on
17 January 2011. Reposted on the Web site with correction on
3 February 2011.
Corresponding Editor: P. Gustafson.
A. Kato. Laboratory of Plant Breeding, Faculty of Life and
Environmental Sciences, Kyoto Prefectural University, 1-5
Shimogamo Hangi-cho, Sakyo-ku, Kyoto-shi, Kyoto 606-0823,
Japan. (e-mail: katoa@kpu.ac.jp).
Genome 54: 151–159 (2011)
fluorescence in situ hybridization (FISH) were attempted in
the late 1990s (Pedersen et al. 1996; Tsujimoto et al. 1997;
Taketa et al. 1999). During that period, the 5S and 18S–25S
ribosomal DNA probes proved to identify all the barley
chromosome arms unambiguously (Pedersen and LindeLaursen 1994; Brown et al. 1999; Taketa et al. 1999). At
that time, indirect probe-labeling procedures were used to
detect fluorescent signals; namely, probes were labeled with
biotin-dUTP or digoxigenin-dUTP, and the inflorescent
haptens biotin and digoxigenin were detected by fluorochrome-conjugated streptavidin or anti-digoxigenin antibodies. The signals could be amplified by the secondary
fluorochrome-conjugated antibody. The indirect method
works well; however, some detection and resolution limitations exist. Both streptavidin and antibodies are macromolecules and their ability to penetrate to the chromatin is not
doi:10.1139/G10-098
Published by NRC Research Press
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
152
good. Also, the unspecific binding of antibodies to the surface of the cells produces a background, and this background is amplified after an application of the secondary
layer of antibodies.
Recently, direct labeling procedures have become popular
(Kato et al. 2004). Directly labeled DNA probes exhibit
more discrete signals on chromosomes than those produced
by indirect detection methods, and the signals are more consistent. A recent technical development has greatly improved
the incorporation of fluorochrome into DNA probes so that
direct label signal brightness is comparable to indirect methods (Kato et al. 2006). Cuadrado and Jouve (2007) revealed
the microsatellite distribution on barley chromosomes using
directly labeled probes. They reported that the TAG (ACT)
sequences are located at discrete positions along various
chromosome arms and that they contribute to the identification of all the chromosome arms on the barley cultivar Plaisant; however, most other microsatellites are simply
enriched at pericentric regions.
Even if all barley chromosomes are identifiable using 5S
and 18S–25S ribosomal DNA probes, an increase of FISH
landmarks on barley chromosomes is desirable for detecting
break points of aberrant chromosomes and for identifying
alien chromosome segments after interspecific crosses.
High-density chromosome landmark detection will also
make chromosome recognition possible at a highly condensed stage such as anaphase.
Here I report on a genomic plasmid library that I constructed and screened for novel sequences that will contribute to the identification of barley chromosomes or
chromosome arms. In my previous screening work on maize
(Kato et al. 2004), FISH-positive probes were separated
from randomly amplified polymerase chain reaction (PCR)
products; this time, DNase-I-digested barley genomic DNA
was TA-cloned, and E. coli stbl4 cells were transformed
and screened.
Materials and methods
Genomic library construction
Genomic DNA was extracted from leaves of a Japanese
local barley cultivar Minorimugi using the standard CTAB
procedure. The DNA was purified using phenol–chloroform
extraction and stored at –20 8C until use. The genomic DNA
solution (1 mg/mL) was partially digested using DNase I
(Roche Diagnostics, Mannheim, Germany) in the presence
of MgSO4 (5 mmol/L). The digested solution was heated to
75 8C for 10 min to inactivate DNase I and to facilitate
breaking of nicked fragile DNA sites. The irregular ends of
DNA fragments were repaired using T4 DNA polymerase
(New England Biolab, Ipswich, Massachusetts) according to
the manufacturer’s instructions. Then, DNA was purified,
precipitated, and resuspended in a TE buffer (10 mmol/L
Tris-HCl, 1 mmol/L EDTA, pH 7.6). Adenosine addition
was achieved by incubating DNA fragments in a dATPadded PCR buffer with standard Taq polymerase at 72 8C
for 30 min. The ‘‘A’’-added DNA was loaded into a well of
sterilized 1% agarose gel. The gel had a second row of wells
that was 2–3 cm downstream from the first. This allowed for
different DNA-fragment length fractions to be separated by
successive sampling from the second row of wells. Aliquots
Genome Vol. 54, 2011
Fig. 1. PCR products that showed smear or ladder patterns. From
left to right, 100 bp ladder, pHv-38, pHv-365, pHv-689, pHv-875,
pHv-961, pHv-1112, pHv-1123, and pHv-1889. PCR products of
repeated sequence templates show smears or ladder patterns after
electrophoresis.
of fractions were electrophoresed, and the fraction containing 800–1200 bp DNA fragments was identified and TAcloned using the p-GemT easy vector system (Promega,
Fitchburg, Wisconsin) according to the manufacturer’s instructions. An E. coli strain, stbl4 cell (Invitrogen, Carlsbad,
California), was electroporated with the desalted p-GemT
easy plasmid according the manufacturer’s instructions.
