ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ РАЗЛИЧНЫХ ПОРОД

Реклама
УДК 636.4.082.2
ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ РАЗЛИЧНЫХ ПОРОД
И ПОПУЛЯЦИЙ СВИНЕЙ ПО ГЕНУ ЭСТРОГЕНОВОГО РЕЦЕПТОРА (ESR)
Ковальчук М.А., Ганджа А.И., Журина Н.В., Курак О.П., Симоненко В.П.,
Леткевич Л.Л., Кириллова И.В.
РУП «Научно-практический центр Национальной академии наук Беларуси по животноводству»,
Республика Беларусь
Аннотация. В статье изучена генетическая
структура популяций свиней нескольких пород
по гену ESR. На этой основе установлена
различная
интенсивность
селекционных
процессов в исследуемых породах. Изучение и
применение полиморфных генетических систем
в качестве маркеров является важной
перспективной задачей.
Ключевые слова: генетические системы,
полиморфизм, структура породы, свиноводство,
ген ESR.
Summary: In the article the genetic structure
of populations of pigs of several breeds on ESR
gene are studied. On this basis one have set the
different intensity of selection processes in the
studied breeds. The study and application of
polymorphic genetic systems as markers is an
important perspective task.
Актуальность.
Известно,
что
при
использовании
традиционных
методов
селекции и при действии модификационных
факторов генетический потенциал животных
полностью не реализуется, и продуктивные
качества проявляются достаточно длительное
время. MAS (маркерная селекция) имеет ряд
преимуществ перед традиционными методами
селекции. Она не учитывает изменчивость
хозяйственно-полезных
признаков,
обусловленную внешней средой. ДНКтехнологии позволяют определить генотип
животного независимо от пола, возраста и
физиологического состояния особи, что
является важными факторами в селекционной
работе [1].
При создании мясных генотипов свиней
важно
сохранить
высокий
уровень
репродуктивной
Выявлено три вида полиморфизма гена ESR
(ESR/PvuII, ESR/AvaI и ESR/MspII), все они
связаны с репродуктивными признаками свиней
(M.F. Rothschild et al., 1996). Наибольший
интерес представляет полиморфная система
ESR/PvuII, расположенная в первом интроне
гена, для которой идентифицировано два
кодоминантных аллеля - ESRА и ESRВ. В
результате точковой мутации в данном участке
гена появляется сайт рестрикции фермента PvuII
(ESRА→ESRВ), что позволяет определять
аллельные
варианты
гена
эстрогенового
рецептора методом ПЦР – ПДРФ.
Материал и методика исследований.
Исследования
проводились в лаборатории
молекулярной
биотехнологии
и
ДНК-
функции материнских форм. Из существующих
генов-кандидатов влияющих на воспроизводство
был отобран ген эстрогенового рецептора,
анализ полиморфизма которого, по нашему
мнению, играет важную роль в повышении
эффективности
селекционного
процесса,
направленного на улучшение репродуктивных
качеств свиней, и позволяет прогнозировать
проявление
количественных
признаков
животных в раннем возрасте и независимо от
пола.
Ген, кодирующий эстрогеновый рецептор
(ESR, 1р2.4-р2.5) свиней расположен на коротком
плече (р) субметоцентрической хромосомы 1, в
субъединицах 4–5 второго сегмента. Мутация
данного гена приводит к изменению белкового
рецептора эстрогена, что является причиной
спонтанных абортов.
ESR F: 5´CCTGTTTTTACAGTGACTTTTACAGAG-3´,
ESR R: 5´- CACTTCGAGGGTCAGTCCAATTAG3´;
Для
проведения
ПЦР
использовали
реакционную смесь конечным объемом 20-25
мкл, включающую: от 50 до 100 нг ДНК,
праймеры в количестве от 10 до 25 пМ, по 200
мкМ каждого из дНТФ, 1х буфер (10 мМ трис
рН 8,6, 50 мМ KCl, 0,1 % tween-20), 1,5 мМ
MgCl2 и 1,3-2,5 ед. акт. Taq-полимеразы.
ПЦР проводили в термоциклерах «DNA
Engine Tetrad2», «MJ Mini» («Bio-Rad», США)
по следующей программе:
- для гена ESR - «горячий старт» - 940 С – 5
мин.; 35 циклов: денатурация – 940 С – 1 мин.,
отжиг – 650 С – 1 мин., элонгация – 720 С – 1
Keywords: genetic systems, polymorphism,
structure of the breed, pig breeding, ESR gene.
