Диагностика бруцеллёза методом полимеразной цепной

Реклама
ВЕТЕРИНАРНЫЕ НАУКИ
Как известно, молозиво имеет повышенную
плотность в силу большего содержания в единице
объёма сухих веществ, жира, белков, солей и т.д.
Изменения плотности молозива в первых
удоях практически одинаковы у животных
обеих групп как по величине показателя, так и
по динамике его изменения, что подтверждает
имеющиеся данные [6].
Титруемая кислотность молозива обусловливается солями фосфорной и лимонной кислот,
белковыми веществами, имеющими кислый
характер, а также растворённым в молозиве
диоксидом углерода.
Исследованиями установлена достаточно высокая кислотность молозива в первом удое. Так, у
животных II гр. она была на уровне 45,51±2,28 °Т,
I гр. – 52,51±2,19 °Т соответственно. Во втором
удое кислотность понижается у голштинов на 7°
Тернера, а у чёрно-пёстрого скота – на 9,43 °Т.
В третьем удое кислотность уменьшилась на
6–8 °Т, в четвёртом и пятом – на 4–5 °Т.
Минеральные вещества имеют важное физиологическое и технологическое значение при
переработке молока. В молозиве находятся все
элементы, обеспечивающие минеральный обмен в организме, нормальный рост и развитие
животного.
В первых удоях молозива отмечается повышенное содержание основных элементов, что
подтверждает имеющиеся в литературе данные [7]. Установлено, что у новотельных коров
I гр. в пробах первого удоя содержалось
47,10±1,96 мМ/л неорганического кальция и
47,84±1,83 мМ/л неорганического фосфора.
У животных II гр. в первом удое молозива
содержалось кальция 44,58±1,38 и фосфора –
42,69±2,14 мг/%. Наиболее заметное уменьшение кальция и фосфора отмечено в пробах
четвёртого удоя – соответственно до 34,32±1,21
и 35,95±1,73 мМ/л.
Выводы. Анализ физико-химических свойств
молозива новотельных коров показал, что многие параметры, характеризующие их, были близки или тождественны по динамике в первых пяти
удоях у животных обеих групп. Однако местный скот имел преимущества по концентрации
общего белка, кальция и фосфора, молочного
сахара.
Литература
1. Шпис А.А. Молочная продуктивность и технологические
свойства молока коров различных генотипов // Вступление
Казахстана в ВТО: проблемы и перспективы: матер. междунар. науч.-практич. конф. Кустанай, 2006. С. 323–327.
2. Гертман А.М., Бертазин А.Б. Биологические особенности
и молочная продуктивность чёрно-пёстрых и помесей коров стада Челябинского агроинженерного университета //
Актуальные проблемы интенсификации животноводства
и подготовка специалистов: матер. науч.-практич. конф.
Троицк: Изд-во УГАВМ, 1993. С. 93–96.
3. Алешкина С.В., Сарапкин В.Г. Зависимость молочной продуктивности и долголетия коров чёрно-пёстрой породы от
возраста первого отёла // Селекция, кормление, содержание
сельскохозяйственных животных и технология производства
продуктов животноводства: сб. науч. труд. ВНИИплем. М.:
Изд-во ВНИИПЖ, 2007. В. 20. С. 57–61.
4. Мостовая В.В. Иммунобиологический статус и адаптационные возможности нетелей разных генотипов: автореф.
дисс. … канд. биол. наук. Оренбург, 2008.
5. Прусов М.А. Химический состав молока у первотёлок
чёрно-пёстрой породы // Особенности племенной работы
с сельскохозяйственными животными: сб. научн. тр. М.,
1991. С. 73–81.
6. Горелик О.В., Лыкасова Н.И. Влияние генотипа на молочную продуктивность коров // Технологические проблемы
производства продукции животноводства: сб. науч. трудов.
Троицк: Изд-во УГАВМ, 2002. С. 14.
7. Горбатова К.К. Биохимия молока и молочных продуктов:
учеб. для вузов. СПб.: Гиорд, 2001. 314 с.