PCR screening of repeated sequences
Colony PCR reactions using Quick HS Taq DyeMix
(Toyobo, Kita-ku, Osaka, Japan) were performed on 2000
transformed bacterium colonies and electrophoresed. The forward and reverse primers were the p-GemT easy plasmid’s
cloning site sequences, CGACGTCGCATGCTCCCGGCCGCCA and TGGTCGACCTGCAGGCGGCCGCGAA, respectively. Clones whose PCR products showed either a
smear or multiple banding patterns on a gel (Fig. 1) were selected for successive FISH signal detection on Minorimugi
chromosome spreads.
Slide preparation
Slides were prepared from root tips of seedlings of three
barley cultivars, Minorimugi, Emir, and Plaisant, that were
geminated either in a 30 8C incubator or in the greenhouse.
The slide preparation procedure was as described in Kato et
al. (2006) with minor modifications. The root tips were
treated with 1.0 MPa nitrous oxide gas (Kato 1999) in an
airtight stainless steel chamber for 2 h and fixed in 90% acetic acid for 5 min. Root tips were stored in 70% ethanol at
–20 8C until use. Root tips were washed in a TE buffer.
Four root meristems were cut and put into a 1.5 mL centrifuge tube containing 10 mL pectolyase Y-23 (1%) (Kikkoman Co., Tokyo, Japan) and cellulase Onozuka R-10
Published by NRC Research Press
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Kato
(2%) (Yakult Honsha Co., Ltd. Minato-ku, Tokyo, Japan)
in a citric buffer (sodium citrate 5 mmol/L, 5 mmol/L
EDTA, pH 5.5). The tube was transferred to a water bath
containing 37 8C water, and the root sections were digested for 80 min. After digestion, root sections were
washed in a TE buffer. After aspiration of the TE buffer,
50 mL of 70% ethanol was added to the tube. Then the
tube was agitated several times to disperse the digested
cell sections into a suspension of single cells.
The tube was centrifuged at 5000 rpm for 2 min to collect
the root cells. The 70% ethanol was discarded, and the cells
were washed with 100% ethanol to remove any remaining
moisture. The cells were again spun down and the ethanol
was aspirated. The cells were resuspended in 30 mL of
100% acetic acid.
Clean glass slides were placed in a humidity chamber,
which was a small open top cardboard box (10 cm 10 cm 20 cm) lined on the sides and bottom with moistened paper towels with two wooden rods inside. Eight droplets (0.5 mL each) of an acetic acid cell suspension were
dropped onto a clean glass slide in two lines of four droplets. The slides were allowed to dry slowly in the humidity
chamber. The cell-spreads on the slides were fixed with a
10% formaldehyde solution for 5 min by dropping formaldehyde solution on the slide and covering with a tip of parafilm; this formaldehyde treatment prevented the loss of DNA
from the chromatids during the following FISH procedure
and reprobing.
Identification and marking of chromosome spread for
reprobing
A phase contrast microscope was used to evaluate unstained chromosome spreads. Each slide was evaluated for
the number and the quality of the cell spreads. Once a good
cell spread was identified, its location was indicated on the
back of the slide with a color marker. Later, the marks were
made permanent by scratching with a tungsten carbide pencil and wiping away the color mark. With this procedure,
the chromosome spreads were easily identified after reprobing.
FISH procedure
Amplified PCR products that had shown a smear or ladder pattern were labeled with Texas-red-dATP or fluoresceindATP by a modified nick translation procedure (Kato et al.
