» 06.01.05 – 03.02.07 – : , , – 2011 . ., . 2 ……………………….…………………………………………….........3 1. ………………………….……………………………….......8 2. ………………………………………………………….36 2.1. …………………………………………………..36 2.2 …………………………………………………………….42 2.3 SDS- ……………………….43 2.4 …………………………………………………………………..43 2.5 ………………………………………....49 3. RAPD Ribes L…..……………………….………………….……55 3.1. Ribes L……….………55 3.2. Ribes L…………….……………………….........75 4. PAAG SDS……………………………………….………….………80 5. ( ) (R.nigrum) (Cecidophyopsis ribis)…………..…………………..………89 6. Rpf1 - (P.fragariae subsp. fragariae)...............................................................................…98 6.1 6.2. SCAR-R1a ………98 ....……………...........106 6.3. …….……………………….……….………………………….………..111 …………………………………………………………………….114 ……….………………………………………………..………….…….115 ….………………….………………………….………….……..117 ………………………..………………...118 …………………………...…………………………..……………145 3 . , . , - , - , , 1995). (Ribes nigrum L) - (Cecidophyopsis ribis) , 1992, .,1998, - ( , , 2004), , - Phytophthora fragariae Hick. subsp. fragariae) (Parikka, 2004, Ellis, 2008). , , , ( , 1987, - , 2001), - , - ( , 2005, Francia et al., 2005). Ribes L. 150 , . - . , , - , ( , 2002, Collard and Mackill, 2007). - , , 4 (Brennan et al.,1997, 1998, 2002,2009, Haymes et al., 1997, Weg et al.,1997, 2006, Sargent et al., 2008). , - ( , 2003). . – - . : 1) RAPD Ribes L. ; 2) Ribes L. RAPD ; 3) ; 4) SCAR , - GMresa, - ; 5) Rpf1 . . Ribes L ., , RAPD . SDS- - . SCAR - 5 . (Rpf1), . . - SCAR , . Rpf1 . - Rpf1 , , , . , RAPD Ribes L. , , - , . - . SDS- . . «Foodomics» (Cesena), (28-29 , 2009); , 35- - , - 6 – , 16-19 2010 », ); , 155- XXII « . » (26-28 . , 2010) . . - IAMONET-RU, . - (23.01.2009-23.01.2010). . 9 3 , . . , , ,6 , , (241 ), 19 153 - , - , 29 154 ,6 . , , . .( , , , - ) ., - . ( ., , ) . « , ; « », , , » ; , . : ., . . . - . , : , . 7 - Ribes L. RAPD , , - Rpf1 , - Rpf1. « , , » ; , ; « , . », - 8 1. . - , , 1985). , - , , . - , ( ( , , , , .) .,2009). ; ( 300 ), - - , , ( - ) ( , 2004). , , , , , , , - - .), , , . - , 3 2( , 2009). (Ribes nigrum L.) (Fragaria x Ananassa) – , , 1983, - , 2004, GIL-ARIZA et al., 2006, Brennan, 2008). , , (Brennan, 2008), , , ( - , 2010). , , : , , , (World Horticultural 9 Trade &U.S. Export Opportunities, 2006). 2003 (USA market report, 2004). . ( , 1987, , 2001). Ribes L., 150 , . (Ribes nigrum L.), , - (Ribes rubrum L.) - (Ribes uva-crispa L. = Ribes grossularia L.), - (Ribes aureum Pursh). guineum Pursh, Ribes aureum (Ribes san- .) , 1987, Hummer,2002). 28 Ribes L., - 43 10-12 ( , , 1992, Brennan 2008). , ( , , - , 2010). - - - ( , 1998). Ribes L. ) 1908, Berger, 1924; (2008), : Ribes Grossularia Hill ) (Coville and Britton, , 1939, Komarov, 1971). (2002) - 10 Ribes, . (1907), 1962), (Rehder, 1954), ( , (Sinnot, 1985). . , , ( ., 2004, , 2006). , , , (Janczewski, 1907), Ribes Coreosma Spach. – Ribesia Berl.. . 6 , , Grossularia Rich.. – (1939) Ribesia Jancz.( ) ). Ribes , Eucoreosma Jancz ( - (Rehder, 1954), 4 , Ribesia, . ( - , 1962), 9, . - - (Weigend, 2007) (Ribes, Core- osma, Calobotrya, Symphocalyx, Grossularioides, Grossularia, Parilla) - , - . , Ribes - , , ( , 1987). , Ribes . , , , , , - 11 ) ( , 1992, , 2004, Parikka, 2004, Ellis, 2008). , 1992; ( , 1995; , 2000; , 2000). , Cecidophy- opsis ribis - . , ( ) ( , 1984, , 1981, , 1988). - . - ( , 1939). . ( , 1984, Brennan Robertson et.al., 1992). , ( ) , - Phytophthora fragariae Hick. subsp. fragariae (P. Parikka, 2004, Ellis, 2008, , 2008). (Ellis, 2008). (Phytophthora fragariae Hick. subsp. fragariae) . ( 26 ). 2007 . N 673, - 12 . . - , . . . - , , . ( - , 1974). , - , ) , 1993, ( , 2005, )( ( - , 1983, - , 2007, Francia et al., 2005). ( 1). 1. ( , 2000). ( . 1) , – 13 , – - ( 2004, 2000, , 2005, , 1993, , 2003). , , - . - – . - . , - , , , , ( ., 2000, 2002). ( , , 1993). , . : 1. , ( ), - . 2. ; . 3. , - , , ( , 2000). 14 , ( ., 1989, , 2000, ., 2002, 2006, ., 1978, , 1984, ., 2001, , 2002, ., 2007, - ., 2002, , 2006, ., 2007 ( ., .). - ., 2005). , , . , , - ( Prunus) (Zeinalabedini et. al, 2008). : ( , , 1999) ( (R.pauciflorum) , 1994, , 1995). , , ( , 1994). (1995) , , , - , . . , . - 15 , - . , , . - : , - , ( ), (Y- - ), , - . , , , ., , , ( .) ( - , , - , 2004). - : RFLP, AFLP, RAPD, DAMD-PCR, RAMPO .( APS, SSR, SCAR, NBS-profiling, SNP, , 2004, , 2005, Joshi, 1999). RFLP , (Grodzicker, 1974, otstein, 1980). - , , , - . ( , 2004). 16 , , - , , - ( , 2004). , - (RAPD, AFLP, ISSR, IRAP, NBS-profiling c .) , SCAR, SNP (SSR, .). SCAR RAPD, SSR , RAPD ( - . ) , - . ( , 2003, , 2005). , , , , . . RAPD, AFLP SSR - RAPD , AFLP SSR (Jones et al., 1997). - RAPD , - , . RAPD ( 2005). , 17 RAPD - RAPD ( , , - , ) - ( ), - , ( SSR , 2003). - - , - , 100 -, , , . , 2004). - , - ( - EST-SSR – , . EST- SSR – , , , (Keniry et al., 2006). , ( - ., 2003). : 1. - . 2. . , . 10 –100 ., – 10 . 2 . . . - 18 , . - , , (Collard and Mackill, 2010). ( ., 2009). , , . , , , , - (Guilford, Prakash et al., 1997, oart, Vekemans et al., 2003, Aranzana et al., 2003 .). 2007 2008 - , (http://news.discovery.com/earth/apples-genetic-material-is-a-delicious-find.html, Velasco et al., 2009). , « » , , . , (Xu and Crouch, 2008), , , , . , ( - ,2007). , - (Dirlewanger et al., 2004, Korban and Tartarini, 2009). (Fragaria ananassa) (Fragaria 19 vesca .) (Fragaria virginiana Mill.) (Ashley,·Wilk et. al., 2003, Hadonou, Sargent, Wilson et.al.,2004, Cirpiani and Testolin 2004, Folta, Staton et.al. 2005, Davis, DiMeglio et. al., 2006, Cirpiani, Pinosa et. al., 2006, GilArisa, Amaya et al., 2006 .). , « » . NCBI (http://www.ncbi.nlm.nih.gov/) , . - 12 (Brennan et al.. 2002). , - , (Brennnan et al.. 2008). - , SSR (White Pine Blister Rust) , (Burnes and Blanchette. 2008). SCAR – - , . » , - , , . , . - SCAR- - 2004). . , , ( - 20 , 2002). (2000) , - 1967 . , . , , - , . 1% , - , (C , 2004). , , , - , , , (Slater et al., 2008). , . , , , , , , , , - . , ( - , 2009). , , Mackill, 2008). (Collard and 21 RAPD- , , , ( - ., 2001, ., 2007, , 2007, ., 2002, 2004, ., 2008, , 2009, 2010, ., 2008, ., 2010, Bellini, Giordani et al. 1998, Sureeporn Kate-ngam and Padcharee Lakote, 2008, MITRE and LUKÁCS, 2009, Sahasrabudhe, A. and M. Deodhar, 2010). ( , 2004). . , , - . ) ( , - , , , 2002). ( , 2005, , 2007, , 2002, , 2004, - , 2010). » (Angiosperm Phylogeny Group, APG) . APG III (Bremer et al., 2009) - , . - 22 , , , - . Ribes L. , . ( , psbA-trnH , (ITS) - ) , . , , Grossularia - Rib s (Messinger t al., 1999, Senters and Soltis, 2003, Schultheis and Donoghue, 2004). R.nigrum – , . RAPD 21 , - , (Lanham et al., 1995). , , RAPD ISSR , (Lanham et al., 2000). ( , ) (Henry, 2001). , MAS – - . Marker Assisted Selection. . , - 23 . – - ( ., 2009, Subsp.shney and Tuberosa, 2008). 2. ( , 2009). – , - , ( , 2009). 2 - , , , 5 ). . ( - 24 ( ) . - , ( , , - .); - ; - ; ( ) , - ; , - ; . (Francia et. al., 2005, Collard and Mackill, 2008). . , MAS: ( 5 , - ), ; - ; ( ); , ; - (Mackill & Ni 2000). , . ( 2005, ., 2004, ., ., 2009, Paran et al., 1993, McDermott et al., 1994, Toojin- da et al., 1998, Witcombe et al., 2000, Colton et al., 2000, Hash et al., 2003, Hash et al., 2004, YOU et al., 2005, Ribaut et al., 2007, Jena et al., 2008, Zhang et al., 2008, Vida et al., 2009 .). MAS - 25 , , , (Guimarães, 2007). , , , . QTL (King, Tartarini, 1999, Tartarini et.al., 2000, Bus et al., 2002, Hemmat, Brown, Aldwinckle, 2003, Liebhard, Koller et al., 2003 Gygax et al., 2004, Afuniana, Goodwina, Hunter, 2004, Belfanti, Silfverberg-Dilworth et. al., 2004, Boudichevskaia et al. 2004, Patocchi, Bigler et. al. 2004, , Patocchi et.al., 2005, Boudichevskaia et al., 2006, Urbanovich et al., 2008, Patocchi et al., 2009), (Roche, Alston et al., 1997, Cevik and King, 2002, Bus and Chagné et al. 2008), (Dunemann, Bracker et al., 1999, James and Evans, 2004,), Erwinia amylovora (Khan et al., 2009) . , - ( ., 2010). , (Silva, Garcia- Mas, 2005), (Lecouls, Rubio-Cabetas et al., 1999, Esmenjaud, 2009) Mnejja, 2004) (Arús and . , , , , , , (Keller- Przyby kowicz et. al., 2006). Collard and Mackill (2008) , , 26 MAS , , (Collard, Mackill, 2008). , (Francia et al., 2005). . Cecidophyopsis ribis , , - ( ) , - . - . , ( , 2004). : - (Anderson,1971) (Knight et al, 1974). , , , (Knight, 1981). . ( , 1984, , 1995). - (Brennan, Robertson et.al., 1992). 88% 27 . , 100% - . , , , .( , , 1992, Lanham et al,1997, Brennan et al, 2002). (SCRI) , . SCRI, 10 , - (Brennan et al, 2009). , » (Xu and Crouch, 2008). , , , , , . , (Collard and Mackill, 2008). MAS , , , ( , 2003). , - , , . MAS , ( ) - 28 . , MAS , , - , (QTL) (Francia et al., 2005). (fine mapping) 3. MAS (Collard and Mackill, 2008) ( .3) ; , ; , ; - ; ( Collard and Mackill, 2008). . - 29 . . (1972) : - .« - , , . , , » ( , 1972, http://selplod.ru/immun/?p=22). 1971 . (Flor, 1971) ( - ) , . , ( ), - . , – . - – - « , ». - . - , – , – (Howard, 1968.), – (Moseman, 1957), (Boone, Keitt, 1957, Bagga, Boone, 1968) « »( – . .4), (Jones and Dangl, 2006). , . 30 (PAMPs, ). , . (trans- membrane pattern recognition receptors – PRRs) , - PAMP-triggered immunity (PTI). 4. « », (Jones and Dangl, 2006; - ). ( ), PTI, , (effector- triggered susceptibility - ETS). 31 (NB-LRR protein), - (effector-triggered immunity - ETI). (PTI), . , , - , ( )– . - NB-LRR, , . , , - ( ) - ( ) [PTI – ETS + ETI]. R LRR , NB- , , NBS profiling. , , R (Linden et.al., 2004). (Baldi, Patocchi, 2004) . , , , , Jones and Dangl (2006), NB-LRR , / , 32 , NBS profiling - , . (Colleto- tRich.um acutatum) (Phytophthora cactorum) (Guerin et al., 2003, Parikka, 2004). SCAR Rca2, . 43 , 81,4% (Lerceteau-Köhler et al., 2004). - (Lerceteau-Köhler et al., 2004, Weebadde et al., 2008). - (Phytophthora fragariae Hick. subsp. Fragariae). - , - . , - ( . , 1974). (1997 ) , 5 - (1971). » - (Patocchi and Frei, 2009). . , R1, Rpf2 (Weg, 1997). (Weg, 1997a). Rpf2 Rpf3 RAPD R3 - , Rpf1 33 (Haymes et al., 1997,Weg et al., 1997c) SCAR , (Haymes et al., 2000). , , , - , Rpf1 (Haymes et al., 2000, Sasnauskas et al., 2007), RAPD . - ( , ) , 145 (Rh50, ) Rpf1 , - ). b press). , 6 (Dijk, in , Rpf1, , . - , , - . , . - , - , , , ( - ., 2004). , 34 . , ( , 2005). , - , , ( , 2004). - , (Werner et al., 2004). 