2 351 121(13) C1

Реклама
РОССИЙСКАЯ ФЕДЕРАЦИЯ
(19)
RU
(11)
2 351 121
(13)
C1
(51) МПК
A01H 1/04 (2006.01)
A01H 4/00 (2006.01)
C12N 15/09 (2006.01)
ФЕДЕРАЛЬНАЯ СЛУЖБА
ПО ИНТЕЛЛЕКТУАЛЬНОЙ СОБСТВЕННОСТИ,
ПАТЕНТАМ И ТОВАРНЫМ ЗНАКАМ
(12) ОПИСАНИЕ
ИЗОБРЕТЕНИЯ К ПАТЕНТУ
(21), (22) Заявка: 2007134283/13, 17.09.2007
(24) Дата начала отсчета срока действия патента:
17.09.2007
(45) Опубликовано: 10.04.2009 Бюл. № 10
(73) Патентообладатель(и):
Институт биохимии и физиологии растений и
микроорганизмов Российской академии
наук (RU),
Федеральное агентство по науке и
инновациям (RU)
2 3 5 1 1 2 1
активированными
vir-генами,
причем
обрабатывают непосредственно пестичные
нити. Затем эти цветки опыляют пыльцой
фертильных растений. Для обработки клеток
штаммом Agrobacterium используют участки
пестичных нитей, расположенные вблизи
завязи цветка. Эти операции позволяют
создать трансгенные однодольные растения
при сохранении высокой частоты их получения
в условиях, соответствующих природным
температурам
цветения,
и
упростить
технологию получения трансгенных растений.
3 з.п. ф-лы, 1 ил., 1 табл.
R U
(57) Реферат:
Изобретение может быть использовано в
селекции однодольных растений при создании
новых сортов и гибридов с помощью генной
инженерии, в работах по инсерционному
мутагенезу, выделению и клонированию генов
растений.
Для
получения
трансгенных
однодольных растений в период их активного
цветения
отбирают
цветки,
лишенные
собственной фертильной пыльцы. В качестве
объекта
генетической
трансформации
используют цветущий женский гаметофит,
который обрабатывают суспензией клеток
штамма
Agrobacterium
tumefaciens
с
Ñòðàíèöà: 1
ru
C 1
C 1
(54) СПОСОБ ПОЛУЧЕНИЯ ТРАНСГЕННЫХ ОДНОДОЛЬНЫХ РАСТЕНИЙ
2 3 5 1 1 2 1
Адрес для переписки:
410000, г.Саратов, Главпочтамт, а/я 62, О.И.
Куприяновой
R U
(56) Список документов, цитированных в отчете о
поиске: RU 2229793 С, 10.06.2004. RU 2279211 С2,
10.07.2006. RU 2196421 C1, 20.01.2003. US
6603061 B1, 05.08.2003. EP 0292435 A1,
23.11.1988. WO 98/49332 A1, 05.11.1998. SU
1708849 A1, 30.01.1992.
(72) Автор(ы):
Чумаков Михаил Иосифович (RU)
RUSSIAN FEDERATION
(19)
RU
(11)
2 351 121
(13)
C1
(51) Int. Cl.
A01H 1/04 (2006.01)
A01H 4/00 (2006.01)
C12N 15/09 (2006.01)
FEDERAL SERVICE
FOR INTELLECTUAL PROPERTY,
PATENTS AND TRADEMARKS
(12) ABSTRACT
OF INVENTION
(21), (22) Application: 2007134283/13, 17.09.2007
(24) Effective date for property rights:
17.09.2007
(45) Date of publication: 10.04.2009 Bull. 10
(73) Proprietor(s):
Institut biokhimii i fiziologii rastenij i
mikroorganizmov Rossijskoj akademii nauk (RU),
Federal'noe agentstvo po nauke i innovatsijam
(RU)
C 1
2 3 5 1 1 2 1
R U
Agrobacterium
tumefaciens
with
activated
vir-genes, pistil filaments being processed directly.
After that said flowers are pollinated with pollen of
fertile plants. For processing cells with strain
Agrobacterium pistil filament sections, located near
flower ovary, are used.
EFFECT: said operations allow to create
transgenic monocotyledon plants preserving high
frequency of their obtaining under conditions, that
correspond to natural temperatures of blooming, and
to simplify technology of obtaining transgenic plants.
4 cl, 1 dwg, 1 tbl
Ñòðàíèöà: 2
en
C 1
(57) Abstract:
FIELD: genetic engineering.
SUBSTANCE: invention can be used in
monocotyledon plants selection for creation of novel
sorts and hybrids by means of genetic
engineering,
in
works
insertional
mutagenesis, separating and cloning of plant genes.
