Документ 2687993

Реклама
иммунология № 2, 2013
57.Vourvahis M., Tappouni H.L., Patterson K.B. et al. The pharmacokinetics and viral activity of tenofovir in the male genital tract.
J. Acquir. Immune Defic. Syndr. 2008; 47: 329–33.
58.Wang L.H., Begley J., St Claire R.L., 3rd et al. Pharmacokinetic
and pharmacodynamic characteristics of emtricitabine support its
once daily dosing for the treatment of HIV infection. AIDS Res.
Hum. Retrovirus. 2004; 20: 1173–82.
59.Watson-Jones D., Baisley K., Rusizoka M. et al. Measurement
and predictors of adherence in a trial of HSV suppressive therapy
in Tanzania. Contemp. Clin. Trials. 2009; 30: 504–12.
60.Weber J., Chakraborty B., Weberova J., et al. Diminished replicative fitness of primary human immunodeficiency virus type 1
isolates harboring the K65R mutation. J. Clin. Microbiol. 2005;
43: 1395–1400.
61.www.prepwatch.org.
Поступила 31.10.12
Молекулярная иммунология и иммуногенетика
© М.В. Пащенков, Б.В. Пинегин, 2013
УДК 612.112.94.017.1:577.21.08
Пащенков М.В., Пинегин Б.В.
Экспрессия CD8-ассоциированных генов в циркулирующих CD4+
цитотоксических лимфоцитах у здоровых доноров
Лаборатория клинической иммунологии ФГБУ ГНЦ Институт иммунологии ФМБА России, г. Москва (115478,
Каширское ш., д. 24, корп. 2)
Циркулирующие CD4+-цитотоксические Т-лимфоциты (CD4+-ЦТЛ) представляют собой атипичную субпопуляцию
CD4+ Т-клеток, которая обладает некоторыми свойствами, присущими CD8+ Т-лимфоцитам (наличие литических
гранул, цитотоксических белков и клеточной цитотоксичности). В настоящей работе показано, что в CD4+-ЦТЛ по
сравнению с обычными CD4+ Т-клетками повышена экспрессия факторов транскрипции RUNX3 и эомезодермина,
необходимых для дифференцировки и поддержания фенотипа CD8+ Т-лимфоцитов, а также снижена экспрессия
фактора транскрипции ZBTB7B, играющего ключевую роль в дифференцировке и поддержании фенотипа CD4+
Т-лимфоцитов. Эти изменения в CD4+-ЦТЛ проявляются фенотипически в виде повышения экспрессии перфорина
и гранзима B, снижения экспрессии CD4 и появления невысокой экспрессии CD8 на 20–30% CD4+-ЦТЛ. Таким образом, в основе дифференцировки CD4+ ЦТЛ из обычных CD4+ Т-клеток может лежать частичное переключение
транскрипционной программы с CD4-типа на CD8-тип.
К л ю ч е в ы е с л о в а : CD4+-цитотоксические Т-лимфоциты, CD4, CD8, RUNX3, ZBTB7B, эомезодермин
Pashenkov MV, Pinegin BV.
Expression of CD8-associated genes in the circulating CD4+ cytotoxic T lymphocytes
The circulating CD4+ cytotoxic T lymphocytes (CD4+ CTL) represent an atypical subpopulation of CD4+ T cells that possesses
some features of CD8+ T lymphocytes (lytic granules, expression of cytotoxic proteins, cell-mediated cytotoxicity). Here we
show that CD4+ CTL, as compared to "ordinary" CD4+ T cells, display an elevated expression of RUNX3 and eomesodermin,
two transcription factors that are vital for differentiation of CD8+ T lymphocytes and for the maintenance of their phenotype.