2009 , (Sargent et.al., 2009) (Viruel et al., 2002, Sargent et al., 2004, Spigler et al., 2008 .). (comparative genetic mapping) ) (Rousseau-Gueutin, LerceteauKohler t al., 2008). , , 2008 (Brennan et. al., 2008). , , , - , . , , . - , , . - 35 Rib s L., - , - . - . . 36 2. . RAPD Ribes L. « » - , , , . . SDS« , », . ., . Rpf1 - , SCAR WUR, . « , » , ; ; « , , », - . 2. 1. 2.1.1. RAPD Ribes L. 47 Ribesia Berl. ( Grossularia Rich. ( ) Ribes ) . besia Ri- (Eucoreosma, Calobotrya, Sympho- calyx, Ribesia), , (CCC , , , )( 1). R. nigrum, - , 9 nigrum 3 Eucoreosma . ) R.ussuriense ( ), R.dikuscha Fisch. ex Turcz. ( R.hudzonianum Rich. ( ) R. Pauciflorum Turcz. ( R. ), - 37 ), - . 4 , , ( 1613/17, ), Ribes, - Eugrossularia, Eucoreosma Calobotrya. 1. Ribes, ( 1 2 2 3 4 5 258 250 6 Josta Rehder A., 1954) 3 R. grossularia L. R. grossularia L. 4 5 6 Grossularia Rich. Eugrossularia Grossularia Rich. X Ribesia Berl. Eugrossularia R. nigrum X Eucoreosma Ribes divaricatum Jancz. 13-15-3 ) 7 203029-61 8 1613/17 , Grossularia Rich. Ribesia Berl. : Eugrossularia R.oxyacanthoides Engh Eucoreosma Jancz. Calobotrya Spach 9 29 35 - , Grossularia Rich. Ribesia Berl. R. nigrum R.bra teosum Dough R.glutin sum Benth : Eugrossularia R.oxyacanthoides Engh Eucoreosma Jancz. R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. scandinavicum R. nigrum subsp. 38 1 2 10 11 12 16 13 14 15 17 18 19 20 21 22 25 24 27 28 30 31 32 33 26 23 R.hudsonianu m Bourg. ex 4 Ribesia Berl. Ribesia Berl. Calobotrya Spach 5 Eucoreosma Jancz. Eucoreosma Jancz. Ribesia Berl. Eucoreosma Jancz. R. nigrum subsp. Ribesia Berl. europaeum Jancz. ?* Eucoreosma Jancz.. R. nigrum subsp. Ribesia Berl. europaeum R. nigrum subsp. scandinavicum Ribesia Berl. Eucoreosma Jancz. R. nigrum subsp. Ribesia scandinavicum Berl. Ribesia Berl. Eucoreosma Jancz. Eucoreosma Jancz. Ribesia Berl. Eucoreosma Jancz. Ribesia Berl. Eucoreosma Jancz.. 3 R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. europaeum Jancz. R. nigrum subsp. europaeum Jancz. Eucoreosma Jancz. europaeum R.dikuscha Fisch. ex Turcz. R.glutin sum Benth 6 R. nigrum subsp. europaeum R. nigrum subsp. scandinavicum R.ussuriense R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. scandinavicum R. nigrum subsp. europaeum R.ussuriense R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. scandinavicum R. nigrum subsp. Europaeum R.dikuscha Fisch. ex Turcz. R.hudsonianum Bourg. ex S.Wats. 39 S.Wats. 34 1 2 3 R.ussuriense Jancz. 36 37 3864-46-62 38 - 39 R. Pursh Ribesia Berl. Eucoreosma Jancz. 4 Ribesia Berl. Ribesia Berl. 5 Eucoreosma Jancz. Eucoreosma Jancz. sanguineum Ribesia Berl. R.multiflorum Kit.. R.dikuscha Fisch. ex Turcz. R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. scandinavicum R. nigrum subsp. europaeum R.dikuscha Fisch. ex Turcz. R.pauciflorum Turcz 6 R. nigrum subsp. sibiricum Wolf E. R. nigrum subsp. europaeum R. procumbens Pall. Calobotrya Spach Ribesia Berl. Ribesia Berl., emend Jancz. Ribesia Berl. Ribesia Berl., R.multiflorum Kit. emend Jancz. R.sativum Syme subsp. macrocarpum Jancz. R. petraeum subsp. atropurpureum Ribesia Berl., emend Jancz. R.mandshuricum** 40 1002-17-110 41 42 43 44 45 46 R. petraeum subsp. Ribesia atropurpureum Berl. 970-18-41 Ribesia Berl. R.rubrum L. Ribesia Berl. R.sativum Syme Ribesia Berl. R.sativum Syme Ribesia subsp. macrocarpum Berl. Jancz. R. warszewiczii Ribesia Ribesia Berl., R.sativum Syme emend Jancz. R.rubrum Z. R. petraeum subsp. atropurpureum Ribesia Berl., emend Jancz. Ribesia Berl., emend Jancz. Ribesia Berl., emend Jancz. Ribesia Berl., 40 47 1 2 48 ***- Jancz. R.palczewskii (Jancz.) Pojark Berl. Ribesia Berl. emend Jancz. Ribesia Berl., emend Jancz. 3 R. aureum Pursh 4 Ribesia Berl. 5 Symphocalyx Berl. , 6 , Ribesia ( ) - R.rubrum, R.sativum, R. warszewiczii, R.palczewskii, R. petraeum, R.multiflorum, (970-18-41, 1002-17-110). Calobotrya - R. san- guineum ( ), Symphocalyx - R. aureum ( ) Eugrossularia - R. uva-crispa ( ( ), - , 203029-61). – Philadelphus pallidus Hayek., (Hydran- geaceae). ( , 1939) Saxifragaceae DC. : Saxifragoideae A.Br., Hydrangeoideae R.Br. , . . - Ribesioideae Engl. (2001) - (Cronquist, 1988) , (Grossulariaceae) (Saxifragaceae). , (Rosales). SDS- . 7 (3 - , , 4 – 3268-4-36, 2091-39-32, 3190-44-57, 3122-47-29). , . - 41 (R.nigrum) (Cecidophyopsis ribis). - 37 . : 31 ,1 - , 3 ( 2 . - 13). , - . . ( ., 1995.). . 0 - 5. 2.1.2. Rpf1 (64 .), Fragaria ananassa Duch: -4 (Rpf1, rpf1), , , , (rpf1, rpf1), . . , 120 - , . (Weg et al., 1993, 1997, Haymes et al., 2000, ). (1997b) (1989), Scott et al. (1975). Maas et al. 42 2.2 . Edwards (Edwards et al., 1991) c . , . - , D. Puchooa (2004) - ( 1). , - , , , , NaCl, , - . . -80º , ( Thomas and Tanksley (1990) . - ) , Doyle and Doyle, 1987 ( . 2 3). - , -80 º , , . . -80º - 2 – Freeze Dryer (Ilshin R Europe, the Netherlands). 5 28-30. - 43 . – 300 . 2.3 SDS- . 50 , ) - , ( ; ., 2000). - . ( 8,3), . - . SDS- 12,5 % ( , VE-4). . , - . , . ( , , )( - , ., 2005). - . 2.4 RAPD Ribes L. - OPA, OPD, OPE, OPH, OPK, OPN ("Operon Technologies", ). 18 . 15 , 44 2.5 MgCl2, 0,2 dNTP; 0,5 ; 0,3 , 1x (« 100 , Biosystems», - 45 », : - 30 37° ; -1 . 94° ; - 72° -5 - 36 (94° ). - 1,7 % “Sigma”, MetaPhor) ), GeneAmp PCR System2700 («Applied ) . Taq 1 (High resolution, , - . GeneRul- erTM 100bp DNK Ladder Plus (Fermentas, ) . SCAR (R.nigrum) (Cecidophyopsis ribis). 20 MgCl2, 0,2 , 1,6 dNTP; 0,17 TTACCGCAGATACAAGGTGAAG (GMresaF 5` 3` GMresaR 5` GGACTAGGCCTTCTTATGAC 3`(Brennan et al., 2009)); 0,3 DNA polimerase, 1x neAmp , 10 System2700 («Applied Biosystems», : - 30 – 30 - 15 . 94° ; , Ge- ). - – 30 72° ( Gold . 58° ; – 30); (94° ) – 10 - 72° . . 2% 1 c . - GeneRulerTM Express DNA Ladder (Fermentas) SCAR-R1a . - 2. . 45 , GeneAmp 2720 Thermal Cycler (Applied Biosystems, ). 2% , ABI PRISM® 3100 Genetic Analyzer (Applied Biosystems, C ). , , , - . 2. 1 BFACT 10 2 UDF-019 3 ARSFL-7 4 EMFn123 5 ChFaM1 6 Fvi6d 7 8 Cx661654 EMFn 185 (GA)11 9 ARSFL22 (GA)11 10 EMFn 228 (CT)9 11 EMFn 225 (CT)21 12 EMFvi 025 (TG)8 13 EMFV104 (AG)25 14 BFACT026 15 BFACT047 16 EMFv6 (GA)34 17 CFVCT030 (GA)25 . F:TGTCATTTCCTCCAGTCTTATTCC R: CAGCAACATCCATGGCTACC F: TGGAAATCTGCACCGTAAGA R: TCAGCACTTTAAGGCAGGTG (CT)14(GA)13 F: GCGCGCATAAGGCAACAAAG R: GCGAATGGCAATGACATCTTCTCT F:CATTTCGGGCACACTTCC R:AGACGGCAAAGAGACTCACC (GA)20 F: GGAGATTATGCACAAAATATAGAGA R: CCAGAACTCCATCAGCCTCT (GA)15 F: TCCTGATTCAACCACAAGAT R: GTAACACTCATTGCTTCAGGTA F:GTAACGACGGCTGCTTCTCC R:CGCTCGCTCTTATAAACTTCC F: GCGAACCCCATTAACAGCTTCA R: GCGATCAAATTCCCCTCTAACAAT F:TTGCTGAGGATTTGAAAATGG R: TGAAGTTTACTGGCGTTTGC F:AAGGAAAAATGCTCAAATACCC R:TACGTGCGACGTTAGAGTCC F: TTGTGATCTCGTAGAAGGAGCA R: GGGTTCCGTGAAACTAAACTTG F:TGGAAACATTCTTACATAGCCAAA R:CAGACGAGTCCTTCATGTGC F:CTCTTCTAAACCACAAAATCCAGTT R:AACAAAGGAGAGAAATGGTTGG F:ATCGTACCTATGCATCATCTGC R:AGGCAGGACCATCAACTAAGAG F: CGCCGTTTGAGATTGCCCTGAA R:CAAATTGCCACCCCTAGAGAAAAG F: TCGATCGATTATCACCATGAA RousseauGueutin,2008 Cirpiani and Testolin, 2004 Ashley et al.,2003 Sargent et al.,2006 Gil-Ariza et al., 2006 Ashley et al.,2003 Sargent al.,2006 et Lewers,2005 Sargent et al.,2006 Sargent et al.,2006 Sargent et al.,2003 Sargent et al.,2006 RousseauGueutin 2008 RousseauGueutin 2008 James et.al., 2003 Momfort et 46 18 CFVCT028 (CT)17 19 EMFn 117 (CT)15 20 FAC-004d (GAA)6 21 22 R: CGTCCTCAACATCTCCTTCC F: GGGAAGAGAGGCCTAAAACC R: CGGCGTCTCAACTTGACC F:ATCGGATCAACAAGCAAAGC R:ATGGATGAGGGGAGAAGAGG F:GTCCATACTTTAAGCCGAATGC R:ACGTCCCTTCACAATAAAATGG Rh76 Rh50 23 UFFxa01E0 3 24 CFVCT005 al., 2006 MONFORT et al., 2006 Sargent et al.,2006 Lewers,2005 Yan, 2005 Yan, 2005 F:TGATGAAATCATCCGAGTGTCAG R:TCACTTTCATTGGAATGCCAGAAT F:ACCCCATCTTCTTCAAATCTCA R: GACAAGGCCAGAGCTAGAGAAG F:GCGACAGCTTAGGGTTGAAG R:CTTCTCCTCGCCTGTGAAAT (CAC)10 (GA)10… (GA)11 Sargent et.al., 2006 Momfort et al., 2006 ABI PRISM® 3100 Genetic Analyzer, , . Sephadex G-50 . , - (Millipore multiscreen), , , . . , - ABI PRISM® 3100 Genetic Analyzer , . - – . - , ( ), 2) 3). 1) ( , ), 3) - 47 , ( - tail) 17 ( , - , ), Schuelke (2000); 4) 17- - ( ). . 5 . 3. , 10x 2,0 MgCl2 (25 mM) 1,6 dNTP's (5 mM) 0,8 F* +R (2 GoldStartTaq M+2 (5 U/ M) 2,0 ) 0,06 MQ 12,54 10 ng/ 1,0 20 , MP KIT. 5,00 F1 * + R1 (2+2 µM) 1,00 F2 *+ R2 (2+2 µM) 1,00 10 ng/ 1,00 10,00 17 , 10x 2,00 MgCl2 (25 mM) 1,60 dNTP's (5 mM) 0,80 F +R 17* F GoldStartTaq (0.5+2uM) (2uM) 2,00 2,00 (5 U/ ) 0,06 48 MQ 10,54 10 ng/ 1,0 20 17 , MP KIT. 5,00 F1 + R1 (0.5+2 µM) 1,00 F2 + R2 (0.5+2 µM) 1,00 17F* (2µM) 2,00 10 ng/ 1,00 10,00 *- . . , EMFV104, BFACT026 EMFvi025, 97-150 , 147-182 267-283 . , - , . 17 (forward) , . - – (5`-AACAGGTATGACCATGA-3`). . 4. * 94°C 94°C 30 49 50°C 30 35 72°C 72°C 10 *(95) (72) ( 1° (50), (50) . 4), - 10 MP kit.. SCAR-R1a 5), Haymes et al., 2000. : F: 5 -TGC ATC ATT AAT GTA GAA GTC TTT-3 R: 5 -TGA TGC GAC ATA CAA AAA TAT TAG-3 . : 94º 45º , 1 3 ; 30 72º ; : 30 7 5. 94º , 45 72º . SCAR-R1a , 10x 2,00 MgCl2 (25 mM) 1,60 2 mM dNTP's (5 mM) 0,80 0,2 SCAR-R1a-F (10 µM) 1,00 0,5 SCAR-R1a-R (10 µM) 1,00 0,5 0,06 0,015 Taq (5 U/ MQ ) 3,54 (10 ng) 10,00 20,00 2% . 285 . - 50 2.5 . RAPD Ribes L. , 300 2000 - . , - . RAPD , - RAPD- 1 0 . (GD) Statistica 6.0 TREECON (Van de Peer and de Wachter, 1994). (GD) - . UPGMA ( - - unweighted pair-group method using arithmetic averages). UPGMA - . (STATISTICA, , III, www.statsoft.ru). : - RAPD , - – 100 - Nei and Li (1979), - . - . - , . 100 , - 51 – . - , ( 100), . , , - , . ( , - , 1988, Zharkikh and Li, 1992, 1995). . ABI PRISM® 3100 Genetic Analyzer Genotyper ) GeneMapper. , - 52 ) 5. Genotyper 3.6 ( ) Gene- Mapper ( ). , ( - . 5). –« », , , .). « », , 1-2 30 % ( 6. , . 6). ( « - »). Genotyper/GeneMapper Microsoft Office Exel. , , , . 53 Rpf1, . Microsoft Of- fice l. , ( , , .). . . - , . . , (1:1 3:1), . « », , - , . » « - , , – - , . . , , - , , . JoinMap (manual JoinMap 3.0, 2001). . , ARSFL007_YS220Y222S224 , - 54 ARSFL007 -4 ( 220 Y Yalova), (S . Senga-Sengana). <abxac> ( – 222 220 224 - – , ). , b, , b . ( , - SCAR- R1 ) JoinMap 3.0 3.0, 2001). – - (manual JoinMap – . . . LOD - 3. - . 2 – , ( ={4 f12/S-N} 2 - , 1980) 2 st f1 - ( ), - , f2 - , S- (S= f1+f2) Vg- (V=g-1) , . 55 3. RAPD Ribes L. . . . RAPD – , . RAPD Ribes ( . ) - ( , ) , - , , . 3.1. Ribes L. RAPD , , 18 (OPN13, OP 10, OP 1, OP 8, OP 7, OP 5,OP 9, OP 6, OPD12, OPD8, OPD6, OPN14, OPN8, OP 2, OP 3, OPN12, OPN19, OPD3). , ( .7). OPN-19 . , ( ( 1), 2), 56 ( 4, 5 3). - 6 - . 