In order to obtain transgenic monocotyledon plants in
period of their active blooming flowers lacking own
fertile pollen are selected. As object of genetic
transformation, blooming female gametophyte is
used, which is processed with suspension of strain
2 3 5 1 1 2 1
(54) METHOD OF OBTAINING TRANSGENIC MONOCOTYLEDON PLANTS
R U
Mail address:
410000, g.Saratov, Glavpochtamt, a/ja 62, O.I.
Kuprijanovoj
(72) Inventor(s):
Chumakov Mikhail Iosifovich (RU)
RU 2 351 121 C1
5
10
15
20
25
30
35
40
45
50
Изобретение относится к сельскому хозяйству и биотехнологии и может быть
использовано в селекции однодольных растений при создании новых сортов и
гибридов с помощью генной инженерии, в работах по инсерционному мутагенезу,
выделению и клонированию генов растений.
Известен способ получения трансгенных растений кукурузы на основе
агробактериальной трансформации незрелых зародышей кукурузы в культуре in vitro
(Zhao Z.-Y., Cai Т., Tagliani L. et al. Agrobacterium-mediuted sorghum transformation // Plant
Mol. Biol., 2000, v.44, pp.789-798), в соответствии с которым незрелые зародыши
кукурузы помещают на 5 мин в суспензию агробактериальных клеток (плотность 0.51.0×10 9 кл/мл) в среде для инокуляции, содержащей минеральные соли и витамины
по MS, гидролизат казеина (1.0 г/л), 2,4-D (1.5 мг/л), глюкозу (36 г/л), сахарозу (68.5
г/л), ацетосирингон (100 µМ), после чего их переносят на 3 дня на среду для
сокультивирования, отличающуюся от исходной увеличенной до 2.0 мг/л
концентрацией 2,4-D, сниженными до 20 и 10 г/л соответственно концентрациями
сахарозы и глюкозы, добавкой L-пролина (0.7 г/л), аскорбиновой кислоты (10 мг/л),
MES (0.5 г/л) и агара (8 г/л). Затем зародыши переносят на 4 дня на среду без
ацетосирингона, но с добавкой антибиотика карбенициллина (100 мг/л) для
подавления роста агробактерий. Затем для индукции эмбриогенного каллуса
зародыши переносят на среду, отличающуюся от предыдущей отсутствием глюкозы и
сниженной концентрацией 2,4-D (до 1.5 мг/л) и добавкой селективного агента
фосфинотрицина (5 мг/л), ген устойчивости к которому (bar) присутствовал в Т-ДНК
использованного агробактериального штамма, и культивируют в течение 2 недель.
Переносят выживший (устойчивый) каллус на среду того же состава с повышенным
уровнем фосфинотрицина (10 мг/л) и пересаживают каждые 2 недели. Для развития
эмбриоидов каллус пересаживают на среду, отличающуюся от предыдущей добавкой
кинетина (0.5 мг/л), и затем - на среду для побегообразования, отличающуюся от
предыдущей отсутствием 2,4-D, увеличенной до 60 г/л концентрацией сахарозы,
заменой кинетина на зеатин (0.5 мг/л), добавкой индолил-3-уксусной кислоты (ИУК)
(1 мг/л), абсцизовой кислоты (АБК) (0.1 µM) и тадиазурона (0.1 мг/л). Побеги
переносят на среду для укоренения - 1/2 Мурасиге-Скуга (MS), (нитрил-3-уксусной
кислоты (НУК) (0.5 мг/л), индол-3-бензольная кислота (ИБК) (0.5 мг/л), сахароза (20
г/л), агар (7 г/л), а затем - на среду того же состава, но без НУК и ИБК. У полученных
растений с помощью методов молекулярной генетики анализируют наличие в их
геноме встройки фрагмента чужеродной ДНК (Т-ДНК агробактерий). Данный способ
позволяет достигать частоты стабильной трансформации до 10.1% в расчете на
количество инокулированных зародышей.
Недостатком данного способа является высокая трудоемкость и длительность
процесса получения трансгенных растений. Кроме того, использование системы
культуры in vitro, во-первых, может привести к получению сомаклональных
вариантов среди растений-трансформантов, во-вторых, ограничивает применение
данного метода, поскольку не все образцы кукурузы (селекционноценные линии и
гибриды) дают хорошо растущий эмбриогенный каллус с высокой регенерационной
способностью, либо же их экспланты, продуцирующие эмбриогенный каллус,
некротизируют в результате сокультивирования с агробактериальными клетками.