2006). Also used for the FISH trials were fluorescein or
Texas-red-labeled synthetic oligos (30-mer) of GAA and
TAG microsatellite sequences. A slide with a good chromosome spread was placed on a metal plate on ice. A
probe mixture (e.g., 5 ng/mL fluorescein-labeled TAG and
10 ng/mL Texas-red-labeled pHv-38, total volume 2 mL)
was dropped on the slide. Immediately, a plastic cover slip
(4 mm 4 mm, rain X-coated) was applied. Two thick
paper tips (1 mm in thickness, 1 cm 2 cm in size) were
applied on both sides of the slide, and another clean slide
was placed on the probe-applied slide. The slides were
then clipped using double clips. The clipped slide set was
placed upside down on a metal tray with wet paper in it
and covered with a small plastic tray. The metal tray was
allowed to float on slightly boiling water for 5 min to denature the chromosomal DNA and probes (100 8C). The
153
slide set was then placed back on ice, and the clips were
removed. The slide was incubated in a sealed storage container with moist paper towel in it for 2–3 h at 55 8C.
After a stringent wash (55 8C, 2 SSC, 1 mmol/L EDTA,
20 min), the slides were allowed to drain. A drop of Vectashield mounting medium with 4’,6-diamidino-2-phenylindole
(DAPI) (Vector Laboratories, Inc., Burlingame, California)
was applied and the cells were covered with a 24 mm 32 mm cover glass. Fluorescent signals from each of the
three channels (DAPI, fluorescein, and Texas red) were captured through a 100 plan apochromatic oil objective using
a BX60 epifluorescence microscope (Olympus, Shinjuku-ku,
Tokyo, Japan) with an EOS Kiss X2 camera (Canon, Ootaku, Tokyo, Japan) and a camera adaptor provided by MeCan
Imaging, Inc. (Fujimino-shi, Saitama, Japan, http://www.
mecan.co.jp/index.html). Computerized background reduction and image feature intensification were applied using
the curve command of the Photoshop software (Adobe Systems, San Jose, California).
Reprobing procedure
After capturing images, the cover slip was removed, and
the slide was washed gently with flashing water from a distilled water-filled washing bottle. The slide was submerged
in a boiling 2 SSC buffer (100 8C) for 5 min. The slide
was washed again with distilled water and then rinsed with
100% ethanol briefly and air dried. One drop of a 1,4-diazabicyclo[2.2.2]octane (DABCO)-based antifade mounting medium (a mixture of 0.233 g DABCO; 200 mL 1 mol/L TrisHCl, pH 8.0; 800 mL distilled water; 9 mL glycerin; 15 mg
DAPI) was applied to the marked position of the chromosome spread. The chromosome spread was observed using
the epifluorescence microscope to confirm the disappearance
of the fluorescent signals. If there was any remnant of fluorescent signals, the chromosome spread was exposed to a
blue excitation light for a few minutes to quench the fluorochrome. The slide was washed with distilled water and
rinsed with ethanol as described before. The dried slide was
observed using a phase contrast microscope to confirm the
integrity of the chromosome spread. If so, the slide was
ready for another round of in situ hybridization.
This study uses internationally agreed upon chromosome
nomenclature (Linde-Laursen et al. 1997; Cuadrado and
Jouve 2007).
Results
Among 2000 colonies, 56 had PCR products that showed
a smear or ladder pattern after gel electrophoresis (Fig. 1).
Texas-red-labeled FISH trials showed that 42 clones produced probes that exhibited distinctive or smear fluorescent
signals on the Minorimugi chromosome spreads (Table 1).
Among these FISH-positive repeated sequences, pHv-365
(GenBank
accession
No.
HM536200),
pHv-177
(HM536201),
pHv-1112
(HM536206),
pHv-689
(HM536203),
pHv-1476
(HM536208),
pHv-1889
(HM536209), and pHv-1972 (HQ213972) were newly identified clones. The clone pHv-177 shows distinctive signals
on the short arm of 1H on Minorimugi but not on the 1H
chromosomes of Emir or Plaisant (Fig. 2). This clone also
distributes to the centromere regions of all chromosomes,
Published by NRC Research Press
154
Signal distribution or homologous sequence
Chromosome 1H, 2H, 4H, and 6H
GAA simple sequence repeat related
5S ribosomal DNA
Chromosome 1H short-arm tip and centromere
Subtelomere HVT01
H. vulgare repetitive sequence pHvMWG2315
Centromere
Chromosome 1H long-arm tip, 70 bp repeat
Pericentric diffused signal
Clone No.
pHv-365ab
pHv-90, pHv-607, pHv-888, pHv-889, pHv-890, pHv-1053, pHv-1453, pHv-1503, pHv-1659, pHv-1966, pHv-1993
pHv-38a, pHv-413, pHv-660, pHv-1744
pHv-177ab
pHv-961a, pHv-1457
pHv-496, pHv-580, pHv-874, pHv-1123a, pHv-1390, pHv-1468, pHv-1631, pHv-1982
pHv-619, pHv-654, pHv-869, pHv-875a, pHv-986, pHv-987, pHv-1110, pHv-1234, pHv-1253
pHv-1112ab
pHv-689b, pHv-1216, pHv-1476b, pHv-1889b, pHv-1972b
Note: Sequences presented here are registered in GenBank as accession numbers, HM536200 to HM536209 and HQ213945 to HQ213972.
a
Sequences used in the FISH signal detection in this report for karyotyping.