Диагностика бруцеллёза методом
полимеразной цепной реакции (ПЦР)
К. Ж. Кушалиев, д.в.н., профессор, Р. Г. Зулхарнаева,
соискатель, Западно-Казахстанский АТУ; Н. А. Сивожелезова, д.с.-х.н., профессор, Оренбургский ГАУ
Бруцеллёз животных широко распространён
в Казахстане, наносит огромный ущерб животноводству и представляет большую угрозу
здоровью людей.
Предотвращение эпизоотии позволяет поддерживать и развивать необходимые межхозяйственные, межрегиональные и государственные
связи, а успешная борьба с болезнями животных,
опасных для человека, обеспечивает охрану
здоровья населения страны [1, 2].
Цель исследований – провести анализ на
бруцеллёз методом ПЦР.
Объекты, методы и результаты исследований.
Работа выполнялась на базе НИИ (лаборатории
биотехнологии инженерного профиля) ЗападноКазахстанского АТУ.
Использовали следующие реактивы и расходные материалы: агароза (ДиаэМ, Россия);
бромид димидия (RT193993, ICN, США); бром
феноловый синий (B5525, Sigma, Германия); диоксинуклеозидтрифосфаты – смесь dАТР, dТТР,
dСТР, dGТР (2 мм), R0241 (Ферментас, Литва;
Сибэнзим, Россия); таq-полимераза (5 ед/мкл)
(Синтол, Россия); тригидроксиметиламинометан
(Трис, USB, Великобритания); этиловый спирт
(Россия).
Применяли оборудование: автоматические дозаторы переменного объёма (0,1–20 м, 20–200 м,
109
ВЕТЕРИНАРНЫЕ НАУКИ
200–1000 м); анализатор-термоциклир (амплификатор) для детекции нуклеиновых кислот методом ПЦР iCycler IQ5; бокс абактериальной воздушной защиты БАВп-01-«Ламинар-С»-1,2(01);
бокс для проведения GWH работ UVC/T-M-AR;
гельдокументирующая система Geldoc XR system
PC; источник тока PowerPac basic; центрифуга
Heraeus Pico 17.
Выделение ДНК проводили при помощи
коммерческого набора «Амплисенс» «ДНКсорб-Б». Вначале лизирующий раствор прогрели
при температуре 65 °С до полного растворения
кристаллов.
К сыворотке крови животных добавили
300 мкл лизирующего раствора, тщательно перемешивали смесь на вортексе и прогревали 5 мин
при температуре 65 °С, затем ещё раз перемешивали на вортексе. В каждую пробирку вносили
25 мкл суспензии сорбента, перемешивали и
оставляли на 2 мин для осаждения сорбента.
Затем повторно проводили перемешивание на
вортексе и оставляли на 5 мин для осаждения
сорбента. Сорбент осаждали на микроцентрифуге
при 5 тыс. об./мин в течение 30 с и отбирали
супернатант из каждой пробирки отдельным наконечником. Вносили по 300 мкл раствора для
отмывки № 1, тщательно перемешивали смесь
на вортексе и вновь осаждали в прежнем режиме. Вносили по 500 мкл раствора для отмывки
№ 2, ресуспендировали на вортексе, осаждали
микроцентрифугированием 10000 об./мин в течение 30 сек и удаляли супертанант. Повторяли
процедуру отмывки раствором № 2. Элюцию
проводили при помощи 50 мкл ТЕ-буфера. Качество выделения ДНК определяли при помощи
метода электрофореза в агарозном геле.
При подключении к источнику тока отрицательно заряженная ДНК начинает двигаться в геле от катода к аноду. При этом более
короткие молекулы ДНК движутся быстрее,
чем длинные. На скорость движения ДНК в
геле влияют концентрация агарозы, напряжённость электрического поля, температура, состав
электрофорезного буфера. Все молекулы одного
размера движутся с одинаковой скоростью. Краситель встраивается плоскостными группами в
молекулы ДНК [3, 4].