Известен способ получения трансгенных однодольных растений с использованием
генетических маркеров, используемых в генетической инженерии у высших растений
для отбора трансгенных растений, для чего служит ген nptII, который кодирует
фермент неомицин-фосфотрансферазу, обусловливающую устойчивость к
Ñòðàíèöà: 3
DE
RU 2 351 121 C1
5
10
15
20
25
30
35
40
45
50
канамицину. Для отбора трансгенных растений, несущих ген nptII, из семян,
собранных с растений-трансформантов, извлекают зародыши и выращивают их на
питательной среде с канамицином (Данилова С.А. Оптимизация агробактериального
метода трансформации кукурузы. Автореф. дисс. канд. биол. наук. М., 2001), При этом
проростки, несущие и экспрессирующие ген nptII, имеют зеленый фенотип, тогда как
проростки, не несущие данный ген, становятся альбиносными и погибают.
Данный способ, позволяющий отбирать у некоторых видов двудольных и
однодольных растений канамицин-устойчивые трансформанты с геном nptII, имеет,
однако, два существенных недостатка: высокую трудоемкость, ограничивающую
объем анализируемого материала, длительность контакта зародышей с канамицином
в процессе их культивирования на канамицин-содержащей среде, в результате чего
нарушается развитие даже канамицин-устойчивых трансформантов.
Наиболее близким к предлагаемому способу является способ получения
трансгенных растений сорго (Патент на изобретение РФ №2229793, МПК: А01Н
1/00, C12N 15/82, C12N 15/00), включающий трансформацию клеток сорго с
помощью Agrobacterium tumefaciens и отбор трансгенных растений. Для получения
трансгенных растений используют цветущие метелки сорго, лишенные собственной
фертильной пыльцы, которые опыляют пыльцой фертильных растений сорго и, затем,
наносят суспензию клеток штамма Agrobacterium tumefaciens с активированными
vir-генами, причем для активации vir-генов используют ацетосирингон, а нанесение
суспензии клеток Agrobacterium tumefaciens осуществляют при температуре,
оптимальной для процесса трансформации, при этом трансгенные растения отбирают
среди проростков, выросших из семян, завязавшихся на этих метелках.
Недостатком данного способа является требование осуществлять трансформацию
при температуре, оптимальной для процесса трансформации, что входит в
противоречие с природным температурным оптимумом созревания пыльцы,
поскольку считается, что оптимальной температурой для активации vir-генов является
температура ниже 25°С (Fullner K.J, Nester E.W. Temperature affects the T-DNA transfer
machinery of Agrobacterium tumefaciens // J.Bacteriol. 1996. V.178. P.1498-1504), а
оптимальной температурой для созревания пыльцы является температура выше 25°С.
Чтобы избежать этого противоречия, растения приходится обрабатывать в ночное
время, выращивать их в специальных сосудах (или выкапывать растения из земли и
помещать в сосуды) и переносить их для инкубирования при пониженных
температурах в специальные помещения. После инкубирования при пониженных
температурах требуется обратное перемещение растений до полного созревания в
условия оптимальной освещенности и температуры, что значительно осложняет
технологию получения трансгенных растений, приводит к потерям растений,
ухудшению вызревания и, в конечном счете, к снижению эффективности получения
трансгенных растений.
Задачей изобретения является создание более быстрого и простого способа
получения трансгенных однодольных растений при сохранении высокой частоты их
получения в условиях, соответствующих природным температурам цветения
однодольных растений.
Техническим результатом является возможность осуществления
высокоэффективного переноса ДНК из агробактерий в растение при реальных
природных температурах цветения однодольных растений (выше 25°С), с упрощением
технологии получения трансгенных растений (процедур обработки, инкубирования,
созревания).
Ñòðàíèöà: 4
RU 2 351 121 C1
5
10
15
20
25
30
35
40
45
50
Поставленная задача достигается тем, что в способе получения трансгенных
однодольных растений, включающем отбор в качестве объекта генетической
трансформации цветков однодольных растений, лишенных собственной фертильной
пыльцы, опыление цветков пыльцой фертильных растений, обработку цветков
суспензией клеток Agrobacterium tumefaciens с активированными vir-генами, согласно
предлагаемому решению в качестве объекта генетической трансформации используют
цветущий женский гаметофит однодольного растения, который сначала
обрабатывают суспензией клеток штамма Agrobacterium tumefaciens с
активированными vir-генами, а затем опыляют пыльцой фертильных растений.