Newly identified FISH positive sequences in barley.
b
Genome Vol. 54, 2011
Fig. 2. Signal distribution of the newly identified FISH-positive sequences pHv-177 and pHv-1112. (a) Minorimugi: distinctive signals of pHv-1112 (1H long-arm tip, green) and pHv-177 (1H shortarm tip, red) are observed. The FISH probe pHv-177 also produces
signals on the centromere region on all chromosomes at various
degrees; the chromosome 3H shows relatively stronger centromeric
signals than the others. (b) Plaisant: the 1H short-arm tip pHv-177
signals are not observed. (c) Emir: neither pHv-177 nor pHv-1112
chromosome 1H tip signals are observed; however, centromeric
signals of pHv-177 are observed. Bar = 10 mm.
Published by NRC Research Press
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Table 1. List of 42 FISH-positive clones identified in this study in barley.
Kato
155
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Fig. 3. Probe combination and assignments of pseudo-colors to each probe on the root tip chromosomes of cultivar Emir. Lane 1, the combination of five probes: pHv-38 as red, TAG as green, pHv-961 as purple (pseudo-color), pHv-365 as yellow (pseudo-color), and GAA as
light blue (pseudo-color). Lane 2, distribution of the three sequences alone, i.e., pHv-38, pHv-365, and GAA. Lane 3, distribution of the two
sequences TAG and pHv-961; the red signals are the centromere sequence of pHv875. Lane 4, distribution of pHv-1123 sequence (yellow,
pseudo-color). A chromosome distal-enriched distribution pattern is observable. Lane 5, signals of GAA (green) and TAG (red, pseudocolor) are overlaid. Chromosome identifications become easier. Lane 6, DAPI staining. Secondary constrictions of chromosome 5H and 6H
are conspicuous on this photo; however, these features are difficult to observe at a more condensed state. Bar = 10 mm.
but 3H is clearly stronger than other signals. This clone is
764 bp in length, and the sequence, which is unique in barley, is partially (75–129 bp) homologous to cDNA clones in
wheat (AK333442), barley (AK249337), and a microsatellite
sequence in rye (EU339055).
The clone pHv-1112 shows distinctive FISH signals at the
tip of the long arm of 1H on Minorimugi and Plaisant but
not in Emir (Fig. 2). This sequence is 504 bp and consists
of seven tandem repeats of 70 bp units. This sequence is homologous to several rice genomic sequences.
The clone pHv-365 shows distinctive FISH signals on 1H,
4H, and 6H centromeric or pericentromeric regions, plus a
faint signal on the short arm of 2H (Fig. 3). All the chromosomes exhibit a slight background signal, which indicates a
wide distribution of this sequence across the entire barley
genome. This clone is 604 bp in length and includes three
repeats of a 119 bp sequence. This pHv-365 sequence was
identified in two barley contigs; one was 518 kbp
(EF067844) and the other was 155 kbp (FJ477091). BACs
of Triticum spp. also contain homologous sequences.
The clones pHv-689 (168 bp), pHv-1476 (776 bp), pHv1889 (281 bp), and pHv-1972 (194 bp) showed a diffused
pericentric-enriched signal on all barley chromosomes (data
not shown). The pHv-689 clone had homology to sequences
Published by NRC Research Press
156
Genome Vol. 54, 2011
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Fig. 4. A chromosome spread of the barley cultivar Emir. (a) The combination of the five probes, sequences, and color assignments are the
same as those in Fig. 3. (b) The combination of the three probes. Bar = 10 mm.
found in both the 518 kbp (EF067844) and 155 kbp
(FJ477091) barley contigs. The clone pHv-1476 is 776 bp
in length and consists of similar 366 bp and 372 bp sequences. Clone pHv-1972 is a part of either the 366 or the 372
sequence of clone pHv-1476. Half of the sequence is basically composed of GA, GAA, and GAAA motifs with low
complexity but is different from the GAA simple sequence
repeat. These sequences are found in a 518 kbp (EF067844)
barley contig and a 115 kbp barley BAC clone (AY485643).
