АНАЛИЗ ПОЛИМОРФИЗМА ГЕНОВ CSN3 И PRL У ПЕРВОТЕЛОК

Реклама
УДК 636. 082. 12
АНАЛИЗ ПОЛИМОРФИЗМА ГЕНОВ CSN3 И PRL У ПЕРВОТЕЛОК
ХОЛМОГОРСКОЙ ПОРОДЫ ТАТАРСТАНСКОГО ТИПА, А
ТАКЖЕ ИХ МОЛОЧНАЯ ПРОДУКТИВНОСТЬ И
КАЧЕСТВЕННЫЙ СОСТАВ МОЛОКА В ЗАВИСИМОСТИ ОТ
СОЧЕТАНИЯ ГЕНОВ
Зиннатова Ф.Ф.
ФГОУ ВПО «Казанская государственная академия ветеринарной медицины
имени Н.Э.Баумана»
Ключевые слова: генотипирование, сочетаемость генотипов,
продуктивность, селекция.
Key words: genotyping, genotypes compatibility, productivity, selection.
На современном этапе развития животноводства определяющим
фактором его эффективности является интенсификация и оптимизация
молочного скотоводства.
Известно, что эффективность селекционно-племенной работы
зависит от многих факторов: генетических, средовых, экономических.
Основной причиной торможения реализации генетического потенциала
животных является прежний подход к их селекционному отбору, как в
племенных, так и в товарных стадах.
За последние десятилетие основной мерой в увеличении и
улучшении молочного и мясного стада в Республики Татарстан и в
Российской
Федерации,
в
целом
явилось
приобретение
высокопродуктивных животных, из-за рубежа. К сожалению, отсутствие
должного контроля за здоровьем и наследственностью импортируемых
животных привело к накоплению животных с проблемами
наследственного характера, такими как уменьшение генетического
разнообразия стада и распространение генетических аномалий [1]
Под интенсификацией и оптимизацией производства продукции
животноводства принято понимать рост продуктивности стада. В
селекционной работе с молочными породами скота все больше внимания
уделяется поиску генетических маркеров продуктивных и технологических
качеств животных. Одними из которых являются маркеры по гену каппаказеин- связаный с белковомолочностью и технологическими свойствами
молока, и ген пролактин- также ассоциированый с молочной
продуктивностью и белковомолочностью молока.
На сегодняшний день отсутствуют данные о комплексном
использовании этих генов в оценки животных холмогорской породы
татарстанского типа в условиях РТ.
76
В связи с вышеизложенным целью данного исследования явилось
анализ полиморфизма генов каппа-казеин и пролактин, методом ПЦРПДРФ – анализа у крупного рогатого скота холмогорской породы
татарстанского типа. Определить животных несущих в своем геноме
хозяйственно – полезные аллели по данным генам, и использовать их для
создания племенного ядра в СХПК «им. Вахитова» Кукморского района
РТ.
Материалы и методы. Исследования проводились на образцах ДНК
полученных из цельной крови 161 первотелок холмогорской породы
татарстанского типа, с целью внедрения их в племенное ядро СХПК «им.
Вахитова» Кукморского района РТ. ДНК выделяли из лейкоцитов крови в
количестве 100 мкл с использованием набора реагентов «ДНК-сорб-В»,
согласно методике представленной изготовителем. В предварительных
опытах была разработана программа проведения ПЦР, с некоторыми
изменениями температурных и временных режимов реакции, что
обеспечило оптимальную амплификацию участков гена CSN3 и PRL.
Фрагменты ДНК амплифицировали на программируемом термоциклере
MyCycler (Bio-Rad, США).
Составленная реакционная смесь для проведения амплификации
генов обьемом 20 мкл, содержащая: 10хTag буфер , 10 мМ dNTPs (смесь
нуклеотидов), 25 мM MgCl2 , смесь праймеров (50 пМ/мкл каждого), Tag
ДНК полимераза (5 ед./мкл), 100 нг геномной ДНК.
Для амплификации фрагментов по генам CSN3 и PRL использовали
следующие праймеры:
JK3 (5- ATAGCCAAATATATCCCAATTCAGT 3)
JK5 (5- TTTATTAATAAGTCCATGAATCTTG 3).