Кроме того, опыление цветущего женского гаметофита пыльцой фертильных
растений осуществляют в течение часа после их обработки суспензией клеток
штамма Agrobacterium tumefaciens, а обработку суспензией клеток
штамма Agrobacterium tumefaciens осуществляют непосредственно пестичных нитей
цветущего женского гаметофита, при этом цветки отбирают в период их активного
цветения. Для обработки суспензией клеток штамма Agrobacterium tumefaciens
используют участки пестичных нитей цветущего женского гаметофита,
расположенные вблизи завязи цветка. Для получения трансгенных растений кукурузы
для обработки суспензией клеток штамма Agrobacterium tumefaciens используют
участки пестичных нитей цветущего женского гаметофита, расположенные на выходе
нитей из початка.
Изобретение поясняется чертежом (фотографией), где представлено доказательство
встройки Т-ДНК в геном растения в виде фрагментов ДНК определенной длины,
полученных в результате полимеразной цепной реакции (ПЦР) и визуализированной
методом электрофореза в агарозном геле, в частности на чертеже представлен
ПЦР-анализ ДНК из проростков кукурузы, трансформированной in planta, где
цифрами 1-8 обозначены дорожки: 1 - ДНК из нетрасформированного растения
(отрицательный контроль); 2 - маркер молекулярного веса (Fermentas, Латвия), размер
фрагментов, начиная сверху: 3000, 2000, 1500, 1200, 1031, 900, 800, 700, 600, 500 п.н.; 38 - тестируемые проростки, зерна которых прорастали без задержки на канамицине.
Предлагаемый способ осуществляют следующим образом. Женские цветки (в
составе одно- или двудомных, раздельнополых) растений изолируют пергаментными
изоляторами до начала цветения. Для обработки цветков используют суспензию
клеток Agrobacterium tumefaciens с плотностью клеток 1×10 7 кл/мл, в которую
добавляют ацетосирингон. Женские цветки растения после обработки
агробактериальной суспензией опыляют пыльцой той же или другой линии этого же
вида растения и снова изолируют. С обработанных растений собирают семена,
проращивают их и отбирают на среде с канамицином проростки, несущие маркерный
ген. У проростков, устойчивых к канамицину, берут фрагмент ткани и с помощью
метода ПЦР (полимеразной цепной реакции) проверяют наличие последовательности
ДНК переносимого гена, используя необработанные и
поверхностно-стерилизованные растения. Отбирают проростки, несущие фрагмент
ДНК маркерного гена («ПЦР+» проростки), которые являются трансгенными
растениями.
Заявляемй способ был реализован на растениях кукурузы линии АТ-3 и сорго
посевного. В качестве доноров пыльцы служили растения этой же линии. Трансгеноз
осуществляли с помощью Agrobacterium tumefaciens, при этом использовали
штамм GV3101, с плазмидой pTd33, в которой присутствовал селективный маркерный
ген nptII, обусловливавший устойчивость к канамицину. Суспензию клеток данных
Ñòðàíèöà: 5
RU 2 351 121 C1
5
10
15
20
25
30
35
40
агробактериальных штаммов выращивали на качалке на питательной среде CIB
(Fullner K.J., Stephenens K.M., Nester E.W. An essential virulence protein of Agrobacterium
tumefaciens, VirB4, requires an intact mononucleotide binding domain to function in transfer of
T-DNA. // Mol. Gen. Genet. 1994. V.245. P.704-715) до плотности 1х10 7 кл/мл при
комнатной температуре. По достижении необходимой плотности в суспензию
добавляли ацетосирингон (200 µM) и либо непосредственно использовали в опыте по
трансгенозу, либо помещали в холодильник (t°=4-7°С) для использования в течение
последующих 2-3 суток.
До начала цветения початки изолировали пергаментными изоляторами. В качестве
объекта генетической трансформации использовали цветущий женский гаметофит
однодольного растения, пестичные нити которого, расположенные на выходе нитей из
початка, отрезали и сначала обрабатывали суспензией клеток штамма Agrobacterium
tumefaciens с активированными vir-генами, а затем в течение часа опыляли собранной
в пакет пыльцой фертильных растений путем натряхивания из пакета или пальцами на
поверхность срезанного пучка пыльцевых трубок. Температура при обработке
растений варьировалась в зависимости от года в пределах от 20 до 28°С. Для
выявления трансгенных растений семена, собранные с початков, обработанных
агробактериальной суспензией и необработанных (контрольных) початков растений
исходной линии, стерилизовали 5%-ным раствором хлорамина (15 мин), интенсивно
промывали в проточной воде, замачивали в дистиллированной воде (24 час), повторно
стерилизовали в ламинар-боксе 5%-ным раствором хлорамина и без промывки
раскладывали на агаризованную среду, содержащую канамицин (200 мг/л), и после
появления корней через 2-5 дней переносили в почву в сосуды с почвой, где
проращивали в течение 2-3 недель.