The sequence of pHv-1972 is 84% homologous to a rye microsatellite sequence (275 bp, EU338794).
The remainder of the FISH-positive clones had sequences
that were already reported and well characterized. Four
clones possessing the 5S repeat (Gerlach and Dyer 1980;
Fukui et al. 1994) were isolated. Eleven clones possessed
the GAA microsatellite and nine had centromere sequences;
most of the latter were the AGGGAG repeat (Hudakova et
al. 2001). The FISH signal positions of the GAA microsatellite motifs corresponded with the C bands of barley (Kakeda
et al. 1991; Pedersen et al. 1996). Two clones had the
HVT01 telomere sequence (Kilian and Kleinhofs 1992;
Brandes et al. 1995; Pedersen et al. 1995), and eight clones
possessed the pHvMWG2315 (324 bp) repeated sequence
(Busch et al. 1996). This last repeat is homologous to wheat
pAs1 and pTa1 sequences (Nagaki et al. 1995; Tsujimoto et
al. 1997; Taketa et al. 2000).
Four clones obtained in this current study, pHv-38
(HM536200), pHv-365, pHv-961 (HM536205), and pHv1123 (HM536207), and two synthesized microsatellite sequences, GAA and TAG (Cuadrado and Jouve 2007), were
selected to develop an efficient karyotyping procedure. The
procedure involved reprobing Emir chromosome spreads.
First, a probe mixture of fluorescein-labeled TAG microsatellite and Texas-red-labeled pHv-38 was hybridized and imaged. After striping, the spreads were rehybridized with a
probe mixture of fluorescein-labeled GAA and Texas-red-labeled pHv-365. A third hybridization was made with a
probe mixture of fluorescein-labeled pHv-961 and Texasred-labeled pHv-1123. A final hybridization was made with
a Texas-red-labeled centromere repeat sequence pHv-875
(HM536204). The images were pseudo-colored and overlaid
(Figs. 3 and 4). From the results, the author proposes two
karyotyping probe combinations. The first combination allows for the instant identification of each chromosome, and
it consists of pHv-38 (5S), pHv-365, pHv-961 (HVT01), and
the two synthesized microsatellite sequences GAA and
TAG. The second probe combination is for high-density
chromosome labeling; it is a mixture of pHv-1123 (barley
324 bp repeat) and the two synthesized microsatellite sequences GAA and TAG (Figs. 3 and 4).
When the five probes pHv-38 (5S), pHv-365, pHv-961
(HVT01), GAA, and TAG were tested against chromosome
spreads from Emir and Minorimugi, they yielded consistent
chromosome identification for those cultivars as well
(Fig. 5). Even so, there was considerable variation especially
for the TAG microsatellite signals (Fig. 6). The signal
strength of pHv-38 (5S) was variable among lines. The 5S
signal of the 4H long arm was not observable on Minorimugi; instead, the 5S signal on the long arm of 2H was
brighter than that of Emir or Plaisant. The signals of pHv365 and pHv-961 were consistent between lines. The signals
of the GAA microsatellite were relatively consistent but
with some variability. With this probe, chromosome 4H was
easily identified in all cultivars.
The features of each chromosome are as follows using the
color scheme on Fig. 5:
Chromosome 1H. A pHv-365 signal (yellow) is present
at the centromere region, and this is the smallest chromosome.
Published by NRC Research Press
Kato
157
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Fig. 5. Signal distributions of the barley cultivars Emir, Plaisant, and Minorimugi. The combination of the five probes (upper), sequences,
and color assignments are the same as those in Fig. 3 (pHv-38 as red, TAG as green, pHv-961 as purple, pHv-365 as yellow, and GAA as
light blue). Seven pairs of chromosomes are clearly identified. TAG green signals are polymorphic. The Minorimugi 5S 4H long arm signal
was not detectable. In the combination of the three probes (lower), the chromosome arms are labeled with fine clusters of three color dots
(pHv-1123 yellow, GAA green, and TAG red). The chromosomes are cut from a single chromosome spread. Bar = 10 mm.
Chromosome 2H. A pHv-38 (5S) signal (red) is at the
distal region of the long arm; a signal for pHv-961
(purple) at the long-arm tip is absent or very weak,
and a diffused pHv-365 signal (yellow) is present at
the proximal region of the short arm.
Chromosome 3H. A pHv-38 (5S) signal (red) is present
in the distal region of the long arm, but unlike 2H a
pHv-961 (purple) signal is present at the tip of the
long arm.