5 6 4 1 3 1 1 4 1 1 2 2 7. OPH-8, OPE-7 3 OPN-19 , ( .- , - .– ). , OPN-19 , , - , . 8 OP - , , , - , , . OP -7 ( , - , - 57 ,), , - . 9 (OPD6, OPD3, OPN14, OPN8, OPN19, OPE1, OPE3, OPE5, OPE2), , - . RAPD 47 ( . . . Ribes. .8, - 4-6). dikxhud . . . . . . 3000 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 2000 1500 1200 1000 900 800 700 600 500 400 8 OPN19 1 . 1; – ; – 48 - , – , .– , ; 1- .- , .– - , dikxhud - - , .– , , .– .- , .– ). 274 330 2000 , - 270 , . - , - 58 , 22 (OPD6) 30 ( 41 (OPN14) 6). 6. , - RAPD ,% D6 D3 N14 N8 N19 1 E3 E5 E2 ACCTGAACGG GTCGCCGTCA TCGTGCGGGT ACCTCAGCTC GTCCGTACTG CCCAAGGTCC CCAGATGCAC TCAGGGAGGT GGTGCGGGAA : : 22 33 41 32 31 26 32 25 32 274 30 22 32 40 31 31 26 32 25 31 270 30 100,0 97,0 97,6 96,9 100,0 100,0 100,0 100,0 96,9 98,5 . Idaeobatus Rubus L. 9 (Zhang et al., 2009). 24 - 27 RAPD 6,9 (Senthilkumaran, 2008), – 12,5 (Fernández et al., 2002). , , 97% ( E2) D6) 100% ( - 98,5%. , al.,1995, , (Lanham et , 2001), 21 12 - RAPD 26% , - 29 % - . Ribes (12 6 39 % (Lanham et. al., 2000), ) , , - 59 . , . , , , (47), , , - , . RAPD tum Moench , Fagopyrum esculen- F. tataricum (L.) Gaertn., , 92,85 % RAPD , - (Senthilkumaran et al., 2008). RAPD, Ribes 7). 7. Ribes L. RAPD ,% Ribes nigrum 147 172 172 243 93 140 152 236 63,3 81,4 87,4 97,1 - 207 192 93,2 - 202 192 95 Ribes nigrum 93 – (9 (29 147 ). ) 172 , (9 , 152 , 236 . . ) . (38 140 172 - ) 243 - 60 (33 ) 207 , 192 (13 202 , , 192 , . ) - . - , - . (172 ) (172 ), (29 ), , - 9 - . . - . , (63,3%) (81,4 - 87,4%). , (93,2%;95%;97,1%). (Grossularia Rich. - Ribesia Berl., reosma Jancz. -93,2; Grossularia Rich. - Ribesia Berl., ( Euco- Ribesia Berl. - 95) Eucoreosma Jancz. - besia Berl. – 97,1). - , Ri- , , , . ( - , 1962), 9 , Grossularia, Symphocalyx, Ribesia, Calobotrya, Eucoreosma Calobotrya Calobotrya. 17 (Cajanus cajan) 17 RAPD 74,7% - 61 (Neha Malviya and Dinesh Yadav, 2010). 9 R. nigrum (63,3%) (81,4%). - R. nigrum, , . 16 RAPD - 10 - 63%, (Fernández, 2002). ( ( , . 9), . 10). - , , - RAPD - . 38 39 1 2 3 4 5 48 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 9. 2( ; 38 , 39 - , 48 - ; – ). 9 , RAPD -2 62 ( 38), ( 48) - ( 39). 1 2 2 10. OPN 14 ( – , . ). 10 (1), : RAPD , , - Eucoreosma Ribesia, Symphocalyx (2). , ( - 8), - , . 6 - . (R.grossularia), (R.sativum Syme subsp. macrocarpum Jancz.), nigrum subsp. sibiricum Wolf E. guineum Pursh R. nigrum subsp. uropaeum) (R. . R. san- 63 6 . R.multiflorum Kit. , R.mandshuricum - 6 , . 8. , 36 37 , R.ussuriense 3864-46-62, R. nigrum/ R. procumbens Pall. , R. sanguineum Pursh , R.multiflorum Kit. R.mandshuricum , R. uva-crispa , R.sativum Syme subsp. macrocarpum Jancz. , R. nigrum subsp. sibiricum/R. nigrum subsp. europaeum , R. aureum Pursh 38 39 4 45 11 48 1 4 6 6 23 42 **- **, OPN14-740 OPN8-510,OPN14-550,OPN14-750, OPD6-590 OPE2-1000,OPE2-1450,OPN141320,OPE3-670,OPD3-1150,OPE3-1200 OPE2-700,OPN19-530,OPN19710,OPE3-1350,OPD6-640,OPN8-660 1 1 OPD3-1170 OPN8-500 1 OPD3-600 4 OPN8-600,OPE1-790,OPE2-530,OPN14720 OPN14-590 , R. nigrum subsp. 1 sibiricum/R. nigrum subsp. scandinavicum/ R. nigrum subsp. europaeum/ R.ussuriense DikXHud38, R.dikuscha 3 Fisch./ R.hudzonianum Bourg. 970-18-41, R.sativum Syme/ 1 R.rubrum Z./ R. petraeum subsp. atropurpureum 20 - OPE5-430,OPD6-600,OPD6-810 OPD6-650 , , , , OPN14-460, OPD3-400), 100 , .11. . ( 2-920, 64 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 11. N-14 ( OPN14-4-460, - Ribes; 1 - 48 . 1, – ). Ribesia Berl. ( . 12), ) Grossularia Rich. ( 950 ( 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 1-16-490, OPE3-24-440 ) 2-19-800, OPD3 -3- .13). 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 39 40 41 42 43 44 45 46 47 12. - 3( - Ribesia Berl.; 1 . 1, – 48 ). (OPN8-1100, OPE2-770, OPE2-1100, OPN19-22, OPD3-920) : 6-37), ( . - 65 (OPN14-430, OPE5-15). 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 3536 37 38 39 40 41 42 43 44 45 46 47 48 13. - 2( ; 1 1, - 48 – . ). , - , . - (OPN8-1100,OPE3-750, OPE3-540) - Ribesia Berl. emend Jancz. ( ), Symphocalyx Berl.. ( : 39-48). , - , Ribesia Berl. Symphocalyx (OPN8-1200); , , Grossularia Rich. Symphocalyx (OPN8-690); , Eucoreosma Jancz. ( ) , Calobotrya; . , - , . RAPD (1997) 66 . , , , , (Lanham et al.,1997). RAPD ( . 14), , 2 3 , RAPD , 4 - (1999). 5 2 OPN8 3 4 5 2 14. RAPD - OPN8 – ,5– 2 (2- 13-15-3; 250, 3- 258, 4 . ). .14 , , - . 250 ( 2) . 258 ( 3) 13-15-3 ( 4) - - 67 , , , - ( 5). , , ( , , ) ( . 15). ) ) 15. ) RAPD ( - , , ); ) . – 68 , 762-5-82 , , , , - . , , , . ( , . (1995) , 2004). RAPD . , 100 % , RAPD - . . - Statistica. , - Ribes 0,01 ( , - Symphocalyx ) R. sanguineum 0,23 ( R.aureum Pall. Calobotrya). - , , , Ribes L. , ( , , .) Microsoft office Exel , 9). , - ( - 69 9. - Ribes L., RAPD - ( Grossularia Rich. Berl. Ribesia 0,13-0,19 .) .* .* 0,16 0,0024 0,14 0,0011 Ribesia Berl. Grossularia Rich. Berl. Ribesia 0,12-0,17 Eucoreosma Jancz. Calobotrya - Grossularia 0,15-0,18 0,17 0,0069 Symphocalyx - Grossularia 0,19-0,21 0,2 0,0036 0,14-0,21 0,16 0,0006 Calobotrya - Ribesia 0,14-0,23 0,17 0,0078 Calobotrya - Eucoreosma 0,12-0,16 0,14 0,0020 Symphocalyx- Ribesia 0,15-0,18 0,16 0,0032 Symphocalyx- Eucoreosma 0,17-0,22 0,19 0,0022 Eucoreosma Jancz. Ribesia Berl. Symphocalyx- Calobotrya 0,22 ( R. nigrum, R. ussuriense 0,04-0,05 ) 0, 05 0,0009 0,08 0,006 Eucoreosma Jancz. ) , 0,05-0,13 R.petraeum subsp. atropur- pureum, R.rubrum, R. sativum, R.warszewiczii, R. palczewskii Ribesia Berl.) Eucoreosma Jancz. 0,01-0,08 0,04 0,0006 Ribesia Berl. 0,04-0,13 0,07 0,0038 Eugrossularia 0,03-0,05 0,04 0,0024 70 R. nigrum (10-17,19) 0,02-0,05 0,03 0,0012 (27 0,01-0,07 0,04 0,0004 (5 0,04-0,09 0,06 0,005 0,1 0,003 0,07 0,001 , 8-22, 24-35) , 43-47) Grossularia Rich. .- . 0,08-0,11 Eucoreosma Jancz. 0,05-0,09 .- . 29 Eucoreosma, , Eucoreosma (R. bracteosum, R.pauciflorum. R.dikuscha Fisch, R.ussuriense .), Grossularia (R. oxyacanthoides) ( Calobotrya (R.glutin sum), .14) - 0,01-0,08 , Ribesia - 0,04-0,13, - Ribesia: R. rubrum, R. sativum, R. warszewiczii, R. palczewskii, R. petraeum. Ribesia ) ma Eucoreos), ( , 5 ), . .16. , R. nigrum , , , . - R. rubrum, R. sativum, R. petraeum, (Brennan, 2008). - 71 . 16 . , ( , ), . 16. ( , 2004; . ). ( Grossularia) 0,03-0,05, , , (4 ). , 2030-29-61 , Grossularia) : R. disubsp.icatum R. nigrum ( Ribesia), 72 (0,05-0,09), (0,08-0,11). (Ribesia) osma) (0,14-0,21); (EucoreSymphocalyx R.aureum ( ) (0,17-0,22); ) Eucoreosma ) Symphocalyx R.aureum ( - Calobotrya R.sanguineum ( ) (0,23); - Calobotrya R.sanguineum ( ) Ribesia ( - ) (0,14-0,23). Grossularia , Ribesia . Grossularia ( Ribesia - , ) Eucoreosma ( ) 0,12-0,17; Grossularia ( Ribesia - ) Calobotrya - R.sanguineum ( - ) - 0,15-0,18. , - (0,12 – 0,23), ( Ribesia Grossularia) (0,12-0,21). ( Grossularia), Ribesia, Eucoreosma) , . , (R. sanguineum) Calobotrya Symphocalyx - 73 (R. aureum) Ribesia . , , R. sanguineum Calobotrya, - Ribesia) (0,14) , (0,17) (0,17). , - , . , - , , R. sanguineum subsp. gluti- nosum ( , , 2004). 4 Ribes : 1) Eucoreosma Calobotrya Grossularia, 2) Ribesia Ribesia, 3) Sym- phocalyx. 8 ( .17), , , . - , . ( ) - . 0,1 ( ). 0,1 0,05, ( Grossularia Rich..), - Ribes L., 0,05. R. nigrum . - . . 17. RAPD ( , . . R . n ig r u m . , R . p e t re u m / R . ru b ru m /R .w a rs z e w i c z i i/ R . s a t i v u m ( R i b e s i a ) R . n ig r u m / R . u s s u r i e n s e ( E u c o r e o sm a) E u c o re o s m a / G r o s s u la r i a / S y m p h o c a l y x / C o lo b o t r y a S y m p h o c a ly x / E u c o re o s m a S y m p h o c a ly x / R ib e s ia C o lo b o try a / E u c o re o s m a C o lo b o t r y a / R e b e s ia ( E u c o r e o s m a / R ib e s ia G r o s s u l a r ia / S y m p h o c a ly x G r o s s u l a r i a / C o lo b o t r y a G r o s s u l a r ia / E u c o r e o s m a G r o s s u l a r ia / R ib e s ia 74 Eucoreosma Jancz.); Ribesia Berl. - Eucoreosma Jancz., - . 0.25 0.2 0.15 0.1 0.05 0 . . - - - ). - - - 75 3.2. Ribes L. RAPD - (UPGMA) , ( .18). 18. 47 Ribes, RAPD 93% , . - 76 . - Ribes ( essinger at al.,1999, Senters, Soltis, 2003, Schultheis at al., 2004), . Ribes . , Eucoreosma Ribesia ( - ), - . R. grossularia (= R.uva-crispa, Grossularia), , – Ribesia Ribesia. Calobotrya Ribesia R. sanguineum ) Ribesia Symphocalyx R. aureum ( ). - , R. nigrum. R. nigrum R.procumbens, R.ussurienses - . R. dikuscha R.hudsonianum. .(Lanham et al., 2000) RAPD ISSR , Eucoreosma - R. dikuscha, R. nigrum R.ussurienses . , - ITS (Messinger at al., 1999, Senters and Soltis, 2003). , . , R. 77 nigrum , , - , c R. nigrum: R. nigrum subsp. euro- paeum Jancz. , , ), R. nigrum subsp. sibiricum ( navicum ) , , - R. nigrum subsp. scandi- ). . ( 72%) , ( 100% - R. nigrum subsp. scandinavicum, , -25% ). , , R. nigrum subsp. scandinavicum , , 50% 25 %, - , (25%). . (Lanhum et. al.,1995) - . ( , , , , ), R. nigrum subsp. euro- paeum (65%). , - . , (100 % ), . , - ( , , , 78 ), , , RAPD , . (Lanhum and al.,1995) . , - , , RAPD . : - ; , , ; . ( ( 100%) 2030-29-61), , , . (Lanhum at. al.,1995) . ( Eucoreosma - Ribesia) R. grossularia, Grossularia. - , ), R. sanguineum ( Calobotrya - Ribesia. - ITS, ETS, psbA-trnH - R. sanguineum Grossularia (Shulthies, Donoghue, 2004). Ribesia 96%), . R. sativum ( , ), R.palczewskii ( ), R. petraeum 79 ), R. warszewiczii ( ), 1002-17-110, R.multiflorum, R.sativum, R. petraeum. ( 79%), R.rubrum ( , R.rubrum 970-18-41). , - R.multiflorum R.mandshuricum. , GRIN (http://www.ars- grin.gov/cgi-bin/npgs/html/taxon.pl?31860) R. sativum R.rubrum , R. sativum R.rubrum - R.palczewskii, R. petraeum, R.warszewiczii. ITS Ribesia (Senters and Soltis, 2003). Ri- besia (R.mandshuricum, R.petraeum, R.triste) ( . R.rubrum) , Berisia (Senters and Solt- is, 2003). RAPD Ribes R. aureum ), , . Symphocalyx (R.aureum , psbA-trnH and Donoghue, 2004). - R.odoratum) - ETS (Schultheis 80 4. SDS. , , . , . , - , . . SDS- 7 - . SDS- . - : - , ( , 1987, , 1988), ( - (1995)) ( , 2000). , . (1994) 7SSDS, , 11S- , - . - - 81 - : 10-40 ( 105-110( 1) ( 4), 43-67 ( 3), 85-100( 2) .19). 4 3 2 1 19. ( , - ). , , (65 ) (25 - (45 )- 22 , 37, , ) – 65 (17,5 ) – 108 ( , 2000), . 43 65 . ) 33 22 39 , - ( ) – 17,5 20 . - SDS- ( , 1994) , - 82 ( 22-25 (1), 32-37 (2) 47 (3)) . ( 43 65 ( ) 47 ) . 