тестирования РУП «НПЦ НАН Беларуси по
животноводству». Объектом исследования для
проведения
молекулярно-генетического
тестирования по гену ESR (количество тестов
n=627) являлись свиньи пород:
белорусской крупной белой (КБ), белорусской
мясной (БМ); белорусской черно-пестрой
(БЧП), ландрас (Л), дюрок (Д), йоркшир (Й) и
двухпородные свинки БМхЛ, у которых были
взяты биопробы ткани, спермы и выделена
ДНК перхлоратным методом [2].
Концентрацию
и
степень
чистоты
препаратов ДНК оценивали с использованием
спектрофотометра GeneQuant 1300 (Healthcare).
Изучена
генетическая
структура
племенного поголовья свиней разводимых в
хозяйствах
республики:
РСУП
СГЦ
«Заднепровский» Витебской, РСУП СГЦ
«Западный» Брестской, РСУП «Племенной
завод «Ленино» Могилевской, РСУП СГЦ
«Вихра»
Могилевской,
ГП
«ЖодиноАгроПлемЭлита» Минской, РСУП
СГЦ «Заречье» Гомельской областей.
Генотипирование свиней по гену ESR
проведено
методом
ПЦР,
при
этом
использовали олигонуклеотидные праймеры
следующих последовательностей:
мин.; достройка – 720 С – 8 мин.
Продукты ПЦР амплификации фрагментов
гена ESR расщепляли рестриктазой: PvuII.
Продукты ПЦР и рестрикционные фрагменты
разделяли электрофоретически в агарозном геле,
окрашенном бромистым этидием. Фракции
нуклеиновых кислот в гелях визуализировали в
проходящем
ультрафиолетовом
свете
с
использованием компьютерной видеосистемы
Infinity-3026 (Vilber Lourmat, Франция).
Полученные результаты обработаны по
стандартным биометрическим методикам [3].
Результаты собственных исследований и
их обсуждение. Проведено генотипирование
животных методом ПЦР-ПДРФ и изучена
генетическая структура различных пород и
популяций свиней, разводимых в хозяйствах
Республики Беларусь по гену эстрогенового
рецептора (ESR), детерминирующему проявление
репродуктивных признаков.
Молекулярно-генетическое
тестирование
пород (БКБ, БМ, Л, Й, БЧП, Д) и породного
сочетания БМхЛ выявило полиморфизм гена
ESR, представленный двумя аллелями - ESRA и
ESRB (таблица 1).
Таблица 1 – Генетическая структура по гену ESR, различных пород и популяций свиней
разводимых в республике
Порода
Белорусская
крупная белая
Белорусская
мясная
Ландрас
Йоркшир
Белорусская
черно-пестрая
Дюрок
БМ х Л
Хозяйство
n
СГЦ «Заднепровский»
СГЦ «Вихра»
СГЦ «Западный»
СГЦ «Заречье»
СГЦ «Западный»
СГЦ «Заречье»
ГП «ЖодиноАгроПлемЭлита»
СГЦ «Западный»
СГЦ «Заднепровский»
ГП «ЖодиноАгроПлемЭлита»
п/з «Ленино»
СГЦ «Заречье»
СГЦ «Вихра»
СГЦ «Западный»
170
50
17
14
103
37
98
7
60
21
46
4
50
23
Анализ популяций белорусской крупной
белой
породы
выявил,
что
частота
встречаемости желательного генотипа ESRBВ
составила от 13,53% (СГЦ «Заднепровский») до
28,57% (СГЦ «Заречье») и аллеля ESRB от 0,44
до 0,54, соответственно. В популяциях
белорусской
мясной
породы
процент
встречаемости животных с генотипом ESRBВ
находился в пределах от 2,90 (СГЦ«Западный»)
до 10,81 (СГЦ «Заречье»).
Концентрация
предпочтительного
генотипа
ESRBВ
в
популяциях свиней породы ландрас и йоркшир
составила
от
7,14-9,52%
(ГП
АА
24,71
18,0
29,41
21,43
66,0
40,54
47,96
71,43
31,67
23,81
56,52
75,0
100
56,52
Частота встречаемости
Генотипов, %
Аллелей
АВ
ВВ
А
В
61,76
13,53
0,56
0,44
56,0
26,0
0,46
0,54
52,94
17,65
0,56
0,44
50,0
28,57
0,46
0,54
31,1
2,90
0,82
0,18
48,65
10,81
0,65
0,35
44,90
7,14
0,70
0,30
14,29
14,29
0,79
0,21
55,0
13,33
0,59
0,41
66,67
9,52
0,57
0,43
36,96
6,52
0,75
0,25
25,0
0,87
0,13
1,0
43,48
0,78
0,22
сравнивать
частоту
встречаемости
предпочтительного аллеля ESRB по всем
изучаемым породам, то можно сделать вывод, что
наибольшая доля этого аллеля наблюдалась у
животных крупной белой породы и йоркшир и
составила
от
0,44-0,54
до
0,41-0,43,
соответственно.