This is accompanied by the reduced expression of ZBTB7B, a transcription factor playing a key role in the differentiation
of CD4+ T lymphocytes. These changes of transcription factors observed in the CD4+ CTL penetrate phenotypically as an
elevated expression of perforin and granzyme B, diminished expression of CD4 and appearance of low CD8 expression
on 20–30% of CD4+ CTL. Thus, differentiation of CD4+ CTL from "ordinary" CD4+ T cells may be driven by a partial switch
of the transcriptional program from the "CD4 type" to the "CD8 type".
K e y w o r d s : CD4+ cytotoxic T lymphocytes; CD4; CD8; RUNX3; ZBTB7B; eomesodermin
Введение. CD4+-цитотоксические Т-лимфоциты (CD4+ЦТЛ), циркулирующие в крови, представляют собой атипичную субпопуляцию CD4+ Т-клеток, которая обладает некоторыми свойствами, присущими CD8+ Т-лимфоцитам. Так,
CD4+-ЦТЛ содержат литические гранулы, в которых присутствуют цитотоксические белки, они способны дегранулировать и убивать клетки-мишени [1, 3, 5]. Характерной чертой
CD4+-ЦТЛ являются утрата экспрессии костимуляторной молекулы CD28 и появление маркера терминальной дифференПащенков Михаил Владимирович (Pashchenkov Mikhail
Vladimirovich), e-mail: [email protected]
цировки CD57, ассоциированного с наступлением клеточной
старости [4, 14]. Механизмы дифференцировки CD4+-ЦТЛ
изучены недостаточно хорошо, однако многократно продемонстрирована связь между повышенным содержанием этих
клеток и наличием латентной цитомегаловирусной инфекции [3, 5, 14].
Приобретение CD4+ Т-клетками некоторых свойств
CD8+ Т-клеток, вероятно, требует активации соответствующей транскрипционной программы. Известно, что при
дифференцировке Т-клеток в тимусе формирование фенотипа CD8+CD4– обеспечивается факторами транскрипции
RUNX1 и RUNX3, а формирование фенотипа CD8–CD4+
– факторами транскрипции GATA-3 и ZBTB7B (другое на-
– 72 –
Молекулярная иммунология и иммуногенетика
Таблица 1
звание – ThPOK) [16, 17]. Недавно
показано, что некоторые из этих Праймеры, использованные в работе
факторов транскрипции необхоАмпликон
димы для поддержания фенотипа
Ген
Белок
Праймер
Последовательность (5’ → 3’)
(п. о.)
Т-клеток и после выхода из тимуса. Так, ZBTB7B экспрессируется B3GAT1 CD57
Прямой
TGTGAGTGCTGGTAATGAGGAGCCG
185
в циркулирующих CD4+ Т-клетках
Обратный TTTCGCGTCGGGGGTCACTG
[13] и подавляет в них экспрессию генов, характерных для CD8- CD28
CD28
Прямой
GGTGCTGGTGGTGGTTGGTGG
134
линии (CD8, перфорин, гранзим
Обратный GGCGGCGGGGAGTCATGTTC
B) [15]. У мышей с гипофункцией
Перфорин
Прямой
GAGCCACAGTGGGCTGCCTG
116
PRF1
ZBTB7B или с его избирательным
нокаутом в циркулирующих CD4+
Обратный GGGCTGCCATGGAGCTGGAATC
Т-клетках происходит RUNX3Гранзим
B
Прямой
ACAGCAGCTCCAACCAGGGC
193
GZMB
зависимая реактивация экспрессии CD8-ассоциированных генов
Обратный AGGAAGCCACCGCACCTCTTCA
[15]. Кроме того, RUNX3 совмест- RUNX3 RUNX3
Прямой
GGTGCGCTCGATGGTGGACG
169
но с другим фактором транскрипОбратный CACCACCGTACCATCCGGCAC
ции – эомезодермином (EOMES)
– контролирует дифференци- EOMES Эомезодермин
Прямой
GCAACCGGCCTCTGTGGCTC
174
ровку наивных CD8+ Т-клеток в
Обратный GGAAGCGCCAGTGGTTGGGG
эффекторные
цитотоксические
Т-лимфоциты [6]. Этот процесс ZBTB7B Zbtb7b/ThPOK
Прямой
GGGGACGCGCTTCTTCCCAC
130
сопровождается повышением эксОбратный GCTCACTGCTGTGGTCCGGG
прессии перфорина, гранзима B и
-Галактозидаза
Прямой
ACGCTCCCGGCCTTTTATATGGG
164
β
GLB1
формированием литических гра1
нул. Можно предположить, что
Обратный AAGGTCAACTGAGGGCCCCG
факторы транкскрипции RUNX3,
p21
Прямой
CTGCGCCAGCTGAGGTGTGAG
144
CDKN1A
эомезодермин и ZBTB7B (точнее,
изменение уровня их экспресОбратный TGCCGCATGGGTTCTGACGG
сии) контролируют приобретеГлицеральдегидПрямой
CAGCCTCCCGCTTCGCTCTC
143
GAPDH
ние обычными CD4+ Т-клетками
фосфатдегидроОбратный ACCAGGCGCCCAATACGACC
свойств ЦТЛ. Однако этот вопрос
геназа
пока не нашел отражения в литеП р и м е ч а н и е . п. о. –
ратуре.