47 , , , ( . 20). 10 1 0 20. ( 10; 4). (1995) 40 20 . - , , 2 . - , ( , ) ) 3 11S ( - . . 83 . , ( , 2 , 1994, - , 1995). 3 , , - . 3 (33-39 48, 50, 52, 53. ) 5 2 (20-22 : 46, ) 5 - : 85, 86, 88, 90, 92. . 1 (22-25 ) (1994) 13 , (1995) 2 (32-37 - ) – 10. - 8 . - , , , . 3 9 4 ( 2 10). 10. - 2 3 3 2 - 46 1 2 3 4 5 6 7 8 9 1 1 1 2 2 1 48 1 1 1 1 1 1 2 50 2 1 1 1 2 2 52 1 1 1 1 2 1 1 2 1 53 1 1 1 1 85 1 1 , 86 88 2 2 90 2 2 2 1 92 2 1 1 84 3 48, 50 52, ; – 46, 48, 50, 52, 53; 46. - 46, 48 46, 48, 52 48, 52 53, 52; – 53, . – (46 48) (50 52). (46, 50, 52) , - 46 52. 2 85, 90 92, 92. , (90 . 92), . 86, 88 90, . 11. ( - ) ,% 3 3268-4-36 2091-39-32 3190-44-57 3122-47-29 1 2 3 4 5 55 29 9 2 3 44 6 15 10 21 98 25 6 2 6 7 8 2 4 2 66 70 39 100 9 3 30 61 1 54 48 7 2 30 31 91 3 17 21 2 4 100 100 100 100 85 , - ( 2091-39-32, , 3268-4-36, , , 3190-44-57), (3122-47-29) ( ( 11). - , 1994), ( , 1995). , , - , . ( - ), , 1 (3122-47-29) 3122-47-29 .) 6 ( 3( ) .) 2 1 ( , 3. 3122-47-29, - 2 1 6, 3. (1994), 28 - . 4 ( , 1994). ( . 21) 90% ( 2). ( 1 80% 1 2 3 3 ( 2091-39-32, 2 2). 1,3,5 3 2 - 3268-4-36 80% 3 1,2 3 2). , 3190-44-57 3( 2 1 8, 8 9, 8 9, ( 4). ), - 86 3190-44-57 , : 8 30% 9 - 70% 9, 3190-44-57 (61%). 21. . 2 2 3 – , ( , 1980), 12. 2 12. 2 - 32684-36 3 209139-32 319044-57 32247-29 200 200 200 90,5 19,4 200 200 200 41 35,3 87,8 3 3268-4-36 2091-39-32 3190-44-57 322-47-29 2,7* 80,8 203 200 200 200 37,3 59,1 78,5 75,8 200 200 200 200 200 200 200 200 123,3 117,5 120,3 0* 0* 0* 200 200 200 53,2 0* 0* 0* 2 *- , 2 . , - 87 3 0,001. , 3. 2 , 3190-44-57, 322-47-39) (3268-4-36 (2091-39-32, , ) - 2. 2( .22) . 2091-39-32, - , 3190-44-57, 3122-47-29 86, 88 90, , 3268-4-36 85, 90 92. 22. 312247-29 . 2 3, - 88 , - . , , 3122-47-29, . (1995), 86% , 4 - . , SDS. , 4 ( . - 3122-47-29) , . – , , - . 2 . 3. - 89 5. (R.nigrum) (Cecidophyopsis ribis). ( ) , . , , - , - . . . SCAR , , - ( - ). . (1,25 mM (56, 58 60 , - ). 58 23. 2mM) . SCAR - 90 Gmresa. ( « » ; – ;- – ; 2…12 - , - .13). , ( 14-24), , , , ( 1613/17, 1448- , (130 SCAR - . 23, , - ), 13). , , , . - , . 13. , (R.nigrum) (Cecidophyopsis ribis) SCAR 2 250 3 4 13-15-3 5 Josta ( 6 7 ) + - + , + - + , + - + , + - + 2030-29-61 + - + 1613/17 + - + 8 + - + , 9 - + - , 10 - + - , 91 11 - + - , 12 + - + , + - + , - - - 15 ? - - 16 - - - , - - - , 18 - - - 19 - - - 20 - - - 13 1448-14-24 14 Ojebyn ( 17 ) 3864-46-62 , , . 21 Otelo ( ) - - - - - - - - - ) - - - - - - - - - - - - 28 - - - 29 - - - - - - 31 - - - , 32 - - - , 33 - - - , 34 - - - , 35 - - - , 36 - - - , 37 - - - , 38 - - - 22 23 Silgo ( 24 Wellington XXX ( 25 Ben Sarek ( 26 Ben Lomond ( 27 Titania ( 30 ) ) ) ) R.hudsonianum x R. dikuscha , , , , , , . ( 92 (Anderson,1971) , et al, 1974)), (Knight , ( , ) - . . ( - . 2004). - , . , , - . , 1-2 4-5 , ( , - 14 , 2009 , 2006- ( .) , . 14. - - * 1448-14-24 - , ., 2004). 2005- 1613/17 . 2001 2004, 2005, 2006 0 2001 2004, 2005, 2006 0 2002 2005,2006,2007 0 2006 2009 0 2001 2005,2006 0 2002 2005,2006,2007 0 2005 2009 0 2004 2007, 2008 0 93 2001 - Ojebyn 2004 0 2005 1 2006 1,5 2001 2004, 2005, 2006 0 2001 2004, 2005, 2006 0 2002 2004 0 2005 1 2006 1,5 2000 2004, 2005, 2006 0 2000 2004 2 2005 3 2006 2009 0 2006 2009 0 2002 2005,2006,2007 0 2006 2009 0 2005 2009 0 2004 2007, 2008 0 2005 2009 0 2005 2009 0 2005 2009 1 2005, 2006 2009 0 2001 2004, 2005, 2006 0 2001 2004 0 2005 1 2006 1,5 2005, 2006 1 2007 3 ) 3864-46-62 Otelo ( ) Silgo ( ) Wellington XXX ) Ben Sarek ( ) Ben Lomond ) Titania ) 2002 94 2002 R.hudsonianum x 2001 2005, 2006 1 2007 1,5 2004, 2005 0 2006 1 2005, 2006 1,5 2007 2 2006 2 2007 2,5 2008 1,5 2002, 2004 0 2005 1 2004 1 2005 1,5 2004, 2005 0 2006 1 2005, 2006 0 2007 2 2005 2 2006 3,5 2005 0 2006 1 2007 3 R. dikuscha - 2002 2003 1999 1999 2001 2002 2001 2002 * -0- ;1 - 10 % ;3: : 50 % ;230 % ;4- : 30 : 50 % ;5- . , 1448-14-24 ( ) - ( - - 0). , , . 1613/17 ( , - ) , ( - 0). - 95 , , 1448-14-24 - 762-5-82 , . 762-5-82 , . , , , , ( 2 - ). , , ( 106-1-37-16 . 24) . . .1163 . - , , . SCAR Ce , . , 1,5 ) . , - 96 ) 24. . , SCAR (R. sanguineum), - (R. sanguineum subsp. glutinosum) – - , - ( , 2004). , , , . , - , - (Collard and Mackill, 2007). , . , SCAR 37 , 32 - 97 , . , AFLP 4 23 , . AFLP ( - 125 , ) (Brennan at.al., 2009), , , . ( - , , - , , - ), , SCAR - . , SCRI - (Brennan et. al., 2009), ( ) . 98 6. Rpf1 (P.fragariae subsp. fragariae). Rpf1 - (Fragaria x ananassa) . . - , . Rpf1. . 6.1. SCAR-R1a -4 SCAR-R1a ( 285 . c ., (Haymes et al., 2000)), - ( - ). 24 , 64 -4 - . , , ( .25). - ABI PRISM® 3100 Genetic Analyzer. , 1 , . - 99 25. UDF009 (2% ; , – ) 2 (EMFn 228) 14 (EMFV104, CFCT05a) , 7,7 ( 15). 15. - - 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 BFACT 10 CFVCT05a UDF-019 ARSFL-7 EMFn123 ChFaM1 Fvi6d Cx661654 EMFn 185 ARSFL22 EMFn 228 EMFn 225 EMFvi 025 EMFV104 BFACT026 BFACT047 Emfv6 - 8 14 8 7 8 10 9 7 5 9 2 10 3 14 12 9 4 , . 139-167 106-143 102-130 216-263 177-210 213-261 274-305 411-440 219-235 143-229 285/288 256-293 267-283 97-150 147-182 162-188 222-229 100 18 19 20 21 22 23 24 CFVCT030 CFVCT028 EMFn 117 FAC-004d Rh76 Rh50 Uffxa01eo3 6 3 6 5 11 7 7 101-121 152-156 173-199 334-372 208-233 146-219 165-189 *- , - . , .) , - , , 13 , . . , , 1-2 et al., 2002). (Nourse , . - ', , '), - . , ( , - (Bringhurst, 1990). - , . . . . . (1975) - , - A', Fragaria vesca L. - , F. viridis Duch. - , F. orientalis Los. - AA, F. moschata Duch - AA'B ABB', , nassa Duch - A'A'CC. (Ashley et al., 2003) , F. x ana- . , - 101 8 , . , ABI PRISM® 3100 Genetic Analyzer , GeneMapper Genotyper. ) ) 26. ) ( EMFn123) Genotyper, ) . 102 26 Genotyper. - – – , - EMFn123 -4, – . , - . ., – , , (al. allele), (sz. (ar. area). size), - , - EMFn123. 177, 187, 191, 192, 194-2), 209, 210). 192 – 6 (177, 187, 191, 194, 194-2 . 210 . 194 209 , , , Microsoft Office Excel, - . 30 62), , . , , ( .). . , - . , , . 103 ( ), , ( , ) - . , - . , , , , . , , , . , , . . ) , SCAR-R1a, , 16. 16. (< BFACT10_Y139Y159 BFACT10_Y151YSS167/! BFACT10_YS157Y153S165 BFACT10_S153/! CFVCT05a_Y141 CFVCT05a_S130S136 CFVCT05a_Y126Y143 CFVCT05a_S122 CFVCT05a_S139S138-2 CFVCT05a_YS114Y112 CFVCT05a_S114 <abxaa> <abxaa> <abxac> <aaxab> <abxaa> <aaxab> <abxaa> <aaxab> <aaxab> <abxaa> <aaxab> - , -4 - -4 >) - 104 CFVCT05a_Y116Y126 CFVCT05a_YS118Y106S116 UDF19_Y103 UDF19_YS125Y124S130 UDF19_YS124S102 ARSFL007_YYS216S222/! ARSFL007_YS220Y222S224/ ARSFL007_YSS250Y263/ ChFam1_YS213Y214S228 ChFam1_S251S261 ChFam1_YS245Y218S222 ChFAM1_Y227Y236 EMFN123_YS187/ EMFN123_YS187/ EMFN123_YS187/ EMFN123_Y192Y194-2/ EMFN123_S194S200/ EMFN123_YYS177S210/ Fvi6d-Y279 Fvi6dYS290Y288S305 Fvi6d_YS305Y299S295 ARSFL22_Y143Y163KK163 Cx661654_YS424Y425 Cx661654_Y424! Cx661654_YY429S429S438 Cx661654_Y411Y440 ARSFL22_S179! ARSFL22_YS167Y179 Cx661654_S409S439 EmFn228_Y285Y288 ARSFL22_S176S180 ARSFL22_YS173Y229S192 EmFN185_YS219y EmFN185_YS219s EmFN185_YS230Y228S232! EmFN185_YS235!y EmFN185_YS235!s EmFN185_YS235! EmFn225_Y256Y293 EmFn225_YYS284S260 EmFn225_Y264 EmFn225_S275 EmFn225_S265 EmFvi025_Y267Y270 EmFvi025_S283 EmFv104_YS132y <abxaa> <abxac> <abxaa> <abxac> <aaxab> <aaxab> <abxac> <abxaa> <abxac> <aaxab> <abxac> <abxaa> <aaxab> <abxaa> <abxab> <abxaa> <aaxab> <aaxab> <abxaa> <abxac> <abxac> <abxaa> <abxaa> <abxaa> <aaxab> <abxaa> <aaxab> <abxaa> <aaxab> <abxaa> <aaxab> <abxac> <abxaa> <aaxab> <abxac> <abxaa> <aaxab> <abxab> <abxaa> <aaxab> <abxaa> <aaxab> <aaxab> <abxaa> <aaxab> <abxaa> 105 EmFv104_YS132s EmFv104_S109 EmFv104_YS97YS124 EmFv104_YS97YS124 EmFv104_YS97YS124 EmFv104_YS147Y143S145 EmFv104_S127S150 EmFv104_Y113Y116 EmFv104_Y123Y137 BFACT26_YS147S148 BFACT26_S173S178 BFACT26_Y166 BFACT26_Y154Y170 BFACT26_Y163 BFACT26_S155 BFACT47_Y169 BFACT47_Y176 BFACT47_YS176S178 BFACT47_S167S171 BFACT47_Y172Y178 BFACT47_S179 EMFV6_S222S227 EMFV6_Y223Y229 CFACT30_YS194Y105S101 CFACT30_S115 CFACT30_Y117Y121 CFACT28_YS156Y152S154 Fac4d_SSY334Y335 Fac4d_S367 Fac4d_Y372 Emfn117_Y179 Emfn117_YS199! Emfn117_YS199! Emfn117_S183 Emfn117_S173 Rh76_YYS208S205 Rh76_S210S194 Rh76_YS223Y233S221 Rh76_Y219 Rh76_S233! Rh76_YS226y Rh76_YS226s Rh50_YS179Y146S185 Rh50_YS164Y167 Rh50_S219 Rh50_S164 <aaxab> <aaxab> <aaxab> <abxaa> <abxab> <abxac> <abxac> <abxaa> <abxaa> <aaxab> <aaxab> <abxaa> <abxaa> <abxaa> <aaxab> <abxaa> <abxaa> <aaxab> <aaxab> <abxaa> <aaxab> <aaxab> <abxaa> <abxac> <aaxab> <abxaa> <abxac> <abxaa> <aaxab> <abxaa> <abxaa> <abxaa> <abxab> <aaxab> <aaxab> <aaxab> <aaxab> <abxac> <abxaa> <aaxab> <abxaa> <aaxab> <abxac> <abxaa> <aaxab> <aaxab> 106 Uffxa1e3_S167 Uffxa1e3_YS177S185 Uffxa1e3_Y177 Uffxa1e3_Y173 Uffxa1e3_Y189 SCAR-R1 <aaxab> <aaxab> <abxaa> <abxaa> <abxaa> <abxaa> <abxaa> <aaxab> ( ) - . 1:1. - <abxac> . 3:1. 17. -4 x <aaxab> <abxaa> <abxac> > 43 46 16 1:1 1:1 3:1 1:1 (89 ), 3:1 (16 )( - 17). 24 -4 - . 1:1 6.2. 3:1. . - , -4 - Rpf1 (1:1). , 34 - ( ). SCAR-R1a. 107 29 ( .26), SCAR-R1 8 , Rpf1. 26. 6d – -4: c ; . (Rh76, Rh50) , , - (Fvi6d, EMFn117, EMFn185, EMFn123) – (FAC-004d, BFACT10) ( - 18). Fragaria - Rosa , Fragaria, . 108 18. Fvi6d FAC-004d F.virginiana F.ananassa BFACT10 EMFn117 EMFn185 EMFn123 Rh76 Rh50 F.ananassa F. nubicola F. nubicola F. nubicola Rosa Hybrida Rosa Hybrida Ashley et al.,2003 Lewers,2005 RousseauGueutin,2008 Sargent et al.,2006 Sargent et al.,2006 Sargent et al.,2006 Yan, 2005 Yan, 2005 (Whitton et al.1997; Peakall et al. 1998). , , (Dayanandan et al. 1997; Treuren et al. 1997). , , , - , . c - (Ashley et al. 2003), F.virginiana F.ananassa , F.virginiana F.chiloensis F.ananassa 18- . - (Dirlewanger et al., 2004, Korban and Tartarini, 2009). 27 , - , 6. 109 27. , F2 F. vesca 815 - F. nubicola 601 (Sargent et al., 2006). Rpf1 : FAC-004d, EMFn117, Rh76. , SCAR-R1a, , EMFn185, Rh50, EMFn123, Rh76, - , . (FAC-004d, SCAR-R1a, Rh50, EMFn117) 4 - , – , . (EMFn185, EMFn123) , . 110 . : EMFn123_ Y187, EMFn117_Y179 Rh50_YS179Y146S185 FAC-004d_Y372 SCAR- R1. (Young &Tanksley, 1989) Microsoft Office Exel ( .28). 