В результате анализа генетической
структуры по гену ESR в среднем по породам
было установлено, что наибольшая частота
встречаемости желательного генотипа ESRBВ
наблюдалась у популяций белорусской крупной
белой породы – 17,13%, а наименьшая у
«ЖодиноАгроПлемЭлита») до 13,33-14,29%
(СГЦ «Заднепровский», СГЦ «Западный»),
соответственно.
У животных белорусской черно-пестрой
породы (СГЦ «Заречье»), породы дюрок (СГЦ
«Вихра») и породного сочетания БМхЛ (СГЦ
«Западный») встречаемость генотипа ESRBВ
отсутствовала. Если
животных белорусской мясной породы – 5,0%.
Также более 50% составили животные
белорусской крупной белой (59,36%) и породы
йоркшир (58,02%) с гетерозиготным генотипом
ESRАВ, в сравнении с другими породами
(таблица 2).
Таблица 2 – Генетическая структура по гену ESR в среднем по породам
Порода
Белорусская крупная белая
Белорусская мясная
Ландрас
Йоркшир
Белорусская черно-пестрая
n
251
140
105
81
50
Анализ полиморфизма гена ESR различных
пород свиней выявил изменчивость частот
встречаемости генотипов ESRBВ,
ESRАВ и
B
аллеля ESR в зависимости от популяции и
породной принадлежности животных. Также
следует отметить, что в среднем наибольшая
концентрация аллеля ESRB наблюдалась у
животных породы йоркшир и белорусской
крупной
белой
породы
–
0,41-0,47,
соответственно.
Сравнивая
результаты
полученные нами ранее можно сделать вывод,
что
концентрация
встречаемости
предпочтительного аллеля ESRB в популяциях и
породах разводимых в республике не снизилась
и остается на прежнем уровне от 0,23 до 0,47
[4].
Выводы. Таким образом, нами изучена
генетическая структура по гену ESR популяций
свиней нескольких пород (белорусской мясной,
белорусской крупной белой, белорусской чернопестрой, дюрок, ландрас, йоркшир) и породного
сочетания БМхЛ, разводимых в хозяйствах
республики.
Полученные
данные
свидетельствует о различной интенсивности
селекционных процессов в исследуемых породах
и популяциях свиней, направленных на
увеличение признаков продуктивности. Изучение
и применение полиморфных генетических систем
в качестве маркеров в племенном свиноводстве,
является потенциально важной задачей для
дальнейшего усовершенствования признаков
продуктивности животных, это способствует
накоплению желательных генотипов у
АА
23,51
59,29
49,52
29,63
58,0
Частота встречаемости
Генотипов, %
АВ
ВВ
59,36
17,13
35,71
5,0
42,86
7,62
58,02
12,35
36,0
6,0
Аллелей
А
0,53
0,77
0,71
0,59
0,76
В
0,47
0,23
0,29
0,41
0,24
популяций свиней белорусской селекции.
Список использованной литературы
1. Калашникова,
Л.А.
Методы
молекулярной генетики в животноводстве / Л.А.
Калашникова // Селекция с.-х. животных на
устойчивость к болезням и повышения
естественной резистентности : сб. науч. тр. /
ВНИИплем. – Москва, 1989. – С. 32-39.
2. Зиновьева, Н.А. Подготовка проб,
выделение ДНК и оптимизация метода ПЦРанализа / Н.А. Зиновьева // Методы
исследований
в
биотехнологии
сельскохозяйственных
животных
:
шк.практикум. Вып. 3; под редакцией Н.А.
Зиновьевой. – Дубровицы : ВИЖ, 2004. – С. 4041.
3. Меркурьева, Е.К. Биометрия в селекции
и генетике сельскохозяйственных животных /
Е.К. Меркурьева. – М.: «Колос», 1970. – 423 с.
4. Ассоциация
гена
эстрогенового
рецептора с репродуктивными признаками
свиноматок белорусской мясной и крупной
белой пород / И.П. Шейко [и др.] //
Зоотехническая наука Беларуси : сб. науч. тр. Т.
41. – Жодино : Ин-т животноводства НАН
Беларуси, 2006. – С. 103-109. – Авт. Также :
Журина Н.В., Епишко Т.И., Курак О.П.,
Ковальчук М.А., Епишко О.А.
5. Подольников,
В.Е.
Продуктивные
качества свиноматок крупной белой породы при
чистопородном и промышленном скрещивании
/ В.Е. Подольников, М.В. Подольников //
Вестник Брянской ГСХА, №6 (2013), -С. 15-18.
Скачать