В настоящей работе с помощью полимеразной цепной реакции в реальном времени
primer-blast/index.cgi); последовательности указаны в
(ПЦР-РВ) провели сравнение экспрессии четырех групп гетабл. 1. Амплификацию проводили с использованием сменов в циркулирующих CD4+ ЦТЛ по сравнению с обычными
си реактивов фирмы "Синтол" (Россия) на приборе 7300
CD4+ Т-клетками: 1) генов поверхностных маркеров CD4+
Real Time PCR System (Applied Biosystems, США). Для деЦТЛ (CD57/B3GAT1, CD28); 2) генов цитотоксических белтекции ампликонов использовали краситель SYBR Green.
ков (перфорин, гранзим B); 3) генов факторов транскрипции
Амплификацию GAPDH и RUNX3 проводили при следую(ZBTB7B, RUNX3, эомезодермин); 4) генов, ассоцированных
щих условиях: начальная денатурация – 95°С, 5 мин., зас клеточной старостью (GLB1, p21/CDKN1A).
тем 40 циклов (95°С/15 с; 60°С/45 с) с детекцией сигнала
Материалы и методы. Выделение CD4+-ЦТЛ и обычных
в конце каждого цикла. При амплификации остальных геCD4+ Т-клеток из крови. Венозная кровь была получена от
нов циклы состояли из трех стадий (95°С/15 с; 60°С/40 с;
5 клинически здоровых доноров в возрасте от 27 до 50 лет с
T°C/35 c) с детекцией при T°C, с тем чтобы устранить
высоким содержанием CD57+CD4+-ЦТЛ (от 6,1 до 41% среди
неспецифический сигнал от низкомолекулярных неспецвсех CD4+ Т-клеток; M±σ = 22,2±15,1%). Мононуклеарные
ифических продуктов. При амплификации GZMB, PRF1,
клетки (МНК) выделяли на градиенте плотности фиколлGLB1 и CD28 устанавливали T = 85°C, EOMES – T = 86°C,
урографина ("ПанЭко", Россия). Из выделенных МНК пуB3GAT1 (CD57), ZBTB7B и CDKN1A (p21) – T = 88°C.
тем негативной иммуномагнитной селекции выделяли CD4+
Если специфическая амплификация данного гена в данТ-клетки, используя реактивы и оборудование фирмы Milteном образце отсутствовала, то Ct принимали равным 40.
nyi Biotec (Германия). Затем с помощью парамагнитных
Специфичность амплификации подтверждали путем аначастиц, конъюгированных с антителами к CD57 (Miltenyi
лиза кривых плавления (наличие единственного пика на
Biotec, Германия), популяцию CD4+ Т-клеток делили на
графике в координатах "температура – 1-я производная от
CD57+-фракцию (CD4+-ЦТЛ) и CD57–-фракцию (обычные
интенсивности сигнала" в области температур, выше или
CD4+ Т-клетки). По данным проточной цитометрии, чистота
равных температуре детекции).