11 49 59 21 6 12 20 29 37 18 23 4 24 26 13 43 0 ll lm ll lm lm lm lm lm -- ll ll lm lm lm lm ll {0-} 5 ll lm ll lm lm lm lm lm ll ll ll ll ll ll lm ll {1-} 21 lm ll lm ll lm lm lm lm ll ll ll lm lm lm ll lm SCAR-R1 {1-} 21 lm ll lm ll lm lm lm lm ll ll ll lm lm lm ll lm EmFN185_YS219y {1-} 23 lm lm -- ll lm lm lm lm ll ll ll lm lm lm ll lm RPF1 {1-} 26 ll lm ll ll lm lm lm lm ll ll ll lm lm lm ll lm Rh50_YS179Y146S185 {1-} 27 ll lm ll lm lm lm lm lm ll ll ll lm lm lm ll lm EMFN123_Y187 {1-} 27 ll lm -- -- lm lm -- -- ll ll ll -- -- lm ll lm Emfn117_Y179 {1-} 27 ll lm ll lm lm lm lm lm ll ll ll lm lm lm ll lm Rh76_YS226y {0-} 29 lm -- -- -- -- ll -- -- lm lm lm -- -- ll lm ll Fvi6bY290Y288 {0-} BFACT10_Y139Y159 Fac4d_Y372 28. ( - - 11-26) (13,43) ( . - ). 28 , ; – – ; . , , - , - (lm) . . - (ll) - , - , . – 111 . . . – , 13 43 , Rpf1 11 EMFn185_YS219y. Rpf1 Fac4d_Y372 - 10 ( Rh76_YS226 ) 11, 49, 59 - 21 ( .28). Fvi6bY290Y288 - Fac4d_Y372/SCAR. ( - 13, 43 .). , SCAR 5 , , Md683 (Rpf1; (rpf1; et al, 2000). ), , , ) - 63 , - F1 (Haymes c . - , . , 6d Rpf1 - 8 SCAR-R1a . - , - -4 (64 ) . 6.3 - , , SCAR-R1 - 112 (Haymes et. al., 2000), Rpf1 ( ), ( 19). 19. , Rpf1, , Rpf1 : Emfn117,179 Rh50, 145 . . SCAR-R1a, 285 . Fac4d, 372 . Rpf1* 3 40 0 41 13 rpf1* 3 76 0 79 6 6 116 0 120 19 26 28 2 68 0 59 94 28 61 *( ). Emfn117 ( , 179 .) 6 116. Rh50 ( 146 - .) - . SCAR-R1a 19 . Fac4d ( ) 88239, 372 .) ( 4 Rpf1 ( Rpf1 89 -4 -4). , Rpf1 : Emfn117/ Rh50/ Rpf1/ SCAR-R1a. , Rh50 ( Rpf1. .28), - 113 , . 29. Rh50 typer ( Geno- Rpf1, , – - , Rpf1). SCAR-R1a Rh50 ( 146 .) - Rpf1 - . 114 . , RAPD , - Ribes L. , - , ; , ; - , ; - , . , . , RAPD . SDS- . SCAR - . , . . Rpf1 , . , - . , , . , - 115 1. RAPD - Ribes L. ( 98,5%), - . Ribesia , Eucoreosma. 2. RAPD Ribes L. RAPD . 3. , , - , , . , - . 4. , - , ; , ; . . 7.SDS4 . ( 3122-47-29) , . , - 116 , 3. 2 8.SCAR . , GMresa, , ( , , , 1613/17, 1448-14-24), , . - . 9. 6d (Rpf1) (P.fragariae) . - 117 , , , , - - . 1. RAPD Ribes L. - . RAPD . 2.SDS- . 3. SCAR , GMresa, - . 4.SCAR- R1a Rh50 - , (P.fragariae). Rpf1, 118 1. , . . , - . // . . . . .[ ]/ , . . - . 1987. - . 114.- . 114-126. 2. , . [ // – ]/ . . : .– - ., 1995. - .61-64. 3. . 4. . © V. Vesjolij. , , 2009. 54 . . [ ]/ . . // : .- , 1984.- . 60-65. 5. , . .- .: ]/ . . .- 2- , 1985.- 272 . 6. , .- [ .: . . [ ] / . . - , 1987. -511 . 7. , . (Ribes Pauciflorum Turcz.) ]/ . , .8. . // . , 1999. - .114-116. , . .- [ : 9. , ]/ . , . - , 1974 – 72 . . . Polygonum L. : - : : 03.00.05 10. , , 2007 - 181 c. . F2 [ ]/ . , , . - 119 , . // , , 1978 - .31-36. 11. [ , . ]/ . , . – 2007. 12. . , . // 2. – .19-21. , . . , , - .// [ ] / . .; , ., 1988. - 23 . 13. , . [ . ] / . // 14. , , . , . 2005. - 2. - .13-16. , . [ 2008. - . ]/ . // XXI, 7-9. - .13. 15. , . Triticum l. . . ... 16. . . Iris l: : 03.00.15. - M, 2010. – 19 . , C.B. RAPD- - Aegilops L. ]/ . , 2004. . 40, 17. . D- , , . D- , . // - 5. - . 642-651. , . . - Aegilops L. : 03.00.15 : , 2005. - 225 c. 18. , . [ , . .// ]/ . – 2005. - . 41. - . 4. - . 480-492. , . - 120 19. , . [ - ]/ . // . – 2002. - 38. - 8. - . 1013- 1033. 20. , . [ // . – 1984. - 21. , )[ Olechko-Lutkova. – 22. : , . . 12. - .29-32. ]/ , J. Plasencia, C. , . / . – .: : . , « , . - , 2010. – 36 . . . . 23. / . Plasencia Javier, Olechko-Lutkova Claudia. ( . ] . . , . - », 2000. - 432 . . : [ ]/ . [ ].- .: , 2004. - 422 . 24. , . . )/ . . 25. ( .– , .: , 2001. – . 1. – 780 . . [ ]/ . , .- . // , 2001.- .178- 181. 26. , . [ ]/ .- .: 27. , [ 28. .- « . - // , 1939. - » - 7.- . 34-39. . [ 22. // ,1983.- .284-268. . ]/ , . ]/ . // , 2000.- 2.- .20- 121 29. , . . Aegilops L., c . : : 03.00.12, 03.00.15 30. , ]/ 31. c : , 2009, 98 . . . [ , .].- : , 2009.- 208 . ., . ., 32. - , 2009, 24 . , . [ . , . , . 33. , . . . , ] / . // 9, - . - 2009. - .19-28. . [ , , . // ] / . . - 2010. - 4. - . 11 - 13. 34. ]/ , . 2004. . , . .- : , 2004. - 238 . 35. , . [ ]/ . // .- . - , 1995. - . 83-87. 36. , . [ .- ]/ ., 1995. - . 56-59. . // - - 122 37. , . - [ ]/ 38. , . . – 2002. - 3. - .4-11. . . / - .: 39. // [ ]/ . , 1983. – 320 . , . [ ] / . .; ., 2000. - 186 . 40. , . [ ] / . .; ., 2000. - 186 . 41. , . , 1967–1997 . [ ] / . - , , 1998. - 99 . 42. , . (1967-2007 .). [ ( 43. : , , ]/ . ., ..) - .: . 2- , 2007. - 134 . [ . , . , . - ] / .- . , 1998. - . 47.- . 64-69. 44. , . .: 45. - . , 2006, 23 . , . . Solanum, . Solanaceae Lycopersicon, Capsicum) : : 03.00.15, 03.00.03 , 2004 323 c. 46. , . ., ., . - Lycopersicon (Tourn) Mill. - 123 (ISSR) [ . , . ]/ .// . , . . 2002. - . 38. - , 8. - . 1133– 1142. 47. , . . [ // 9, . . - -2009. - .28-33. 48. , . US[ ]/ . , . . 1993. - .25.49. , . . [ // 2. - .175-180 RAPD Actinidia Lindley, ( - ] / ]/ . Actinidiaceae), . - // . – 2008.- . VI. 3. - .11-17. 50. , . RAPD- - Lemnaceae ( , . , 51. , . )[ // ]/ . , . – 2008. 44. - . - 3. - .1-5. . . . . .- . .- , 2000.- 16 . 52. : /[ .: . . ]- : , 2007. - 331 . 53. , . [ , . . // [ 55. ., . ]/ , , 1998. - . 155 - . .- : . . , , 2003. - 216 . , , 1992. - 384 . . [ . - .54. ]/ ]/ . [ .] - : 124 56. , . / . , . – 2006. 57. , , . // 3. – . 12-15. . [ . , . . . . , . 58. ] [ . , 2009. - , // - . ]/ . [ .] // , 2007; N 3. - . 39-41. 59. , . / 3(18). - . 32-35. [ . ] / , .: . / . , 1972. - 254 . 60. . [ ] / . - ., 1980. - 150 . 61. , ]/ - 38. - . . , . , . // , 2002. 11 - .1498-1510. 62. , . [ . // 63. .-2005.- , . . Ribes L. [ ]/ - Saxifragaceae. [ ., ]/ , 1939 - . I , 64. . , 3.- .3-18. . //// ]/ . 2007 . 673 « . . .- .- . 244. 26 ». 65. , ]/ . . .- , , :- , 1987. - 213 . . . - 125 66. , . [ ]/ .67. , . // , 1988.- . 63-68. . - - : : 06.01.07 68. , , 2007. - 179c. . Triticum spelta L. [ 2001. - . 37. 69. ]/ . [ .] // , 9. - .1258-1265. , . Ribes Pauciflo- rum Turcz. ( ) . .: . .- ., 1994, 21 . 70. , . 2006. [ ]/ . : .- : - , 2006. - 197 . 71. . , [ ] / . - .; - : , 1995. – 502 . 72. , . [ . , 73. . ]/ . // , , . . – 1989. - , 7. - .5-8. . . . 06.01.05 – 74. . , 75. , , . , 2000.15 . . [ . - 1993. - .27. - - ]/ . // 5. - .3-11. . : [ ]/ . // - 126 . , 76. , - 2004. http://www.labsgj.by.ru , . [ , . 77. // , ]/ XXI. – 2010. ]/ . , . 1-3. - .27-28. . . , . , . , . . . , // 9, - 2009. - .160-166. 78. , . [ ]/ . // .: .- 1975. - 184 . 79. , . [ 80. , , ]/ . // . . . – 2002. - RAPD . , . 3. - .59-62. [ .- ]/ .– . , 2002. – 26 . 81. , . [ ]/ . , . , . – - , 2004. – 112 . 82. , . : - [ // . – 2003. - 83. , . ]/ . . 3. - .26-41. [ ]/ . // - . - .43. – 2003. - .267 —306. 84. , . Lycopersicon (Tourn) Mill. , RAPD. , . . , .: . ISSR. [ // , 2001. - . 1133–1142. ]/ . - 127 85. , . . - [ - ]/ . // .- . . - 2005. - 1. – .20- 40. 86. , . [ .- . 87. , .[ 88. .- ]/ . // - , 1981.- .200-202. . ]/ . - .: , 1988.- 263 . Afuniana, M. R. Linkage of Vfa4 in Malus × domestica and Malus floribun- da with Vf resistance to the apple scab pathogen Venturia inaequalis [ ]/ M.R. Afuniana, P. H. Goodwina and D. M. Hunter.// Plant Pathology. – 2004. –V.53. – P.461–467. 89. Anderson, M.M. Resistance to gall mite (Phytoptus ribes Nal.) in the Eucor- cosma section of Ribes [ ]/ M.M. Anderson // Euphytica. – 1971. - V.20. - P.422-426. 90. Aranzana, M.J. A set of simple-sequence repeat (SSR) markers covering the Prunus genome [ ]/ M.J. Aranzana, A. Pineda et al.// Theor Appl Genet. – 2003. – V.106. – P.819–825. 91. Arús P. High Marker Density around the Peach Nematode Resistance Genes ]/ P. Arus, M. Mnejja et al.//Acta Hort. – 2004. – V.658. - P.567-571. 92. Ashley, M. V. High subsp.iability and disomic segregation of microsatellites in the octoploid Fragaria virginiana Mill. (Rosaceae) [ ]/ M.V. Ashley, J. A. Wilk et al.// Theor Appl Genet. – 2003. – V.107. P.1201–1207. 93. Bagga, H. S. Genes in Venturia inaequalis controlling pathogenicity to c ra- bappIes [ ]/ H.S. Bagga, D.M. Boone //Phytopathology. – 1968. – V.58. – P.1176-1182. 94. ple [ Baldi, P. Cloning and linkage mapping of resistance gene homologues in ap]/ P. Baldi, A. Patocchi et al. // Theor Appl Genet. – 2004. – V.109. – P.231-239. 128 95. Belfanti, E. The HcrVf2 gene from a wild apple confers scab resistance to a transgenic cultivated subsp.iety [ ]/ E. Belfanti, E. Silfverberg et al. // PNAS. – 2004. - V. 101.- N. 3. - . 886–890. 96. Bellini, E. Genetic relationships in Japanese plum cultisubsp.s by molecular markers [ ]/E. Bellini, E. Giordani, V. Nencetti, D. Paffetti // Acta Hort. – 1998. – V.478. - P.53-59. 97. Berger, A. A taxonomic review of currants and gooseberries [ ]/ A. Berger // NewYork Agric. Exp. Sta. Techn. Bull. – 1924. - V. 109. - C. 1-118. 98. Boone, D. M. Venturia inaequalis (Cke.) Wint. XII. Genes controlling path- ogenicity of wild-type lines [ ]/ D.M. Boone, G.W. Keitt //Phytopathology. – 1957. – V.47. – P.403-409. 99. otstein, D. Construction of a genetic linkage map in man using restriction fragment length polymorphisms [ ]/ D. otstein, R.L. White, M. Skolnick, R. V. Davis // Amer. J. Hum. Genet. - 1980. - V.32. - P.314-331. 100. Boudichevskaia, A. Development of a multiallelic SCAR marker for the scab resistance gene Vr1/ Vh4/ Vx from R12740-7A apple and its utility for molecular breeding [ ]/ A. Boudichevskaia, H. Flachowsky et al. // Tree Genetics & Genomes, - 2006, - V.2. – P.186–195. 101. Boudichevskaia, A. Development of Molecular Markers for Vr1, a Scab Resistance Factor from R12740-7A Apple [ ]/ A. Boudichevskaia, H. Fla- chowsky et al.// XIth Eucarpia Symp. on Fruit Breed. & Genetics, Eds. F. Laurens and K. Evans, Acta Hort. – 2004. – V.663. – P.171-176. 102. Bremer, B. An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III [ ]/ B. Bremer, K. Bremer et al. // Botanical Journal of the Linnean Society. – 2009. – V.161. – P.105–121. 103. Brennan, R. The development of a genetic linkage map of blackcurrant (Ribes nigrum L.) and the identification of regions associated with key fruit quality and agronomic traits [ - V. 161. - P. 19-34. ]/ R. Brennan, L. Jorgensen et al. // Euphytica. – 2008. 129 104. Brennan, R. The development of a -based marker linked to resistance to the blackcurrant gall mite ( Cecidophyopsis ribis Acari: Eriophyidae) [ ]/ R. Brennan, L. Jorgensen et al. // Teoretical and Applied Genetics. - 2009. - V. 118. P. 205-211. 105. Brennan, R.M. The use of metabolic profiling in the identification of gall mite (Cecidophyopsis ribis Westw.) – resistant blackcurrant (Ribes nigrum L.) genotypes [ ]/ R. M. Brennan, G.W. Robertson et al. // Ann.appl. Biol. – 1992. – V.121. - P.503-509. 106. Brennan, R.M., 2008. Currants and Gooseberries [ ]/ R. M. Brennan // Temperate Fruit Crop Breeding/ Ed. Hancock J.F., Springer Science+Business Media. - P.177-196. 