PRL1 (5- CGA-GTC- CTT- ATG- AGC- TTG- ATT- CTT-3)
PRL2 ( 5- GCC- TTC- CAG- AAG- TCG- TTT- GTT- TTC-3)
После амплификации полученный фрагмент по каждому гену был
подвергнут расщеплению с помощью эндонклеаз рестрикции HinfI и RsaI
(СибЭнзим
(Россия))соответственно.
Гидролиз
проводили
на
программируемом термоциклере в соответствии с рекомендациями
изготовителя.
Визуализация фрагментов, осуществлялась электрофоретическим
разделением продуктов рестрикции в 2% геле агарозы, в присутствии 5
мкл 10% бромистого этидия, далее фиксировали и документировали с
помощью системы GelDoc (Bio-Rad, США).
Результаты и обсуждения. В исследованном стаде выявлено
значительное преобладание животных с генотипами АА гена каппаказеина и пролактина.
Нами была изучена молочная продуктивность коров по двум генам
за время первой лактации в зависимости от различных генотипов и их
комплексов. Молочная продуктивность животных с генотипом АВ по гену
77
CSN3 достигла 6179,5 кг молока, что на 135, 9 кг больше удоя коров с
генотипом ВВ, и на 75, 4 кг больше удоя первотелок несущих
гомозиготный генотип АА.
По содержанию жира в молоке в среднем за лактацию коровы с
генотипом АВ превосходили животных с генотипом ВВ на 0,54% , и на
0,13% коров несущих генотип АА.
Выход молочного жира также был наивысшим у коров с
гетерозиготным генотипом АВ, и составил соответственно – 244,4 кг, что
больше на 39,9 кг по сравнению с коровами гомозиготных по аллелю «А»,
и на 13,4 кг больше относительно животных с гомозиготным генотипом
ВВ.
В целом первотелки характеризуются низким показателем
белковомолочности. Коровы с генотипом ВВ имели более высокий
уровень содержания белка в молоке- 3,1%, что выше на 0,04 % , чем у
коров с генотипом АА, и на 0,06% , по сравнению с первотелками
несущих гетерозиготный генотип АВ.
Выход молочного белка у животных с гомозиготным генотипом ВВ
был выше на 3,1 кг по сравнению с гомозиготными по аллелю «А», и
незначительно превышал животных с генотипом АВ (на 0,71 кг).(табл.1)
Аналогичные исследования были проведены относительно гена
пролактина. Также по результатам тестирования с помощью ПЦР-ПДРФ
анализа было сформулировано три группы животных в зависимости от их
генотипа. Исследования позволили установить, что молочная
продуктивность животных с генотипом АА- 6148,1больше , чем у
животных с генотипом АВ на 65, 1 кг, и на 417,2 кг животных с
гомозиготным генотипом по аллелю «В».
По содержанию жира в молоке превосходство имели животные
несущие гомозиготный генотип ВВ-4,13 %. Это высше на 0,32 % по
сравнению с животными имеющих генотип АА, и на 0, 15 больше, чем у
коров с генотипом АВ. Выход молочного жира, был наивысшим у
животных, несущих гетерозиготный генотип по гену пролактин, и
составил 240,2 кг., что на 7,2 кг больше по сравнению с животными
имеющими генотип АА, и на 3,4 кг больше чем у животных с генотипом
ВВ.
В случае с геном пролактин наблюдается такая же картина и по
белковомолочности, что и у гена CSN3. Содержание белка в молоке у всех
трех групп животных была низкой, при этом превосходство имели коровы
несущие в своем геноме генотип ВВ – 3,1%, что высше на 0,06%
относительно животных гомозиготных по аллелю «А», и на 0,02% высшее
по сравнению с коровами с гетерозиготным генотипом АВ.