После окончания электрофореза, продолжающегося около 10–20 мин при напряжении тока
90–120 В, гель помещали в камеру трансиллюминатора, излучающего свет в ультрафиолетовом
диапазоне (254–310 нм).
Энергия ультрафиолета, поглощаемая ДНК
в области 260 нм, передаётся на краситель, заставляя его флуоресцировать в оранжево-красной
области видимого спектра (590 нм) [5].
Подбор праймеров осуществляли на основе
имеющихся литературных данных по изучению
Brucella spp и данных секвенирования ДНК вакцин. В результате обработки литературных материалов были подобраны две пары праймеров для
видового определения возбудителей заболевания
бруцеллёза. На основе компьютерного анализа
при помощи пакета программ Vector NTI проанализировали подобранные две пары праймеров.
В результате анализа первая подобранная пара
праймеров 24-1 (TGCAGCTCACGGATAATTTG)
и 24-2 (ACACCTTGTCCACGCTCAC) строго специфична для B. аbortus. Вторая пара
25-1 (ATCTGGTTCTTTCGGGTGTG) и 25-2
(CATCACCAAGAACCGTGTTG) – является
маркерной для определения видов B. аbortus,
B. melitensis и B. suis. Праймеры были заказаны
и синтезированы в компании «Бигль» (СанктПетербург).
Оптимизация условий проведения полимеразной цепной реакции проведена с учётом
имеющихся литературных данных по изучению
Brucella spp и проведению ПЦР.
Была разработана программа амплификации
коллекции ДНК микроорганизмов рода Brucella,
состоящая из 42 циклов. Она включает в себя
несколько этапов: 1-й этап «денатурации» при
95 °С в течение 3 мин; 2-ой этап – «отжига» при
63 °С в течение 1 мин; 3-й этап – «элонгации»,
или «синтеза», при 72 °С в течение 1 мин.
Реакционная смесь состояла из следующих
компонентов: праймеров по 0,1 мкл; буфера для
проведения ПЦР реакции по 2,0 мкл; MgCl 1.5 M
по 1,2 мкл; смеси дизоксинуклеотидтрифосфатов
dNTP в количестве 0,4 мкл и тaq-полимераза по
0,4 мкл на реакцию.
В оптимизированную реакционную смесь
мы добавляли по 1 мкл ДНК, полученной из
сыворотки крови животных; по 0,1 мкл праймеров 24-1 (TGCAGCTCACGGATAATTTG) и
24-2 (ACACCTTGTCCACGCTCAC).
В результате исследования ПЦР-продуктов
методом электрофореза в агарозном геле мы
получили специфические отчётливые полосы,
означавшие, что ДНК бруцеллы содержится в
сыворотке крови животных.
110
Литература
1. Vierstraete Andy // Principle of the PCR. University of Ghent,
March 2001.
2. Фёдоров Н.А., Суханов Ю.С., Асади Мобархан А.Х. и др.
Полимеразная цепная реакция (ПЦР): метод. пос. М., 1996.
С. 33.
3. Сайдулдин Т.С., Уразбекова Д.С. Диагностика бруцеллеза
крупного рогатого скота // Вестник сельскохозяйственной
науки Казахстана. 2000. № 8. С. 37–39.
4. Wardeska B., Jaszczak K., Pierzchaza M., Parada R., Korczak
M. Divergent selection for skeletal malformations in chickens
alters polymorphism at microsatellite loci // J. Appl. Genet.
45(1). 2004. Pp. 61–71.
5. Wardeska B., Olszewski R., Jaszczak K., Zieba G., Pierzchaza M.,
Wicinska K. Relationship between microsatellite marker alleles
on chromosomes 1-5 originating from the Rhode Island Red
and Green-legged Partrigenous breeds and egg production and
quality traits in F2 mapping population // J. Appl. Genet. 43(3).
2002. Pp. 319–329.
Похожие документы
Скачать