107. Brennan, R. Future perspectives in blackcurrant breeding [ ]/ R. Brennan, L. Jorgensen, M. Woodhead and J. Russell // Acta Hortic. - 2002. – V.585. – P.39–45. 108. Bringhurst, R. S. Cytogenetics and evolution in American Fragaria[ ]/ R. S. Bringhurst // Hortscience. – 1990. – V.25. – P.879–881. 109. Burnes, T.D. Black Currant Clonal Identity and White Pine Blister Rust Resistance [ ]/ T.D. Burnes and R. A. Blanchette // Hortscience. – 2008. - V. 43. - N.1. - P. 200–202. 110. Bus,V. G. M. Genome mapping of three major resistance genes to woolly apple aphid (Eriosoma lanigerum Hausm.) [ ]/ V. G. M. Bus et al. // Tree Ge- netics & Genomes. – 2008. – V.4. – P.233–236. 111. Bus, V. An Update on Apple Scab Resistance Breeding in New Zealand ]/ Bus, V. Allan White et al.// Proc. IS on Apple Scab Eds. A. Bergamini et al. - Acta Hort. – 2002. – V.595.- P.43-47. 112. Cevik, V. High-resolution genetic analysis of the Sd-1 aphid resistance locus in Malusspp [ P.346–354. ]/ V. Cevik, G.J. King // Theor Appl Genet. – 2002.- V.105. – 130 113. Cipriani, G. A new set of microsatellite markers for Fragaria species and their application in linkage analysis [ ]/ G. Cipriani, F. Pinosa //Journal of Horticultural Science & Biotechnology. – 2006. - V. 81. - N. 4. - P. 668–675. 114. Cipriani, G. Isolation and characterization of microsatellite loci in Fragaria ]/ G. Cipriani and R. Testolin // Molecular Ecology Notes. – 2004. - V.4. P.366–368. 115. Coart, . Genetic subsp.iation in the endangered wild apple (Malus syl- vestris(L.) Mill.) in Belgium as revealed by amplified fragment length polymorphism and microsatellite markers [ ]/ E.Coart, X. Vekemans // Molecular Ecology. – 2003. – V.12 - .845-857. 116. Collard, B. C. Y.Marker-assisted selection: an approach for precision plant breeding in the twenty-first century [ ]/ B. C. Y. Collard, D. J. Mackill //Philosophical transactions of the Royal Society of London. Series B, Biological sciences. – 2008. – V.363 – P.557-572. 117. Colton, L. M. Marker-Assisted Selection for the Broad-Spectrum Potato Late Blight ResistanceConferred by Gene RB Derived from a Wild Potato Species ]/ L. M Colton, H.I. Groza, S. M.Wielgus and J. Jiming // Crop Sci. – 2006. – V.46. – P.589–594. 118. Coville, F.V. Grossulariaceae [ ]/ F.V. Coville and N.L. Britton // North American Flora. – 1908. - V.22. - P.193-225. 119. Cronquist, A. The Evolution and Classification of Flowering Plants [ ]/ A. Cronquist - New York.: The New York Botanical Garden, - 1988. - 555p. 120. Davis, T.M. Assessment of SSR marker transfer from the cultivated strawberry to diploid strawberry species: functionality, linkage group assignment, and use in diversity analysis [ ]/ T.M. Davis, L.M. DiMeglio et al. // J.Amer.Soc.Hort.Sci., - 2006. - V.131 - N.4 - P.506-512. 121. Dayanandan, S. Conservation of microsatellites among tropical trees (Leguminosae) [ ]/ S. Dayanandan, K. Bawa, R. Kesseli //American Journal of Botany. – 1997. – V.84 – P.1658–1663. 131 122. Ding, X. D. Study on the taxonomic relationship among some blackcurrant cultisubsp.s and species using POD isozyme [ ]/ X. D. Ding, G.Y. Li, E. Zhou //Journal of Northeast Agricultural University (Chinese Edition). – 1994. - V.3. N.5. http://en.cnki.com.cn/Article_en/CJFDTOTAL-DBDN403.005.htm 123. Dirlewanger, E. Comparative mapping and marker assisted selection in Rosaceae fruit crops[ ]/ E. Dirlewanger, E. Graziano et al. // Proc. Natl. Acad. Sci. USA. – 2004. – V.101 – P.9891-9896. 124. Doyle, J. J. A rapid DNA isolation procedure for small quantities of fresh leaf tissue [ ]/ J.J. Doyle and J. L. Doyle // Phytochemical bulletin. – 1987. V.19 – P.11-15. http://irc.igd.cornell.edu/Protocols/DoyleProtocol.pdf 125. Dunemann, F. Identification of molecular markers for the major mildew resistance gene Pl2 in apple [ ]/ F. Dunemann, G. Bracker, T.Markussen, P. Roche // Acta Hort. – 1999. V.484 - P.411-416. 126. Edwards, R. Glutathione and elicitation of the phytoalexin response in legume cell cultures [ ]/ R. Edwards, J.W. Blount, R.A. Dixon // Planta. – 1991. – V.184. - P.403-409. 127. Ellis, M.A. Using fungicides to control strawberry fruit rots in matted row production in Ohio [ ]/ M.A. Ellis // Massachusetts Berry Notes. – 2008. - V. 20 - N.8 – P.2-5. 128. Esmenjauda, D. Resistance to Root Knot Nematodes in Prunus: Characterization of Sources, Marker-Assisted Selection and Cloning Strategy for the Ma Gene from Myrobalan Plum [ ]/D. Esmenjauda // Acta Hort. – 2009. – V.814 - P.707-714. 129. Fernández, ME. The use of ISSR and RAPD markers for detecting DNA polymorphism, genotype identification and genetic diversity among barley cultisubsp.s with known origin[ ]/ M. E. Fernández, A.M. Figueiras, C. Beni- to // Theor Appl Genet. – 2002. – V.104 – P.845-851. 130. Flor, H.H. Current status of the gene-for-gene concept [ //Annu. Rev. Phytopathol. - 1971. – V.9 – P.275-296. ]/ H.H. Flor 132 131. Folta, K.M. Expressed sequence tags (ESTs) and simple sequence repeat (SSR) markers from octoploid strawberry (Fragaria x ananassa) [ ]/ K.M. Fol- ta, M. Staton et al. // BMC Plant Biology. – 2005. - V.5. - P.12. P.http://www.biomedcentral.com/1471-2229/5/12. 132. Francia, E. Marker assisted selection in crop plants [ ]/ E. Francia, G. Tacconi et al.// Plant Cell, Tissue and Organ Culture. – 2005. – V.82. – P.317–342. 133. Fresh strawberry/World production and market/USA market report/19942003 A publication by Today`s market prices.-2004. – 21p. http://www.todaymarket.com/samples/rpt_e.pdf 134. Genomics-Assisted Crop Improvement. Vol 2: Genomics Applications in Crops. [ ]/ Subsp.shney, Rajeev K.; Tuberosa, Roberto (Eds.) - 2007. – 509p. 135. Gil-Ariza, D. J. EST-derived polymorphic microsatellites from cultivated strawberry (Fragaria x ananassa) are useful for diversity studies and subsp.ietal identification among Fragaria species [ ]/ D. J. Gil-Ariza, I. Amaya et al. // Molecular Ecology Notes. – 2006. – V. 6. – I.4 – P.1195–1197. 136. Grodzicker, T. Physical mapping of temperature-sensitive mutations of adenoviruses[ ]/ T. Grodzicker, J. Williams, P. Sharp, J.Sambrook // Cold Spring Harb Symp Quant Biol. – 1975. – V.39 – P.439–446.Guerin, G. Development of a SCAR marker linked to dominant gene conferring resistance to ColletotRich.um acutatum in strawberry (Fragaria x ananassa) [ ]/ G. Guerin, F. Laigret //Acta Hort. – 2003. – V.636 – P.85–90. 138. Guilford, .S. Microsatellites in Malus X domestica (apple): abundance, polymorphism and cultisubsp. identification [ ]/ .S. Guilford, J. M. Prakash et al. //Theor Appl Genet. – 1997. – V.94 – P.249–254. 139. Gygax, M. L. A PatocchiMolecular markers linked to the apple scab resistance gene Vbj derived from Malus baccata jackii [ ]/ M. L. Gygax, R. Gianfranceschi et al. // Theor Appl Genet. – 2004. – V.109 – P.1702-1709. 140. Hadonou, M. Characterisation of Fragaria vesca Single Sequence Repeats (SSR) Markers [ ]/ M. Hadonou, D. Sargent, R. Walden and D. Simpson // Molecular Ecology Notes. – 2003. – V.3 – P.171–173. 133 141. Hadonou M. 2004. Development of microsatellite markers in Fragaria, their use in genetic diversity analysis, and their potential for genetic linkage mapping ]/ M. Hadonou, D. Sargent, R. Walden and D. Simpson // Genome. - V.47. P.429–438. 142. Hash, C.T. Opportunities for marker-assisted selection (MAS) to improve the feed quality of crop residues in pearl millet and sorghum [ ]/ C.T. Hash, A.G. Bhasker et al. // Field Crops Research. – 2003 – V.84. P.79–88. 143. Hash, C.T. Pearl Millet Molecular Marker Research [ ]/ C.T. Hash, R. S. Yadav // PSP Annual Report 2003. Section 1: Introduction and General Overview. Research Outcomes. Edited by Dr C. Stirling, - 2004 - P.35-41. 144. Haymes, K.M.. Development of SCAR Markers Linked to a Phytophthora fragariae Resistance Gene and Their Assessment in European and North American Strawberry Genotypes [ ]/ K.M. Haymes, W.E. Van de Weg et al.// J. AMER. SOC. HORT. SCI. – 2000. – V. 125 – N.3 –P.330–339. 145. Haymes, K.M. Identification of RAPD markers linked to a Phytophthora fragariae resistance gene (Rpf1) in the cultivated strawberry [ ]/ K.M. Haymes, B. Henken, T.M. Davis and W.E. Van de Weg // Theor. Appl. Genet. – 1997. – V.94 – P.097–1101. 146. Hemmat, M. Identification and Mapping of Markers for Resistance to Apple Scab from ‘Antonovka’ and ‘Hansen’s baccata [ ]/ M. Hemmat, K. Susan et al. // Acta Hort. – 2003. – V.622 - P.153-161. 147. Henry, R.J. Plant genotyping: the DNA fingerprinting of plants. [ ]/ edited by R.J. Henry – CABI publishing, - T.1. - 2001. - P.325. 148. Howard, H. W. The relationbetween resistance genes in potatoes and pathotypes of potatorootee1worm (Heterodera rostochiensis), wart disease (Synchytrium endobioticum) . and potato virus X. [ ]/ H. W. Howard // (Abstr.) Int. Congr.Plant Pathol., 1968 – V.1 – P. 92. 149. Hummer, K. E. Currants: Comprehensive Crop Report [ ]/ K. E. Hummer and D. Barney // HortTechnology. – 2002. - V.12. - N.3 - P.377-387. 134 150. James, C. M. Isolation and characterization of polymorphic microsatellites in diploid strawberry (Fragaria vesca L.) for mapping, diversity studies and clone identification [ ]/ C. M. James, F. Wilson, A . M. Hadonou and K. R. To- butt.// Molecular Ecology Notes, - 2003 – V.3 – P.171–173. 151. James, C.M. Identification of Molecular Markers Linked to the Mildew Resistance Genes Pl-d and Pl-w in Apple [ ]/ C.M. James and K.M. Evans // ISHS Acta Horticulturae, XI Eucarpia Symposium on Fruit Breeding and Genetics. – 2004. – V.663 - P.123-128. 152. Jancz ewski, E. Monograph of the currants Ribes L. E. ]/ Jancz.ewski //Mem. Soc. Phys. Hist. Nat. Geneve. 1907. - V.35 - P. 199-517. 153. Jena, K. K. Molecular Markers and Their Use in Marker-Assisted Selection in Rice [ ]/ K. K. Jena and D. J. Mackill // CROP SCIENCE. – 2008. - V.48 – P.1266-1276. 154. Jones, C.J. Reproducibility testing of RAPD, AFLP and SSR markers in plants by a network of European laboratories [ ]/ C.J., Jones, K.J. Edwards et al. // Molecular Breeding. – 1997. - V.3 - N.5 - P. 381-390. 155. Jones, J.D. G. The plant immune system [ ]/ J.D. Jones & J.L. Dangl //Nature. – 2006. – V.444. - P.323-329. 