Подтверждение трансгенной природы из полученных зеленых проростков
проводили с помощью метода ПЦР (см. чертеж). При этом из листьев отобранных
растений выделяли ДНК согласно общепринятым методам (Маниатис Т., Фриш.,
Сэмбрук Дж. Молекулярное клонирование. Лабораторное руководство. М.:
Мир, 1984). Реакцию проводили с олигонуклеотидными праймерами, специфичными к
фрагменту гена nptII размером 250 п.н.: ACAGACAATCGGCTGCTCTGATG
и GGCAGGAGCAAGGTGAGATGACA. Продукты реакции разделяли электрофорезом в
агарозном геле, в качестве маркера молекулярной массы использовали ДНК фага λ. В
качестве положительного контроля использовали плазмиду pTd33.
Результат анализа ДНК показал, что в ряде исследованных образцов тотально
ДНК растения присутствует последовательность размером около 500 п.н.,
свойственная гену nptII. В расчете на число проросших зерновок частота полученных
из них взрослых трансформированных растений составила 1.3-6.8% (см. таблицу 1).
Причем было замечено, что частота трансформации не зависит от повышенной
температуры окружающей среды (более 25°С).
Таблица 1.
45
Частота встройки Т-ДНК в геном кукурузы после обработки пестичных нитей кукурузы A. tumefaciens согласно предлагаемому
способу
Температура во время обработки растения
Параметры
50
Выборка семян
25-28°С
20-22°С
1200
600
Количество зеленых проростков на канамицине
53
37
Количество проростков, проанализированных методом ПЦР
53
37
25 (47%)
9 (24.3%)
6.8%
1.5%
Количество ПЦР-позитивных проростков (% к общему числу проростков)
Количество трансформантов (% к общему числу семян)
Ñòðàíèöà: 6
RU 2 351 121 C1
5
10
15
20
25
30
35
40
Таким образом, приведенные данные показывают, что заявляемый способ
позволяет с высокой частотой получать трансгенные растения при реальных
природных температурах цветения однодольных растений более 25°С со
значительным уменьшением трудоемкости и с упрощением технологии получения
трансгенных растений (процедур обработки, инкубирования, созревания).
Предлагаемый способ позволяет: 1) получать трансгенные растения при реальных
природных температурах цветения однодольных растений при упрощении и
увеличении скорости технологии обработки, инкубирования, выращивания растений
при сохранении высокой частоты трансформации, 2) получать трансгенные растения,
минуя систему культуры in vitro, что ускоряет и упрощает процедуру получения
трансгенных растений кукурузы, 3) избежать возникновение сомаклональной
изменчивости; 4) избежать химерности трансформантов, проистекающей из-за
развития их из многоклеточных меристем, содержащих как трансформированные, так
и нетрансформированные клетки; 5) использовать для трансформации практически
все известные сорта и линии кукурузы, т.к. отсутствуют ограничения по генотипам,
способным к образованию хорошо растущего эмбриогенного каллуса.
Формула изобретения
1. Способ получения трансгенных однодольных растений, включающий отбор в
качестве объекта генетической трансформации цветков однодольных растений,
лишенных собственной фертильной пыльцы, опыление цветков пыльцой фертильных
растений, обработку цветков суспензией клеток Agrobacterium tumefaciens с
активированными vir-генами, отличающийся тем, что в качестве объекта генетической
трансформации используют цветущий женский гаметофит однодольного растения,
который сначала обрабатывают суспензией клеток штамма Agrobacterium tumefaciens с
активированными vir-генами, а затем опыляют пыльцой фертильных растений.
2. Способ по п.1, отличающийся тем, что опыление цветущего женского гаметофита
пыльцой фертильных растений осуществляют в течение часа после их обработки
суспензией клеток штамма Agrobacterium tumefacien.
3. Способ по п.1, отличающийся тем, что обработку суспензией клеток
штамма Agrobacterium tumefaciens осуществляют непосредственно пестичных нитей
цветущего женского гаметофита, при этом цветки отбирают в период их активного
цветения.
4. Способ по п.3, отличающийся тем, что для обработки суспензией клеток
штамма Agrobacterium tumefaciens используют участки пестичных нитей цветущего
женского гаметофита, расположенные вблизи завязи цветка.
45
50
Ñòðàíèöà: 7
CL
RU 2 351 121 C1
Ñòðàíèöà: 8
DR
Скачать