CD57+- и CD57–-фракций была > 90% (по процентному соОтносительную экспрессию (ОЭ) каждого гена вычислядержанию, соответственно, CD4+CD57+CD28– и CD4+CD57–
ли отдельно у каждого донора по методу 2–ΔΔCt с нормализаCD28+-клеток). Выделенные клетки отмывали в фосфатноцией по гену GAPDH:
солевом буфере и лизировали в TriReagent (Sigma, США).
ОЭ = 2–ΔΔCt = 2–((Ct ген обр. 1. – Ct ген обр. 2) – (Ct GAPDH обр. 1 – Ct GAPDH обр. 2)),
где Ct – пороговый цикл, ген – любой исследуемый ген, обр. 1
ПЦР-РВ. Общую РНК выделяли из клеточных лиза– образец CD4+ ЦТЛ, обр. 2 – образец обычных CD4+ Т-клеток
тов согласно инструкции, прилагаемой к реактиву TRI
того же донора, в котором экспрессия данного гена принимаReagent. 1 мкг РНК подвергали обратной транскрипции с
ется равной единице. Для статистического анализа данные
помощью набора реактивов RevertAid (Fermentas, Литва);
переводили в логарифмическую форму (log2 ОЭ).
в качестве праймера использовали гексамеры случайной
Проточная цитометрия. Иммунофенотипирование CD4+
последовательности. Праймеры для ПЦР обратного трансЦТЛ и обычных CD4+ Т-клеток проводили с помощью слекрипта в РВ (ПЦР-РВ) конструировали с помощью продующих моноклональных антител производства Beckman
граммы Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/
– 73 –
иммунология № 1, 2013
Таблица 2
Относительная экспрессия ОЭ генов в CD4+-ЦТЛ по сравнению с таковой
обычных CD4+ Т-клеток (M±σ)
Ген
Белок
log2 ОЭ
Направление
изменения*
559,8±556,9
5,84±4,29**
↑
0,00033±0,000006
–11,59±0,26**
↓
ОЭ
Поверхностные маркеры
B3GAT1
CD57
CD28
CD28
Цитотоксические белки
PRF1
Перфорин
107,1±67,7
6,38±1,08**
↑
GZMB
Гранзим B
12,8±9,4
3,11±1,36**
↑
RUNX3
RUNX3
4,7±1,1
2,19±0,34**
↑
EOMES
Эомезодермин
1264,8±1256,6
7,16±4,14**
↑
ZBTB7B
Zbtb7b/ThPOK
0,25±0,06
–2,04±0,34**
↓
Факторы транскрипции
Белки, ассоциированные с клеточной старостью
GLB1
CDKN1A
β1-галактозидаза
0,52±0,12
–0,95±0,28**
↓
p21
0,47±0,21
–1,26±0,69**
↓
П р и м е ч а н и е . * – направление изменения экспрессии генов в CD4+-ЦТЛ
по сравнению с таковым обычных CD4+ Т-клеток; ** – p < 0,05 при сравнении
CD4+-ЦТЛ и обычных CD4+ Т-клеток парным t-тестом Стьюдента.
Coulter (США): анти-CD57 (FITC), анти-CD8 (FITC), антиCD28 (фикоэритрин), анти-CD4 (PC5), анти-CD3 (ECD).
Образцы анализировали на проточном цитометре Cytomics FC500 с использованием программы CXP (все Beckman
Coulter, США).
Статистическая обработка данных. Парные показатели
в CD4+ ЦТЛ и обычных CD4+ Т-клетках сравнивали с помощью парного t-теста Стьюдента.
