Страницы 204-385

Реклама
ȼȿɌȿɊɂɇȺɊɇȺə ɆȿȾɂɐɂɇȺ
DETECTION OF HIGHLY PATHOGENIC PRRSV-GENOTYPE IN
SWINE FARM OF MONGOLIA
BAYANZUL A., BATBAYAR T.,UYANGAA T., TUNGALAG CH.,
School of Veterinary Medicine, Mongolian University of Life Science, Ulaanbaatar, Mongolia
Abstract
PRRS cases were first reported 2007 in a swine farm of Mongolia. Hence 5 outbreaks wererecorded
in our country, no genetic information on porcine reproductive and respiratory syndrome virus (PRRSV)
reported until now.
The purpose of this study was to determine PRRSV genotypes. RNA was isolated from serum samples
of 12 pigs with suspiciousclinical signs of PRRSV infection.
Reverse transcriptase polymerase chain reaction (RT-PCR) and nested PCR was applied for detection
and typing of PRRSV. We determined North American type of PRRSV. The further determination of
circulating PRRSV genotypes in local swine flocks is helpful for disease control and prevention.
Key words; Porcine Reproductive and Respiratory Syndrome Virus (PRRSV),Reverse transcription
polymerase chain reaction (RT-PCR), Nested PCR, PRRSV genotypes
Introduction. Porcine reproductive and respiratory syndrome (PRRS) is a devastating disease resulting
in huge economic losses to the swineindustry worldwide [1]. Recent economic estimates of annual losses
to the US swine industry due toPRRSV infection amount to more than $660 million (Neumann et al.,2005).
The virus causes late-term reproductive failure in pregnant sows and respiratory distress among young
piglets. PRRSV emerged in the late 1980s with serious outbreaks of reproductive failure, pneumonia, and
reduced growth performances among pigs in the US and Europe (Snijder et al., 2013). Within a couple
of years it had spread worldwide. PRRS virus (PRRSV) is a member of the family Arteriviridae, along
with equine arteritis virus, lactate dehydrogenase-elevating virus of mice, and simian hemorrhagic fever
virus. [6].. The causative agent was isolated and identified as sense RNA virus for the first time in the
Netherlands and later named porcine reproductive and respiratory syndrome virus, reflecting the main
clinical manifestations of infection(Hanada et al., 2005; Wensvoort et al., 1991).
PRRSV is an enveloped virus with (+)ssRNA genome of approximately 15 kb in length. The European,or
type 1 virus, and the North American, or type 2 virus, are thetwo designated genotypes for PRRSV with
worldwide distribution(Snijder et al., 2013). The sequence identity is restricted to 50–60 %between these
two subtypes (Nelsen et al., 1999; Nelson et al.,1993).(5)
Materials and methods
Sample collection: The twelve serum samples were taken from pigs in last outbreak 2014.
RNA Extraction: Viral RNA was isolated with Nucleospin® Viral RNA Mini Kit (Macherey-Nagel)
according to the manufacturer’s protocols.Six hundred microlitter Buffer RAV1 containing Carrier RNA
to 150 ȝL of the sample. Incubated for 5 min at 70 °C. Add 600 ȝL ethanol (96–100 %) to the clear lysis
solution and mix by vortexed.Place NucleoSpin® RNA Virus Columns in Collection Tubes and load 700
ȝL lysed sample and centrifuge.Add 500 ȝL Buffer RAW to the NucleoSpin® RNA Virus Column and
centrifuge. Three times washed by RAV3.Elute viral RNA Place the NucleoSpin® RNA Virus Column
into a new, sterile 1.5 mL micro centrifuge tube. Add 50 ȝLRNase-free H2O and incubate for 1–2 min.
Centrifuge for 1 min at 11,000 x g and to use for PCR.
Primers:We used three different primer sets. One step RT-PCR amplificate both serotypes PRRSV-NA
and PRRSV-EU. Nested PCR detected two serotypes and used different primer sets (PRRSV-NA primer
No.22 and 24, PRRSV-EU primer No.23 and 25).