Выход молочного белка у животных несущих генотип АВ был
наивысшим - 188,7 кг, и превосходил других животных несущих генотип
АА и ВВ на 1,8 кг и 10,9 кг соответственно. (табл.1)
78
1. Продуктивность, жирномолочность и белковомолочность коров с
различными генотипами CSN3 и PRL
Гено
тип
Кол-во Кол-во
голов голов
в%
Показатели
Удой,кг
АА
АВ
118
38
73,3
23,6
6104,1±71,2
6179,5±125,6
ВВ
ВВ к АА
АВ к ВВ
АВ к АА
5
3,1
6043,6±274,9
-60,5
+ 135,9
+75,4
АА
АВ
ВВ
ВВ к АА
АВ к ВВ
АВ к АА
130
24
7
80,8
14,9
4,3
6148,1±67,6
6083,0±162,9
5730,9±173,2
- 417,2
+ 352,1
- 65,1
Жир,%
CSN3
3,89±0,071
3,96±0,104
3,42±3,07
- 0,41
+ 0,54
+ 0,13
PRL
3,81±0,065
3,98±0,156
4,13±0,292
+ 0,32
- 0,15
+ 0,17
Жир, кг
Белок,%
Белок,кг
231,2±5,3
244,4±7,97
3,06±0,009
3,04±0,017
186,1±2,34
188,5±4,52
204,5±12,55
- 26,7
+ 39,9
+ 13,4
3,10±0,052
+ 0,04
-0,06
- 0,02
189,2±7,79
+3,1
- 0,7
+2,4
233,6±3,81
240,8±10,19
237,4±19,28
+ 3,8
+3,4
+ 7,2
3,04±0,008
3,08±0,095
3,10±0,029
+0,06
- 0,02
+ 0,04
186,9±2,25
188,7±6,17
177,8±4,74
- 9,1
+10,9
+1,8
Таким образом, исходя из выше изложенного можно сказать что в
целом, как и по гену каппа-казеин, так и по гену пролактин превосходство
имели животные несущие в своем геноме гетерозиготный генотип АВ, по
всем заявленным параметрам.
Далее были выявлены коровы с наилучшими показателями молочной
продуктивности и качественным составом молока в зависимости от
сочетания различных генотипов гена CSN3 и PRL. В результате таковыми
показателями обладают животные несущие следующие сочетания
генотипов по двум генам: АА/АВ- это 18 коров, АВ/АА- 34 коровы,
ВВ/АА- 3 коровы, АА/АА- 93 коровы. (табл.2)..
2. Результаты показателей молочной продуктивности и качественного
состава молока в зависимости от сочетания различных генотипов
Генотип
kказеин/PRL
Кол
-во
гол
%
удой, кг
Жир
%
Молочный
жир
кг
Белок
%
Молочный
белок
кг
АА/АА
АА/АВ
АА/ВВ
АВ/АА
АВ/АВ
ВВ/АА
ВВ/АВ
93
18
7
34
4
3
2
57,8
11,2
4,3
21,1
2,5
1,9
1,2
6118,6±79,7
6174,7±214,6
5730,9±173,2
6226,7±138,2
5778,0±85,82
6160,7±515,5
5868,0±209,3
3,86±0,087
3,89±0,242
4,13±0,322
4,01±0,116
3,94±0,263
3,83±0,533
3,86±0,048
236,1±6,05
237,5±14,83
236,6±18,8
248,9±8,01
227,7±14,52
232,7±18,09
226,5±10,91
3,10±0,008
3,10±0,024
3,16±0,029
3,10±0,019
3,13±0,047
3,15±0,078
3,18±0,038
189,6±2,43
191,8±7,24
181,0±5,43
192,5±4,65
180,5±5,79
193,4±1,11
186,8±4,45
79
Каждое животное, которое носит один из этих сочетаний генотипов
обладает высокой молочной продуктивностью, и высоким выходом
молочного белка
Заключение. После всех проведенных исследований общее
количество коров, которые будут внедрены в племенное ядро, составило
148 голов.
Полученные данные о наличии взаимосвязи комплекса сочетаний
генотипов животных по двум генам, с молочной продуктивностью и
качественным составом молока коров, открывают возможность для
совершенствования крупного рогатого скота татарстанского типа по
качеству получаемой от них молочной продукции и приводят к
увеличению молочной продуктивности животных. Поэтому необходимо
увеличивать численность животных, несущих в геноме желательные
сочетания генотипов. Также, чтоб этого добиться, необходимо проводит
целенаправленное скрещивание коров, несущих наиболее оптимальное
сочетание по комплексу генотипов, с быками- производителями, также
являющимися носителями наилучших сочетаний генотипов по двум и
более генам.