156. Joshi, S. P. Molecular markers in plant genome analysis [ ]/ S. P. Joshi, K. R. Prabhakar and S. G. Vidya // Plant Molecular Biology. - 1999. - V.77 – P. 230–240. 157. Keep, E. Interspecific hybridization in Ribes 1962. - V. 33 - ]/ E. Keep // Genetica. - 1 - P.1-23. 158. Keller-Przyby kowicz, S. RAPD and ISSR markers of black and green colour of blackcurrant (Ribes nigrum) fruits [ ]/ S. Keller-Przyby kowicz, M. Korbin and J. Gwozdec // Journal of Fruit and Ornamental Plant Research. - 2006. - V.14 - P.45-52. 159. Keniry, A. Identification and characterization of simple sequence repeat (SSR) markers from Fragaria×ananassa expressed sequences [ Clare // Molecular Ecology Notes. – 2006. - V.6 – I.2 – P.319–322. ]/ A. Keniry, J. 135 160. Khan, M.A. Identification and Validation of QTLs Linked to Fire Blight Resistance in Malus and Their Applicability in Marker-Assisted Selection [ ]/ M.A. Khan, C.E. Durel et al.// 753 Proc. XII th Eucarpia Symp. on Fruit Breeding and Genetics Acta Hort. – 2009. - V.814 - P.743-758. 161. King, G.J. Introgression of the Vf source of scab resistance and distribution of linked marker alleles within the Malus gene pool [ ]/ G.J. King, S. Tar- tarini et al. // Theor Appl Genet. – 1999. – V.99 –P.1039–1046. 162. Knight, R.L. Transference of resistance to black currant gall mite Cecidophyopsis ribis from gooseberry to black currant [ ]/ R.L. Knight, E. Keep, J.B. Briggs, J. Parker // Ann. Appl. Biol. -1974. – V.76 - P.123-130. 163. Knight, V.H. Screening black currant for resistance to the gull mite Cecidophyopsis Ribes (Westw.) [ ]/ V.H. Knight // In Breed- ing for resistance to insects and mites. Bulletin of the International Union for Biological Science, International Organization for Biological Control of Noxious Animals and Plants. - 1981.- P.89-93. 164. Komarov, V. L. Flora of the (former) USSR ]/ V. L. Komarov / In: Ribesioideae Engl. (Translated from the Russian by the Israel Program for Scientific Translation, Jerusalem). Keter, London, -1971. - V.IX - P.175-208. 165. Korban, S. S. Apple Structural Genomics [ ]/ S. S. Korban and S. Tar- tarini //Genetics and Genomics of Rosaceae Plant Genetics and Genomics: Crops and Models. – 2009. – V.6 – P.I - P.85-119. 166. Lanham, P. G. The use of molecular markers to characterize suspect black- currant (Ribes nigrum L.) plants in experimental field plots as-sessing resistance to the gall mite (Cecidophyopsis ribis Westw.) [ ]/ P. G. Lanham, R. M. Bren- nan, A. T. Jones //Zeitschrift fur Pflanzenkrankheiten und Pflanzenaschutz. – 1997. - V.104 - N.6 – P.576-580. 167. Lanham, P. RAPD fingerprinting of blackcurrant (Ribes nigrum L.) cultisubsp. [ ]/ P. G. Lanham, R. M. Brennan et al. // Theor Appl genet. – 1995. -V. 90. - P.166-172. 136 168. Lanham, P. Genetic diversity within a secondary gene pool for Ribes nigrum L. revealed by RAPD and ISSR markers [ ]/ P. Lanham, A. Korycinska and R. Brennan // Journal of horticultural Science & Biotechnology. - 2000. - V. 75. N.4. - .371-375. 169. Lanham, P.G. Genetic diversity in Ribes [ ]/ P. G. Lanham, R. M. Brennan // Acta Hort. - 2001. - V.546. - P.135-137. 170. Lanham, P.G. Genetic characterization of gooseberry (Ribes grossularia subgenus Grossularia) germplasm using RAPD, ISSR and AFLP markers [ ]/ P. G. Lanham, R. M. Brennan // J. hortic. Sci. and Biotechnol. -1999. – V.74 – P.361-366. 171. Lecouls, A. C. RAPD and SCAR markers linked to the Ma1 root-knot nematode resistance gene in Myrobalan plum (Prunus cerasifera Ehr.) [ ]/ A.C. Lecouls, M. J. Rubio-Cabetas et al. // Theor Appl Genet. – 1999. V.99 – P.328335. 172. Lerceteau-Köhler, E. QTL Analysis for Fruit Quality Traits in Octoploid Strawberry (Fragaria x ananassa) [ ]/ E. Lerceteau-Köhler, A. Moing et al. //XIth Eucarpia Symp. on Fruit Breed. & Genetics Eds. F. Laurens and K. Evans Acta Hort. – 2004. – V.663 – P.331-336. 173. Lewers, K.S. Strawberry GenBank-derived and genomic Simple Sequence Repeat (SSR) markers and their utility with strawberry, blackberry, and red and black raspberry [ ]/ K.S. Lewers, S.M.N. Styan and S.C. Hokanson // J.Amer.Soc.Hort.Sci., 2005. – V.130 – N.1 – P.102-115. 174. Liebhard, R. Mapping Quantitative Field Resistance against Apple Scab in a ‘Fiesta’ × ‘Discovery’ Progeny [ ]/ R. Liebhard, B. Koller et al. // The Ameri- can Phytopathological Society. – 2003. V. 93 - N.4 – P.493-501. 175. Linden, C. G. Efficient targeting of plant disease resistance loci using NBS profiling [ ]/ C. G. Linden, D.C. Wouters et al.// Theor Appl Genet. – 2004. - V.109 - P.384–393. 137 176. Maas, J.L. Resistance in strawberry to races of Phytophthora fragariae and to isolates of Verticillium from North America [ ]/ J.L. Maas, G.J. Galletta and A.D. Draper //Acta Hort. – 1989. – V.265 – P.521–526. 177. Mackill, D. J. Molecular mapping and marker assisted selection for majorgene traits in rice [ ]/ D. J. Mackill & J. Ni // In Proc.Fourth Int. Rice Genet- ics Symp. (eds G. S. Khush, D. S. Brar& B. Hardy), - 2000. – P.137–151. 178. Malviya, N. RAPD analysis among pigeonpea [Cajanus cajan (L.) Mill sp.] cultisubsp.s for their genetic diversity [ ]/ N. Malviya and D. Yadav // Genet- ic Engineering and Biotechnology Journal. - 2010. - V.2010 - P.1-9. http://astonjournals.com/manuscripts/Vol2010/GEBJ-1_Vol2010.pdf 179. Marker-assisted selection: current status and future perspectives in crops, livestock, forestry and Fisch // Food and Agriculture Organization of the United Nations. Edited by Elcio P. Guimarães. - 2007.- 471p. 180. McDermott, J.M. Genetic subsp.iation in powdery mildew of barley: development of RAPD, SCAR, and VNTR markers [ ]/ J.M. McDermott, U. Brandle et al. // Phytopathology. – 1994. – V.84 – N.11 – P.1316-1321. 181. Messinger, W. Ribes phylogeny as indicated by restriction-site polymorphisms of PCR-amplified chloroplast DNA [ ]/ W. Messinger, A. Liston and K. Hummer // Plant Systematics and Evolution. – 1999. - V.217 - P.185-195. 182. Mitre, I. Genotypic Subsp.iability of he Main pple Cultisubsp.s Grown in Transylvania, omania, valuated by eans of APD nalysis [ ]/ I. Mitre, L. Lukacs et al. // Notulae Botanicae Horti Agrobotanici Cluj-Napoca. – 2009. – V.37 – N.1 – P.261-264. 183. Monfort, A. A new set of polymorphic simple sequence repeat (SSR) markers from a wild strawberry (Fragaria vesca) are transferable to other diploid Fragaria species and to Fragaria×ananassa [ ]/ A. Monfort, S. Vilanova, T . M. Davis and P. Arus // Molecular Ecology Notes. – 2006. V.6 – P.197–200. 184. Moseman, J. G. Host-parasite interactions between culture 12A1 of the powdery mildew fungus and the MIt and Mig genes in barley [ Moseman // Phytopathology. – 1957. – V.47 - P.453 (Abstr.). ]/ J. G. 138 185. Nourse, S.M. Development of simple sequence repeat (SSR) molecular markers in strawberry [ ]/ S.M. Nourse, E.W. Fickus, P.B. Cregan and S.C. Hokanson. // In: S.C. Hokanson and A.R. Jamieson (eds.). Strawberry research to 2001. ASHS Press, Alexandria, - 2002. - P.48–53. 186. Paran, I. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce [ ]/ I. Paran and R. W. Michelmore // Theor Appl Genet. – 1993. – V.85 – P.985-993. 187. Parikka, P. Tracing latent infection of ColletotRich.um acutatum on strawberry by PCR [ ]/ P. Parikka, A. Lemmetty // Eur J Plant Pathology. – 2004. – V.110 – P.393-398. 188. Patocchi, A. Towards improvement of marker assisted selection of apple scab resistant cultisubsp.s: Venturia inaequalis virulence surveys and standardization of molecular marker alleles associated with resistance genes [ ]/ A. Patocchi, J. E. Frei, M. Frey, Kellerhals // Mol Breeding. – 2009. V.24 – P.337– 347. 189. Patocchi, A. Vr2: a new apple scab resistance gene [ ]/ A. Patocchi, B. Bigler et al. // Theor Appl Genet. – 2004. – V.109 – P.1087–1092. 190. Patocchi, A. Identification by genome scanning approach (GSA) of a microsatellite tightly associated with the apple scab resistance gene Vm [ ]/ A. Patocchi, M. Walser et al. // Genome. – 2005. – V.48 – P.630–636. 191. Peakall, R. Cross-species amplification of soybean (Glycine max) simple sequence repeats (SSRs) within the genus and other Legume genera: Implications for the transferability of SSRs in plants [ ]/ R. Peakall, S. Gilmore et al. // Mol Biol Evol. – 1998. V.15 – P.1275-1267. 192. Peer, Van de Y. TREECON for Windows: A software package for the construction and drawing of evolutionary trees for the Microsoft Windows environment [ ]/ Van de Y. Peer,R.D. Wachter // Comput. Appl. Biosci. – 1994. -V. 10. - P.569–570. 193. Plant biotechnology: the genetic manipulation of plants/ A. Slater, N. Scott & M. Fowler.-2nd ed.Oxford University Press Inc., New York. 2008. Pp.376. 139 194. Puchooa D., 2004. A simple, rapid and efficient method for the extraction of genomic DNA from lychee (Litchinensis Sonn) [ ]/ //African Jornal of Bio- technology.April. Vol. 3. N. 4. P. 253-255. 195. Rehder A., 1954. Manual of cultivated trees and shrubs. - Toronto.: MacMillan and Co. 999pp. 196. Ribaut Jean-Marcel and Michel Ragot. Marker-assisted selection to improve drought adaptation in maize: the backcross approach, perspectives, limitations, and alternatives [ ]/ // Journal of Experimental Botany, Vol. 58, No. 2, pp. 351– 360, 2007. 197. Roche P., F. H. Alston, C. Maliepaard, K. M. Evans, R. Vrielink, F. Dunemann, T. Markussen, S. Tartarini, L. M. Brown, C. Ryder, G. J. King. RFLP and RAPD markers linked to the rosy leaf curling aphid resistance gene (Sd1) in apple ]/ // Theor Appl Genet (1997) 94 : 528-533. 198. Rousseau-Gueutin M., Lerceteau-Ko¨hler E., Barrot L., Sargent D.J. et.al. Comparative Genetic Mapping Between Octoploid and Diploid Fragaria Species Reveals a High Level of Colinearity Between Their Genomes and the Essentially Disomic Behavior of the Cultivated Octoploid Strawberry [ ]/ // Genetics 2008 V.179 P. 2045–2060. 199. Sahasrabudhe, A. and M. Deodhar, 2010. Standardization of DNA etraction and otimization of RAPD-PCR cnditions in cinia indica[ ]/ // Int. J. Bot., 6: 293-298. 200. SARGENT D .J ., HADONOU A ..M. and D.W.SIMPSON Development and characterization of polymorphic microsatellite markers from Fragaria viridis , a wild diploid strawberry [ ]/ //Molecular Ecology Notes (2003)3 ,550 –552 201. Sargent D. J., J. Clarke, D. W. Simpson,K. R. Tobutt, P. Arus, A. Monfort, S. Vilanova, B. Denoyes-Rothan, M. Rousseau,K. M. Folta, N. V. Bassil, N. H. Battey. An enhanced microsatellite map of diploid Fragaria [ ]/ // Theor Appl Genet (2006) 112: 1349–1359. 