Р е з у л ь т а т ы . Сравнение экспрессии генов в CD4+
ЦТЛ и обычных CD4+ Т-клетках ex vivo. Как и ожидалось,
экспрессия мРНК B3GAT1 (CD57) в CD4+-ЦТЛ была в среднем в 560 раз выше, чем в обычных CD4+ Т-клетках; напротив, экспрессия CD28 в CD4+-ЦТЛ была снижена примерно в
3000 раз (табл. 2). Экспрессия мРНК PRF1 и GZMB в CD4+ЦТЛ была повышена соответственно в 107 и 13 раз по сравнению с таковой обычных CD4+-Т-клеток (см. табл. 2), что
согласуется с данными других авторов [2], и с экспрессией
этих генов на уровне белковых продуктов [3, 14].
Наиболее примечательной находкой оказались изменения
экспрессии ZBTB7B, RUNX3 и EOMES (см. табл. 2). Так, экспрессия мРНК RUNX3, отвечающего за дифференцировку
CD8+ Т-клеток [6, 17], в CD4+-ЦТЛ была в 4,7 раза выше, чем
в обычных CD4+ Т-клетках. Экспрессия EOMES, необходимого
для приобретения CD8+ Т-клетками фенотипа цитотоксических
лимфоцитов [6], в CD4+-ЦТЛ была повышена приблизительно
в 1200 раз. В то же время экспрессия ZBTB7B, отвечающего
за приобретение и поддержание фенотипа CD8–CD4+ [15, 16], в
CD4+-ЦТЛ была снижена в 4 раза (см. табл. 2). Таким образом,
можно предположить, что появление экспрессии перфорина и
гранзима B, наблюдаемое в CD4+-ЦТЛ, обусловлено повышением экспрессии факторов транскрипции RUNX3 и эомезодермина, контролирующих экспрессию этих белков.
Вопреки ожиданиям экспрессия генов, ассоциированных
с клеточным старением – GLB1 (бета-галактозидаза, ассоциированная со старением [9]) и CDKN1A (p53-индуцибельный
белок p21), – в CD4+-ЦТЛ ex vivo оказалась примерно в 2 раза
ниже, чем в обычных CD4+ Т-клетках (см. табл. 2). Это, однако, не исключает возможности возрастания экспрессии этих
генов при активации CD4+-ЦТЛ in vitro и in vivo.
Снижение экспрессии CD4 и повышение экспрессии CD8
на CD4+ ЦТЛ ex vivo. Поскольку одной из основных функций
RUNX3 и ZBTB7B является контроль поверхностного фено-
типа Т-клеток, изучали экспрессию CD4 и CD8 на
CD4+-ЦТЛ и обычных CD4+ Т-клетках у 5 обследованных доноров. Средняя интенсивность флюоресценции CD4 на обычных CD4+ Т-клетках составила
108,1±25,8 усл.ед., тогда как на CD4+-ЦТЛ она была
снижена в 1,7 раза, составив 63,1±16 усл.ед. (p <
0,01). Аналогичные изменения ранее наблюдали
как наша, так и другие группы [1, 8].
В литературе давно описана субпопуляция
Т-клеток с фенотипом CD4+CD8dim, которая обычно
составляет менее 2% Т-клеток (см. рисунок, а), однако в редких случаях может достигать 40% общего количества Т-клеток [10, 11]. CD4+CD8dim-клетки
имеют морфологию больших гранулярных лимфоцитов и экспрессируют маркер CD57, что указывает на их принадлежность к CD4+-ЦТЛ [10]. У обследованных нами доноров тоже имелась довольно
значительная субпопуляция Т-клеток с фенотипом
CD4+CD8dim (см. рисунок, б; для сравнения на рисунке а показаны Т-клетки контрольного донора с
низким содержанием CD4+-ЦТЛ). Результаты фенотипического анализа подтвердили, что большинство CD4+CD8low-клеток содержится во фракции
CD4+-ЦТЛ и не экспрессирует CD28 (см. рисунок,
в, г). Процентное содержание CD4+CD8dim-клеток
среди CD4+CD28–-ЦТЛ составило 24,1±6,3%, среди
обычных CD4+ Т-клеток – лишь 1,4±1,1%. Следует
подчеркнуть, что экспрессия CD8 на CD4+CD8dimЦТЛ была на порядок ниже, чем на CD4–CD8+
Т-клетках (см. рисунок, б).