ЛИТЕРАТУРА:
1.
Губайдуллин,
Э.
С.
Программа
совершенствования пород молочного скота в Татарстане / Э. С.
Губайдуллин [и др.]. - Казань, 1995. - 158 с. 2. Зиновьев, Н. А.
Методические рекомендации по использованию метода полимеразно
цепной реакции в животноводстве / Н. А. Зиновьев [и др.]. – Дубровицы:
ВИЖ, 1998. – 36с. 3. Калашникова, Л. А. Возможности использования
ДНК маркеров продуктивных качеств животных в практической
селекционной работе / Л. А. Калашникова // Современные достижения и
проблемы биотехнологии сельскохозяйственных животных. – Дубровицы.
– 2003. С.33-39. 4.Хабибрахманова Я.А. Полиморфизм генов молочных
белков и гормонов крупного рогатого скота: дис. … канд. биол. наук /
Хабибрахманова Я.А..- п. Лесные Поляны Московская область, 2009.- 123
с.
АНАЛИЗ ПОЛИМОРФИЗМА ГЕНОВ CSN3 И PRL У ПЕРВОТЕЛОК
ХОЛМОГОРСКОЙ ПОРОДЫ ТАТАРСТАНСКОГО ТИПА, А ТАКЖЕ ИХ
МОЛОЧНАЯ ПРОДУКТИВНОСТЬ И КАЧЕСТВЕННЫЙ СОСТАВ МОЛОКА В
ЗАВИСИМОСТИ ОТ СОЧЕТАНИЯ ГЕНОВ
Зиннатова Ф.Ф.
Резюме
Определены частоты аллелей и генотипов по локусу гена CSN3 и
PRL, используя ПЦР- ПДРФ анализ у коров холмогорской породы
татарстанского типа. Установлена корреляция между генотипами с
молочной продуктивностью и качественным составом молока, а также
80
корреляция между сочетаемостью генотипов, по двум генам, с теми же
показателями. Выявлены животные с наилучшей сочетаемостью генотипов
для внедрения их в племенное ядро.
ANALYSIS OF POLYMORPHISM GENE CSN3 AND PRL IN KHOLMOGORSKY
BREED TATARSTAN TYPE COWS, AS WELL AS THEIR MILK PRODUCTIVITY AND
QUALITY OF MILK BASED ON COMBINATION OF GENES
Zinnatova F.F.
Summary
The frequencies of alleles and genotypes at locus of gene CSN3 and PRL,
using PCR-RFLP analysis in cows Kholmogory Tatarstan breed type. The
correlation between genotypes with milk production and the qualitative
composition of milk, as well as the correlation between combinability genotypes
for two genes with the same parameters. Identified animals with the best
combinability genotypes for their introduction in the breeding nucleus.
УДК 636. 082. 12.
АНАЛИЗ РОДИТЕЛЬСКОГО ИНДЕКСА РЕМОНТНЫХ-БЫЧКОВ И
ГЕНОТИПИРОВАНИЕ ИХ ПО ГЕНАМ КАППА – КАЗЕИНА (CSN3),
ЖИРНОМОЛОЧНОСТИ (DGAT) И BLAD
Зиннатова Ф.Ф., Алимов А.М., Зиннатов Ф.Ф.
ФГОУ ВПО «Казанская государственная академия ветеринарной
медицины им. Н.Э Баумана»
Ключевые слова: быки- производители, генотип, родительский
индекс, частота аллелей, селекция.
Key words: bulls-producing genotype, the parent index, the frequency of
alleles, selection.
Построение оптимальной генеалогической и генетической структуры
стада крупного рогатого скота связано не только с использованием
качественного маточного поголовья как по продуктивности, экстерьеру,
генетическим показателям, но и с использованием препотентных быковпроизводителей, оценённых как улучшатели значимых селекционных
признаков. Скрещивание коров отечественной породы с такими быкамипроизводителями приводит к сужению генетической изменчивости в
результате нарастания общей гомозиготности среди маточной части стада
и поголовья ремонтных бычков. Избежать снижение изменчивости можно,
81
Скачать