202. Sargent D. J., T. M. Davis, K. R. Tobutt, M. J. Wilkinson, N. H. Battey, D. W. Simpson. A genetic linkage map of microsatellite, gene-specific and morpho- 140 logical markers in diploid Fragaria [ ]/ // Theor Appl Genet (2004) 109: 1385–1391. 203. Sargent D.J, F. Fernande´z-Fernande´z ,J. J. Ruiz-Roja, B. G. Sutherland, A. Passey. A genetic linkage map of the cultivated strawberry (Fragaria x ananassa) and its comparison to the diploid Fragaria reference map [ ]/ // 2009, Mol Breeding Volume 24, Number 3, 293-303. 204. Sargent D.J., Cipriani G., Vilanova S., Gil-Ariza D., Arus P., Simpson D.W., Tobutt K.R., Monfort A. The development of a bin mapping population and the selective mapping of 103 markers in the diploid Fragaria reference map [ ]/ //Genome 2008. 51. 120-127. 205. Sasnauskas A., R. Rugienius, D. Gelvonauskiené, I. Zalunskait , G. Stanien , T. Siksnianas, V. Stanys, C. Bobinas. Screening of strawberries with the red stele (phytophthora fragariae) resistance gene RPF1 using sequence specific DNA markers [ ]/ // Acta Hort. (ISHS). 2007. 760:165-169. 206. Schuelke Markus An economic method for the fluorescent labeling of PCR fragments [ ]/ // NATURE BIOTECHNOLOGY VOL 18 FEBRUARY 2000 p.233-234 207. Schultheis L.M., Donoghue M.J., 2004. Molecular phylogeny and biogeography of Ribes (Grossularia) with an emphasis of gooseberry (subg. Grossularia) ]/ // Systematic Botany. Vol. 29. N. 1. . 77–96. 208. Scott, D.H., J.L. Maas, and A.D. Draper. 1975. Screening strawberries for resistance to Phytophthora fragariae with single versus a composite of races of the fungus [ ]/ // Plant Dis. Rpt. 59:207–209. 209. Senters A. E. and Soltis D.E., 2003. Phylogenetic relationships in Ribes (Grossulariaceae) inferred from ITS sequence data// TAXON. Vol. 52. P. 51-66. 210. Senthilkumaran, R., I. S. Bisht, K. V. Bhat, J. C. Rana. Diversity in buckwheat (Fagopyrum spp.) landrace populations from north-western Indian Himalayas [ ]/ // Genet Resour Crop Evol. 2008. V.55. p.287–302. 211. Silva C., J. Garcia-Mas, A.M. Sanchez, P. Arús and M.M. Oliveira. Candidate gene analysis of quantitative trait subsp.iation in flowering time in almond 141 [Prunus dulcis (Mill.) D.A. Webb] [ ]/ // Options Méditerranéennes, Série A, Numéro 63 2005 141-145. 212. Sinnott Q.P., 1985. A revision of Ribes L. subg. Grossularia (Mill.) per. Sect. Grossularia (Mill.) Nutt. (Grossulariaceae) in North America [ ]/ // Rho- dora. Vol.87. P.189-286. 213. Spigler RB, KS Lewers, DS Main and T-L Ashman. Genetic mapping of sex determination in a wild strawberry, Fragaria virginiana, reveals earliest form of sex chromosome [ ]/ // Heredity (2008), 101(6):507-17. 214. Strawberry situation and outlook for selected countries [ ]/ //World hor- ticultural trade & U.S. export opportunities. 2006. P.1-8. 215. Sureeporn Kate-ngam and Padcharee Lakote. 2008. A comparative study of different RAPD-PCR protocols for genetic diversity analysis of Doritis germplasm ]/ // Agricultural Sci. J. V.39.N.3.P.203-206. 216. Tartarini S. Marker-assisted selection in pome fruit breeding [ ]/ // ISHS Acta Horticulturae 622: XXVI International Horticultural Congress: Genetics and Breeding of Tree Fruits and Nuts p.23-28 1999. 217. Tartarini S., S. Sansavini, B. Vinatzer, F. Gennari and C. Domizi. Efficiency of marker assisted selection (MAS) for the Vf SCAB resistance gene [ ]/ // Proc. EUCARPIA Symp. on Fruit Breed. and Genetics Eds M. Geibel, M. Fischer & C. Fischer Acta Hort. 538, ISHS 2000 pp549-553. 218. Thomas T.A. and Tanksley S.D. A rapid and inexpensive method for isolation of total DNA from dehydrated plant tissue [ ]/ //Plant molecular biology report 8, p.297-303. 219. Toojinda T., E. Baird, A. Booth, L. Broers, P. Hayes, W. Powell, W. Thomas, H. Visubsp., G. Young. Introgression of quantitative trait loci (QTLs) determining stripe rust resistance in barley: an example of marker-assisted line development ]/ // Theor Appl Genet (1998) 96 : 123-131. 220. Treuren R van, Kuittinen H, Kärkkäinen K, Baena-Gonzalez E, Savolainen O (1997) Evolution of microsatellites in Arabis petraea and Arabis lyrata, outcrossing relatives of Arabidopsis thaliana[ ]/ // Mol Biol Evol 14:220–229 142 221. Urbanovich Oksana, Zoya Kazlovskaya. Identification of scab resistance genes in apple trees by molecular markers [ ]/ // Scientific works of the LITHUANIAN INSTITUTE OF HORTICULTURE and LITHUANIAN UNIVERSITY OFAGRICULTURE. SODININKYSTE in DARŽININKYSTE. 2008. 27(2).pp.347-357. 222. Van de Weg, W.E. 1997. A gene-for-gene model to explain interactions between cultisubsp.s of strawberry and races of Phytophthora fragariae subsp. fragariae [ ]/ // Theor. Appl. Genet. 94:445–451. 223. Van de Weg, W.E., H.J. Schouten, and B. Henken. 1997b. Resistance to Phytophthora fragariae subsp. fragariae in strawberry: the Rpf1 gene, p.71–76. In: W.E. Van de Weg (ed.). 1997. Gene-for-gene relationships between strawberry and the causal agent of red stele root rot, Phytophthora fragariae subsp. fragariae. PhD thesis. Waginingen Agr. Univ. CPRO-DLO, Wageningen. 224. Velasco Riccardo , Andrey Zharkikh , Michela Troggio , Silvio Salvi , Massimo Pindo et al. Apple Genome Sequencing And Post-Genomic Program At IASMA Research Center [ January 10-14, ]/ // Plant & Animal Genomes XVII Conference. 2009 (http://www.intl- pag.org/17/abstracts/P05h_PAGXVII_427.html). 225. Vida Gyula, Mariann Ga´l, Andrea Uhrin, Otto´ Veisz, Naeem Hasan Syed, Andrew J. Flavell, Zhulin Wang, Zolta´n Bedo. Molecular markers for the identification of resistance genes and marker-assisted selection in breeding wheat for leaf rust resistance [ ]/ // Euphytica (2009) 170:67–76. 226. VIRUEL M. ANGELES, Daniel Sánchez, Pere Arús. AN SSR AND RFLP LINKAGE MAP FOR THE OCTOPLOID STRAWBERRY (Fragaria x ananassa) ]/ // Plant, Animal & Microbe Genomes X Conference, 2002. http://www.intl-pag.org/10/abstracts/PAGX_P660.html 227. Weebadde C. K., D. Wang , C. E. Finn , K. S. Lewers , J. J. Luby , J. Bushakra , T. M. Sjulin and Hancock J. F. Using a linkage mapping approach to identify QTL for day-neutrality in the octoploid strawberry [ ing127, 94—101 (2008). ]/ // Plant Breed- 143 228. Weg, W.E. van de, 1997a. A gene-for-gene model to explain interactions between cultisubsp.s of strawberry and races of Phytophtora fragariae subsp. fragariae [ ]/ //Theoretical and Applied Genetics 94:445-451. 229. Weg, W.E. van de. Genes for and molecular markers linked with resistance to Phytophtora fragariae in strawberry [ ]/ W.E. van de Weg, B. Henken et al. // Acta Hort. – 1997. – V.2 - P.839-843. (c) 230. Weigend, M. Grossulariaceae [ ]/ M. Weigend // In Kubitzki K., Bayer C., Stevens (Eds) The Families and Genera of Vascular Plants: IX Flowering plants. Eudiocots. – 2007. - P.168-176. 231. Werner, H. Comparative mapping and marker-assisted selection in Rosaceae fruit crops [ ]/ H. Werner and P. Arus // PNAS, - 2004. – V.101 - N. 26. – P.9891–9896. 232. Whitton, J. Microsatellite loci are not conserved across the Asteraceae ]/ J. Whitton, L.H. Rieseberg and M.C. Ungerer // Mol Biol Evol. -1997. V.14 – P.204-209. 233. Witcombe, J.R. Resistance gene deployment strategies in cereal hybrids using marker-assisted selection: Gene pyramiding, three-way hybrids, and synthetic parent populations [ ]/ J.R. Witcombe & C.T. Hash // Euphytica. – 2000. V.112 – P.175–186. 234. Xu, Y. Marker-Assisted Selection in Plant Breeding: From Publications to Practice [ ]/ Y. Xu and J. H. Crouch // CROP SCIENCE. – 2008. - V.48 – V.391 - P.391-407. 235. Yan, Z. Construction of an integrated map of rose with AFLP, SSR, PK, RGA, RFLP, SCAR and morphological markers [ ]/ Z. Yan, C. Denneboom et al. // Theor Appl Genet. – 2005. – V.110 P.766–777. 236. You, M. A PCR-based molecular marker applicable for marker-assisted selection for anthracnose disease resistance in lupin breeding [ ]/ M. You, J. G. Boersma et al. // Cellular & Molecular Biology Letters. – 2005. V.10 – P.123 – 134. 144 237. Young, N.D., Tanksley, S.D. Restriction Fragment Length Polymorphism. Maps and the Concept of Graphical Genotypes. // TheorAppl Genet. – 1989. V.77 – P.95-101. 238. Zeinalabedini, M. Comparison of the use of morphological, protein and DNA markers in the genetic characterization of Iranian wild Prunus species ]/ M. Zeinalabedini, K. Majourhat et al. //Scientia Horticulturae. – 2008. – V.116 – P.80-88. 239. Zhang, H. Genetic relationships among 17 bramble cultisubsp.s and 11 wild excellent Rubus germplasms from china revealed be RAPD [ ]/ H. Zhang, X. Wang et al.//Agricultural Journal. - 2009. - V.4 – N.4. - P.179-183. 240. Zhang, X. Development of SCAR markers linked to self-incompatibility in Brassica napus L. [ ]/ X. Zhang, M. Chaozhi et al. // Mol Breeding. – 2008. – V.21 – P.305–315. 241. Zharkikh, A. Statistical properties of boot-strap estimation of phylogenetic subsp.iability from nucleotide sequences. I. Four taxa with a molecular clock ]/ A. Zharkikh and W. H. Li // Mol. Biol.Evol. – 1992. V.9 – P.1119–1147. 145 1 ( D. Puchooa 2004): 1. 1,5 500 , (100mM Tris ph=8.0, 20mM EDTA ph=8.0, 2M NaCl, 2% , 5% , 2% 10mM AcNH4). , , . 60° 20 - . 2. , – 5 , 12 - . . - . - . . 3. . 13 4. . 15 100 , . , , 75% AcNH4. . , 10mM . . - . , . 5. . 6. 100 7. 50 5 TE. NaCl. 8. 70% 15 9. . 10 . . 5-7 – . 10. 11. ). - 100 80% . 20-30 mQ ( 146 2 Thomas and Tanksley (1990) : : - , pH7,5 (100mM Tris-HCL (pH7,5), 5mM EDTA (pH 8,0), 0,35M ). - , pH7,5 (0,2 M Tris-HCL (pH7,5),0,05M EDTA (pH8,0),2M NaCL, 2% CTAB), - STE , 0.02 M 0.4% Triton x-100. - , 17,5 ml , 12,5 ml 0,02M , 6 5% . 1. , , , STE , . 2. 10 4º . (Hermle, 3. 4. ( ) 1 2) . 500 (60º ) , . 5. 60º , . 6. 500 (24:1) . 7. 20 . 147 8. 1,5 0,8 (4º ) , . - « 9. 5 10. , 400 , ». . 70% - . . 11. 12. . , . 13. 14. 15. . 37º 100 30 . . 148 3 (Doyle and Doyle, 1998) . : 2% , 1.4 NaCl, 20mM EDTA, 100mM Tris (pH8.0), 2%PVP, 1% - . . 1. ( ) 700 65º 15 ( ). . 2. 25 3. 65º . 700 (24:1) . 4. 2 600 . 5. 0,8 , ) 2 6. ( . . , , 2 500 - , . 7. , 37º ) 400 ( , , 65º . 8. 135 (1/3 20º , ) 8 5 LiCl, 30 - . . 9. 320 , 30 5 . , -20º , - . 70% 50 .