RT-PCR and nested PCR for detection and typing of PRRSV
RT-PCR was performed with AniGen One Step RT-PCR Kit®as follows: the mixture of 1 —l sample
RNA; 1.2 —l of forward primer; 1.2 —l or reverse primer; 16.6 —l or reagent mixture of the kit (8.4 —l of
RNase-free water, 0.8 —l of dNTP mix, 5 —l of 5x RT-PCR buffer, 0.8 —l of RT-PCR enzyme mix, 0.24
—l of RNase inhibitor). The forward primer were No. 21 F (5’ GTACATTCTGGCCCCTGCCC 3’) and
reverse primer were No. 26 R (5’ GCCCTAATTGAATAGGTGAC 3’).
RT-PCR amplification was carried out as follows: 1 cycle at 42oC for 30 min and 94oC for 10 min
followed by 40 cycles of denaturation at 94oC for 30 sec, annealing at 60oC for 30 sec, extension at 72oC
for 1 min and final elongation step at 72oC for 7 min, finished at 4oC. The amplicons were separated by
204
electrophoresis in 1 % agarose gel in TAE buffer and stained with ethidium bromide. The expected size
of PCR products were 668 bp for NA type and 645 bp for EU type.
Table 1.
Primers used for PCR
Primer Name
Oligonucleotides
No.21F
5’ GTACATTCTGGCCCCTGCCC 3’
No.26R
5’ GCCCTAATTGAATAGGTGAC 3’
No.22 F
5’ TCGTTCGGCGTCCCGGCTCC 3’
No.24 R
No.23 F
No.25 R
5’ TTGACGACAGACACAATTGC 3’
5’ CGCTGTGAGAAAGCCCGGAC 3’
5’ TCGATTGCAAGCAGAGGGAG 3’
Size (bp)
NA EU
668 645
349
354
Nested PCR was performed with Premix as follows: the mixture of 1 —l of the RT-PCR products;
1.25 —l of forward primer; 1.25 —l or reverse primer; nuclease free water 21. For detection of NA
type, the forward primer were No. 22 F (5’ TCGTTCGGCGTCCCGGCTCC 3’) and reverse primer
were No. 24 R (5’ TTGACGACAGACACAATTGC 3’). For detection of EU type, the forward
primer were No. 23 F (5’ CGCTGTGAGAAAGCCCGGAC 3’) and reverse primer were No. 25 R (5’
TCGATTGCAAGCAGAGGGAG 3’)[4]. Nested-PCR amplification was carried out as follows: 1 cycle
at 95oC for 5 min followed by 25 cycles of denaturation at 95oC for 30 sec, annealing at 55oC for 30 sec,
extension at 72oC for 30 sec and final elongation step at 72oC for 7 min, finished at 4oC. The expected size
of PCR products were 349 bp for NA type and 354 bp for EU type.
Results
Twelve samples were found to be PRRSV positive byRT-PCR based on open reading frame 5 (ORF5).
Viral RNA was detected in serum(Fig. 1).
Figure 1.Reverse transcriptase PCR detection of
the viral pathogens from the serum with specific
primers (primer 21, 26) for PRRSVLines 1:
molecular size marker (100 bp DNA ladder)
Lines 2-Serum sample – 11, 3-Serum sample –
71, 4-Serum sample – 13, 5-negative control
Figure 2.Nested PCR result of PRRSV.
Lines ; 1-molecular size marker /100 bp DNA
ladder/, NA type 2- serum sample-11, 3-serum
sample-71 4- serum sample-13, 5- negative control,
EU type 6-serum sample-11, 7-serum sample-71, 8serum sample-13, 9-negative control
Discussion
PRRSV is characterized of its extensive genetic/antigenic variation in the field. In this study we
determined only one PRRSV-genotype but further extended work needed for PRRSV-genetic diversity
in Mongolian swine farms. In Europe, the EU type predominates. In western European countries where
NA type is present, it was most likely introduced in 1996 through the use of a live attenuated PRRSV
vaccine (Madsen et al 1998; Oleksiewicz et al 1998). In Asia and south America, both genotypes have
been isolated[2]. Within each genotype some differences are seen. The farm swine’s and boar-semen
of Mongolia are originally imported mainly from China. Low replication fidelity of RNA polymerase,
abundance of viral quasispecies, RNA recombination, and immune pressure selection are regarded as the
mechanisms generating viral heterogeneity and diversity which promotes the evolution of PRRSV. Our
swine farmers don’t use any PRRSV vaccine. The determination of dominant HP- PRRSV in local swine
205
farms is essential for vaccination program. But vaccination with attenuated PRRSV live vaccine will raise
the risk of reversion to virulence and increase the possibility of recombination between vaccine strains
and field strains, the PRRS diversity will be continually expanded and the epidemic situation in the field
will be more complicated.