Chromosome 4H. There are abundant GAA (blue) signals in the pericentric region and a strong pHv-365
(yellow) signal at the proximal region of the long arm.
Chromosome 5H. A secondary constriction is present
at the short arm, and the signal of pHv-961 (purple) at
the tip of the long arm is absent or very weak.
Chromosome 6H. This chromosome also has a secondary constriction of the short arm, but the pHv-961
(purple) signal is present at the tip of the long arm. In
addition, a pHv-365 signal (yellow) is present on the
proximal region of the short arm.
Chromosome 7H. A pHv-38 (5S) signal (red) is present
on the proximal region of the long arm.
The second probe combination of pHv-1123 (barley 324
bp repeat), GAA, and TAG yielded high-density labeling on
three cultivars (Fig. 5). The pHv-1123 signals are abundantly distributed throughout all chromosomes and enriched
at the distal ends of barley chromosomes. Finely dotted
granular structures were observed on the interstitial region
of chromosomes. The sequence pHv-1123 is particularly
densely distributed on chromosome 7H.
Discussion
The DNase-I-digested genomic TA cloning procedure presented here is highly effective to separate FISH-positive repeated sequences. A tandemly repeated DNA sequence often
lacks restriction sites and the use of DNase I for digestion is
preferable. DNase-I-digested DNA fragments are very fragile because of the presence of nicks along the digested
strands, which tend to produce shorter fragments during hanPublished by NRC Research Press
158
Genome Vol. 54, 2011
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
Fig. 6. Polymorphic nature of TAG microsatellite sequence distribution. On chromosomes 4H, 5H, and 6H the distributions are polymorphic. Bar = 10 mm.
dling. Heat treatment just after digestion facilitated fragmentation and alleviated further fragmentation after cooling. The
TA cloning procedures prevented ligations among digested
genomic DNA fragments, thus preventing the emergence of
plasmids with chimeric DNA inserts. The stbl4 cell, a specifically engineered cell to keep tandem or inverted repeats,
also contributed to the current results.
Among the 56 PCR selected clones, 42 were FISH positive (75%). In a preliminary experiment, only 1.5% (3/200)
of all barley clones were FISH positive; consequently, the
PCR–gel assay effectively identified repeated sequences and
improved the screening efficiency. The reason that PCR
products of directly repeated sequences appear as a smear
or a ladder in electrophoresis is because in each PCR cycle,
not only do the primers anneal to the denatured template
strands, but the denatured PCR products also anneal to each
other. In addition, because DNA polymerase synthesis can
stop at random points, incomplete strands anneal to each
other in various ways if they include repeated sequences.
They then produce shorter or longer chains that are multiples of repeated unit lengths.
Among the 42 clones that yielded FISH signals, 35 possessed known sequences and the distributions of their FISH
signals have been reported. Of the seven clones that had
newly identified sequences, pHv-177, pHv-365, and pHv1112 produced discrete signals on chromosomes. The pHv177 and pHv-1112 signals are variable between lines; to
some degree, they can be used for chromosome 1H landmarks. The pHv-365 clone clearly contributes to the identification of barley chromosomes. Its signal distribution is
more consistent than that of the TAG microsatellite in this
study. This is why it was included in the first probe combination (five probes) for the immediate identification of barley chromosomes. The second probe combination (three
probes) is proposed to be useful in identifying break points
of rearranged chromosomes or incorporated segments of
alien chromosomes. In this experiment, somatic metaphase
chromosomes, which are in the most condensed state, were
used. If less condensed or more stretched chromosomes
were used (Valárik et al. 2004), the GAA and pHv-1123 signals would be seen as fine granular structures along the
chromosome arms. Only two probes, pHv-365 and pHv-38
(5S), are necessary to identify all of the barley chromosomes
and their orientation on the three lines tested here; however,
they showed no signal on 5H. In the current screening work,
the TAG microsatellite, 18S–25S rDNA (Leitch and HeslopHarrison 1992; Taketa et al. 1999), and TTTAGGG telomere repeat were not isolated as plasmid clones. Use of the
18S–25S gene as a FISH probe will improve the immediate
recognition of chromosomes 5H and 6H.