Экспрессия CD8 на CD4+ ЦТЛ.
а – CD3+ Т-клетки донора с высоким содержанием CD4+ ЦТЛ (31% от
CD4+ Т-клеток). Регионами выделены популяции CD4+CD8– Т-клеток,
CD4+CD8dim Т-клеток и CD4–CD8+-клеток. CD4+CD8dim клетки составляют 5,9% от всех Т-клеток, б – для сравнения показаны клетки донора 2 с
низким содержанием CD4+ ЦТЛ (1% от CD4+ Т-клеток). У этого донора
CD4+CD8dim клетки составляют 5,9% от всех Т-клеток, в и г – экспрессия
CD8 и CD28 на изолированных CD4+ ЦТЛ (в) и обычных CD4+ Т-клетках
(г) одного и того же донора. Указано процентное содержание клеток в
соответствующем регионе или квадранте по отношению ко всем клеткам
на графике.
– 74 –
Молекулярная иммунология и иммуногенетика
О б с у ж д е н и е . V. Appay и соавт. [2], сравнив транскриптомы CD8+ и CD4+ Т-клеток, пришли к выводу о том,
что по мере дифференцировки той и другой субпопуляции Т-клеток их транскриптомы становятся все более схожими, причем наибольшее сходство наблюдается между
терминально
дифференцированными
субпопуляциями
CD8+CD57+CD28– и CD4+CD57+CD28–. Настоящая работа позволяет предположить, что в основе этого феномена лежат
изменения экспрессии факторов транскрипции в CD4+ ЦТЛ:
повышение экспрессии RUNX3 и эомезодермина, характерных для CD8+ Т-клеток, и понижение экспрессии ZBTB7B,
необходимого для поддержания фенотипа CD4+CD8-. Эти
изменения экспрессии факторов транскрипции могут быть
взаимосвязаны, поскольку известно, что RUNX3 может подавлять экспрессию ZBTB7B и усиливать экспрессию эомезодермина, тогда как ZBTB7B подавляет экспрессию RUNX3
[6, 7, 12].
Изменения экспрессии факторов транскрипции, вероятно, ведут к частичному переключению транкскрипционной
программы в CD4+ ЦТЛ с CD4-типа на CD8-тип. В результате CD4+-ЦТЛ приобретают как функциональное, так и отчасти фенотипическое сходство с CD8+ Т-клетками, что проявляется, в частности, в повышении экспрессии перфорина
и гранзима B, снижении экспрессии CD4 и появлении невысокой экспрессии CD8 на части CD4+-ЦТЛ. Данные по экспрессии CD4/CD8 напоминают результаты L. Wang и соавт.
[15], которые получены на мышах, экспрессирующих гипоморфный аллель гена Zbtb7b. В периферических лимфоидных органах этих мышей наряду с CD4+CD8– Т-хелперами
и CD4–CD8+ цитотоксическими Т-клетками имеется дополнительная популяция Т-клеток, характеризующаяся промежуточными уровнями экспрессии CD4 и CD8. У мышей
с полным нокаутом Zbtb7b CD4+ Т-клетки на периферии
практически отсутствуют [15]. В литературе нет данных о
том, участвуют ли указанные факторы транскрипции в повышении экспрессии CD57 и репрессии гена CD28, наблюдаемых в CD4+-ЦТЛ. Сигналы, вызывающие изменения экспрессии факторов транксрипции в CD4+-ЦТЛ, а также связь
этих сигналов с цитомегаловирусной инфекцией требуют
дальнейшего изучения.
Благодарность
Работа выполнена при поддержке Российского фонда
фундаментальных исследований (грант 10-04-01337).