In China is both genotypes are identified[2], so there must be also EU type present in our swine farms.
The virus isolation/sequencing from local PRRS cases in Mongolia will result in new strains within this
two genotypes. This will be then helpful for viral phylogenetic studies and disease control. Also, it could
provide an important clue for modification of diagnostic methods and design of novel vaccine.
The incidence decrease of overt clinical cases in western countries can be either real decreasing of
actually infection or predominance of avirulent strains that cause subclinical infections. With the prevalence
of seropositive herds in USA now greater than 50 %, (in 1994) the number of negative, susceptible herds
is decreasing, so the incidence would be expected to decrease (7). The seroprevalence study in Mongolian
farms which can give important epidemiological data not done yet so far.
Acknowledgement
This study was supported by the Mongolian University of Life Science and Viral Disease and
Epidemiology Research Division, National Institute of Animal healthTsukuba, Japan
References
1.
Lu, Z.H., A.L. Archibald, and T. Ait-Ali, Beyond the whole genome consensus: unravelling of PRRSV
phylogenomics using next generation sequencing technologies. Virus Res, 2014. 194: p. 167–74.
2.
Kerstin Wernike1, B.H., Malte Dauber2, Elke Lange2, Horst Schirrmeier1, Martin Beer1*, Detection and
Typing of Highly Pathogenic Porcine Reproductive and Respiratory Syndrome Virus by Multiplex Real-Time
RT-PCR. PLoS ONE, 2012. Volume 7 ( Issue 6).
3.
PRRS outbreak in Mongolia resolved, O.r., PRRS claimed 44 pigs, while an additional 293 susceptible animals
were destroyed. 2014.
4.
Iseki, H., et al., Genetic analysis of ORF5 in porcine reproductive and respiratory syndrome virus in Japan.
Microbiol Immunol, 2011. 55(3): p. 211–6.
5. Sujit Pujharia, Marko Kryworuchkob, Alexander N. Zakhartchouka
Role of phosphatidylinositol-3-kinase (PI3K) and the mammalian target of rapamycin (mTOR) signalling pathways
in porcinereproductive and respiratory syndrome virus (PRRSV) replication.
6. Chang CC, Yoon KJ, Zimmerman JJ, Harmon KM, Dixon PM, Dvorak CM, Murtaugh MP. Evolution of Porcine
Reproductive and Respiratory Syndrome Virus during SequentialPassages in Pigs
7.
ElidaM.Bautista, BS; Robert B. Morrison, DVM, PhD; Sagar M. Goyal, DVM, PhD; James E. Collins,
DVM,PhD; and Joseph F.Annelli, DVM, MSSeroprevalence of PRRS virus in the United States
STUDY OF PMSG, FSH, INHIBIN-B, PROLACTIN AND INSULIN
IN MONGOLIAN HORSES
BAYAR-ENKH B., BATSAIKHAN D., AND TSOGTSAIKHAN E.,
Institute of Veterinary Medicine, Mongolian University of Life Sciences, Ulaanbaatar,
Mongolia. Email: b.ulaka@yahoo.com
ABSTRACT
Every functions of animal body, especially reproductive and metabolic ones are closely associated or
regulated with endocrine system functions or its hormones. Of course, study of both reproductive and
metabolic hormones can facilitate deeper understanding of mechanisms of hormonal regulation of animal
reproduction and metabolism, which is necessary for solving both theoretical and practical issues.
Therefore we attempted to initiate such a study toward some of these hormones including eCG, FSH,
inhibin-B, prolactin and insulin. These hormones were measured in blood serum of Mongolian horses
by using the relevant ELISA test kits. Blood samples of mares were collected during various stages of
reproductive function of Mongolian horses from May through October.