Early in the development of FISH in barley and wheat,
reprobing was employed (Heslop-Harrison et al. 1992; Mukai et al. 1993). Using directly labeled probes, FISH signals
are very discrete, and it takes only 5 h from slide preparation to image taking. As a result, it is possible to complete
two to three FISH rounds daily on the same slide. The formaldehyde treatment and the procedure to prevent dehydration
during denaturing (glass slide sandwich structure) make it
possible to conduct up to six hybridizations on the same
chromosome spread. The success rate of each reprobing is
about 80%. The reasons for failure are various: slide
scratches, dust or cell debris overlapping, chromosomes
swelling, insufficient fluorescent signal intensity, etc. The
chromosome dimensions increased 5%–20% during trials;
consequently, a precise signal position comparison was not
possible among trials.
The reprobing procedure presented here makes it possible
to achieve high-quality image capturing using a standard
three-channel epifluorescence microscope with a common
digital camera. An alternative procedure that has been used
to distinguish chromosome segments is to use a collection of
probes where each one has been labeled with a distinct mixture of fluorochromes. The images must be analyzed using
sophisticated systems, such as Spectral Karyotyping (SKY),
Published by NRC Research Press
Kato
Genome Downloaded from www.nrcresearchpress.com by University of Tennessee on 03/19/13
For personal use only.
products from MetaSystems or Applied Spectrum Imaging,
which use computerized image processing systems and gives
a pseudo-color to each spectral combinations. These systems
work better for animal chromosomes than for plants. In
plants, FISH probes using repeated sequences frequently
cause the computer image-processing systems to produce artifacts. The repeated reprobing procedure presented in this
paper is one solution for capturing discrete FISH images on
pseudo-colored multiple channels. There is potential to capture 12 channels if hybridizations are repeated six times on
the same chromosome spread.
Acknowledgements
The author thanks Andreas Houben (Leibniz Institute of
Plant Genetics and Crop Plant Research, Gatersleben, Germany) for providing Emir and Plaisant barley seeds, Lu Ma
(Leibniz Institute of Plant Genetics and Crop Plant Research, Gatersleben, Germany) for DNA sequence information, Donald Auger (South Dakota State University,
Brookings, South Dakota) for reviewing the manuscript, and
Kanami Suzuki (Kyoto Prefectural University, Kyoto, Japan)
for technical assistance.
References
Brandes, A., Röder, M.S., and Ganal, M.W. 1995. Barley telomeres
are associated with two different types of satellite DNA sequences. Chromosome Res. 3(5): 315–320. doi:10.1007/
BF00713070. PMID:7551546.
Brown, S.E., Stephens, J.L., Lapitan, N.L.V., and Knudson, D.L.
1999. FISH landmarks for barley chromosomes (Hordeum vulgare L.). Genome, 42(2): 274–281. doi:10.1139/gen-42-2-274.
PMID:10231961.
Busch, W., Herrmann, R.G., and Hohmann, U. 1996. Repeated
DNA sequences isolated by microdissection. II. Comparative
analysis in Hordeum vulgare and Triticum aestivum. Theor.
Appl. Genet. 93(1–2): 164–171. doi:10.1007/BF00225741.
Cuadrado, A., and Jouve, N. 2007. The nonrandom distribution of
long clusters of all possible classes of trinucleotide repeats in
barley chromosomes. Chromosome Res. 15(6): 711–720. doi:10.
1007/s10577-007-1156-8. PMID:17874212.
Fukui, K., Kamisugi, Y., and Sakai, F. 1994. Physical mapping of
5S rDNA loci by direct-cloned biotinylated probes in barley
chromosomes. Genome, 37(1): 105–111. doi:10.1139/g94-013.
Gerlach, W.L., and Dyer, T.A. 1980. Sequence organization of the
repeating units in the nucleus of wheat which contain 5S rRNA
genes. Nucleic Acids Res. 8(21): 4851–4865. doi:10.1093/nar/8.
21.4851. PMID:7443527.
Heslop-Harrison, J.S., Harrison, G.E., and Leitch, I.J. 1992. Reprobing of DNA: DNA in situ hybridization preparations.
Trends Genet. 8(11): 372–373. doi:10.1016/0168-9525(92)
90287-E. PMID:1440872.
Hudakova, S., Michalek, W., Presting, G.G., ten Hoopen, R., dos
Santos, K., Jasencakova, Z., and Schubert, I. 2001. Sequence organization of barley centromeres. Nucleic Acids Res. 29(24):
5029–5035. doi:10.1093/nar/29.24.5029. PMID:11812833.
Kakeda, K., Fukui, K., and Yamagata, H. 1991. Heterochromatic
differentiation in barley chromosomes revealed by C- and Nbanding techniques. Theor. Appl. Genet. 81(2): 144–150.
doi:10.1007/BF00215715.