ЛИТЕРАТУРА
1. Пащенков М.В., Муругина Н.Е., Муругин В.В., Пинегин Б.В.
Выявление и характеризация цитолитических CD8+ и CD4+
Т-клеток. Иммунология. 2010; 31 (1): 4-12.
2. Appay V., Bosio A., Lokan S. et al. Sensitive gene expression profil-
ing of human T cell subsets reveals parallel post-thymic differentiation for CD4+ and CD8+ lineages. J. Immunol. 2007; 179: 7406-14.
3. Appay V., Zaunders J. J., Papagno L. et al. Characterization of
CD4(+) CTLs ex vivo. J. Immunol. 2002; 168: 5954-8.
4. Brenchley J. M., Karandikar N. J., Betts M. R. et al. Expression
of CD57 defines replicative senescence and antigen-induced
apoptotic death of CD8+ T cells. Blood. 2003; 101: 2711-20.
5. Casazza J. P., Betts M. R., Price D. A. et al. Acquisition of direct
antiviral effector functions by CMV-specific CD4+ T lymphocytes
with cellular maturation. J. Exp. Med. 2006; 203: 2865-77.
6. Cruz-Guilloty F., Pipkin M. E., Djuretic I. M. et al. Runx3 and
T-box proteins cooperate to establish the transcriptional program
of effector CTLs. J. Exp. Med. 2009; 206: 51-9.
7. Egawa T., Littman D. R. ThPOK acts late in specification of the
helper T cell lineage and suppresses Runx-mediated commitment to the cytotoxic T cell lineage. Nature Immunol. 2008; 9:
1131-9.
8. Fletcher J. M., Vukmanovic-Stejic M., Dunne P. J. et al. Cytomegalovirus-specific CD4+ T cells in healthy carriers are continuously driven to replicative exhaustion. J. Immunol. 2005; 175:
8218-25.
9. Lee B. Y., Han J. A., Im J. S. et al. Senescence-associated betagalactosidase is lysosomal beta-galactosidase. Aging Cell. 2006;
5: 187-95.
10.Richards S. J., Sivakumaran M., Parapia L. A. et al. A distinct
large granular lymphocyte (LGL)/NK-associated (NKa) abnormality characterized by membrane CD4 and CD8 coexpression.
The Yorkshire Leukaemia Group. Br. J. Haematol. 1992; 82:
494-501.
11. Sala P., Tonutti E., Feruglio C. et al. Persistent expansions of
CD4+ CD8+ peripheral blood T cells. Blood. 1993; 82: 1546-52.
12.Setoguchi R., Tachibana M., Naoe Y. et al. Repression of the transcription factor Th-POK by Runx complexes in cytotoxic T cell
development. Science. 2008; 319: 822-25.
13.Sun G., Liu X., Mercado P. et al. The zinc finger protein cKrox directs CD4 lineage differentiation during intrathymic T cell
positive selection. Nature Immunol. 2005; 6: 373-81.
14.van Leeuwen E. M., Remmerswaal E. B., Vossen M. T. et al.
Emergence of a CD4+CD28- granzyme B+, cytomegalovirusspecific T cell subset after recovery of primary cytomegalovirus
infection. J. Immunol. 2004; 173: 1834-41.
15.Wang L., Wildt K. F., Castro E. et al. The zinc finger transcription
factor Zbtb7b represses CD8-lineage gene expression in peripheral CD4+ T cells. Immunity. 2008; 29: 876-87.
16.Wang L., Wildt K. F., Zhu J. et al. Distinct functions for the transcription factors GATA-3 and ThPOK during intrathymic differentiation of CD4(+) T cells. Nature Immunol. 2008; 9: 1122-30.
17.Woolf E., Xiao C., Fainaru O. et al. Runx3 and Runx1 are required for CD8 T cell development during thymopoiesis. Proc.
Natl Acad. Sci. USA. 2003; 100: 7731-6.
– 75 –
Поступила 30.11.12
Скачать