Kato, A. 1999. Air drying method using nitrous oxide for chromosome counting in maize. Biotech. Histochem. 74(3): 160–166.
doi:10.3109/10520299909047968. PMID:10416789.
159
Kato, A., Lamb, J.C., and Birchler, J.A. 2004. Chromosome painting using repetitive DNA sequences as probes for somatic chromosome identification in maize. Proc. Natl. Acad. Sci. U.S.A.
101(37): 13554–13559. doi:10.1073/pnas.0403659101. PMID:
15342909.
Kato, A., Albert, P.S., Vega, J.M., and Birchler, J.A. 2006. Sensitive fluorescence in situ hybridization signal detection in maize
using directly labeled probes produced by high concentration
DNA polymerase nick translation. Biotech. Histochem. 81(2–3):
71–78. doi:10.1080/10520290600643677. PMID:16908431.
Kilian, A., and Kleinhofs, A. 1992. Cloning and mapping of telomereassociated sequences from Hordeum vulgare L. Mol. Gen.
Genet. 235(1): 153–156. doi:10.1007/BF00286193. PMID:
1359394.
Leitch, I.J., and Heslop-Harrison, J.S. 1992. Physical mapping of
the 18S–5.8S–26S rRNA genes in barley by in situ hybridization. Genome, 35(6): 1013–1018. doi:10.1139/g92-155.
Linde-Laursen, I., Heslop-Harrison, J.S., Shepherd, K.W., and Taketa, S. 1997. The barley geneome and its relationship with the
wheat genomes. A survey with an internationally agreed recommendation for barley chromosome nomenclature. Hereditas,
126(1): 1–16. doi:10.1111/j.1601-5223.1997.00001.x.
Mukai, Y., Nakahara, Y., and Yamamoto, M. 1993. Simultaneous
discrimination of the three genomes in hexaploid wheat by multicolor fluorescence in situ hybridization using total genomic
and highly repeated DNA probes. Genome, 36(3): 489–494.
doi:10.1139/g93-067. PMID:18470003.
Nagaki, K., Tsujimoto, H., Isono, K., and Sasakuma, T. 1995. Molecular characterization of a tandem repeat, Afa family, and its
distribution among Triticeae. Genome, 38(3): 479–486. doi:10.
1139/g95-063. PMID:7557360.
Pedersen, C., and Linde-Laursen, I. 1994. Chromosomal locations
of four minor rDNA loci and a marker microsatellite sequence
in barley. Chromosome Res. 2(1): 65–71. doi:10.1007/
BF01539456.
Pedersen, C., Giese, H., and Linde-Laursen, I. 1995. Towards an
integration of the physical and the genetic chromosome maps of
barley by in situ hybridization. Hereditas, 123(1): 77–88. doi:10.
1111/j.1601-5223.1995.00077.x.
Pedersen, C., Rasmussen, S.K., and Linde-Laursen, I. 1996. Genome and chromosome identification in cultivated barley and related species of the Triticeae (Poaceae) by in situ hybridization
with the GAA-satellite sequence. Genome, 39(1): 93–104.
doi:10.1139/g96-013. PMID:8851798.
Taketa, S., Harrison, G.E., and Heslop-Harrison, J.S. 1999. Comparative physical mapping of the 5S and 18S–25S rDNA in
nine wild Hordeum species and cytotypes. Theor. Appl. Genet.
98(1): 1–9. doi:10.1007/s001220051033.
Taketa, S., Ando, H., Takeda, K., Harrison, G.E., and HeslopHarrison, J.S. 2000. The distribution, organization and evolution of two abundant and widespread repetitive DNA sequences in the genus Hordeum. Theor. Appl. Genet. 100(2):
169–176. doi:10.1007/s001220050023.
Tsujimoto, H., Mukai, Y., Akagawa, K., Nagaki, K., Fujigaki, J.,
Yamamoto, M., and Sasakuma, T. 1997. Identification of individual barley chromosomes based on repetitive sequences: conservative distribution of Afa-family repetitive sequences on the
chromosomes of barley and wheat. Genes Genet. Syst. 72(5):
303–309. doi:10.1266/ggs.72.303. PMID:9511227.
Valárik, M., Bartos, J., Kovárová, P., Kubaláková, M., de Jong,
J.H., and Dolezel, J. 2004. High-resolution FISH on superstretched flow-sorted plant chromosomes. Plant J. 37(6): 940–
950. doi:10.1111/j.1365-313X.2003.02010.x. PMID:14996224.
Published by NRC Research Press