This period includes late pregnancy for some mares, postpartum, estrus or diestrus for another ones,
and first months of gestation if mares are conceived. Stallions also were sampled for FSH, inhibin-B,
prolactin and insulin hormones. The study results show eCG or blood serum gonadotropin concentration
starts to increase since day 40 of gestation, reaches maximal level of 164.4±19.8 IU/ml at day 70, then
decreases gradually and finally becomes undetectable at day 150 approximately. Measurement of blood
serum FSH, inhibin-B and prolactin revealed that there are negative correlation between blood serum
concentrations of FSH and inhibin-Bin both mares and stallions (r=í0.77412), whereas no correlations
(r=0.074037) were observed between inhibin-B and prolactin. Blood serum concentrations of inhibin-B
206
and FSH were low and high repectively in those stallions, which have harem with higher conception
rate or are seen to have greater reproductive capacity, whereas they were vice versa in the stallions,
which have harem with lower conception rate or are seen as weaker in reproductive activity. Very weak
positive or 0.07 correlation between insulin and prolactin in blood serum of horse reveals both hormones
dependent each from other. As well, there is a tendency of having relationship between gestation length
and metabolic hormones such as insulin and prolactin.
KEY WORDS: Mongolian horse, gonadotropin, inhibin-B, insulin, prolactin
INTRODUCTION
Various reproductive and metabolic hormones such as eCG, GH, FSH, LH, TSH, ACTH, prolactin,
insulin and many other hormones in various animal models, including horses were reported by a number
of authors.
Donrov(1982)has reported that the gonadotropic activity of serum from pregnant Mongolian mares
also develops between 60 and 120 days of gestation.Pregnant mares’ serum gonadotropin (PMSG,
i.e.,equine chorionic gonadotropin; eCG) has a number of interesting and unique characteristics (Allen
andStewart, 1978).
From an endocrinological viewpoint, the most striking characteristic of PMSG is its ability to elicit
both follicle stimulating hormone (FSH) and luteinizinghormone (LH) activities in species other than
thehorse (Cole and Hart, 1930).
The FSH-like property of PMSG has resulted in the worldwide use of partially purified extracts of
the gonadotropin as the least expensive and most readily available means to induce folliculogenesis in
domestic and laboratory animal species (Allen and Stewart,1978; Stewart and Allen, 1976).
A hormone inhibin was studied relatively later and it has been revealed that the hormone is glycoprotein
consisting of alfa and beta dimers, which is produced in ovarian granulose cells in females and testicle
Sertoli cells in males, its synthesis is stimulated with the increase of FSH in the blood and the hormone
inhibits FSH release from pituitary gland.
Bergfelt et al (1991) measured circulating inihibin during estrus cycle of mares and reported the hormone
increases enormously, when ovulation takes place. Hadley (1992) mentioned inhibin is synthesized
in seminiferous tubule and sertoli cells in male animals and Sertoli cells alone don not decrease FSH
concentrations unless spermatogenesis occurs.
Watson et al (2002) measured mares blood plasma FSH, inihibin A, and inhibin isoforms by using
ELISA test during estrus in spring season. As a result it was found there is inverse relationship between
FSH and inhibin in estrus of mares.
According to study by Donadeu et al (2001) no fluctuations of inhibin-B concentrations in fluid of
ovarian follicles of various sizes for mares were observed. Nagaoka at al (1999) found measurement of
inihibin B concentrations may allow precise determination of ovulation period in mares. Also Goudet
et al (11) determined concentrations of gonadotropic and inhibin hormones during various stages of
follicular development.
Production and secretion of prolactin is elevated during pregnancy, and this hormone has been
recognized as a potent growth factor for pancreatic beta-cells (Billestrup and Nielsen, 1991; Labriola et
al., 2007; Nielsen et al., 1992). Prolactin metabolism appears to differ between species.
For example, studies with human subjects have shown a higher prolactin release after eating in women
than in men (Carlson et al., 1983). In addition, the time at which prolactin peaks after eating appears to
differ among species.
For instance, prolactin peaks approximately 1 h post-eating in humans (Quigley et al., 1981; Carlson
et al., 1983) but at 6 h in cattle (McAtee and Trenkle, 1971). Insulin might be partially responsible for this
post-prandialhyperprolactinemia (Weiss, 2003).
The present study aims to reveal relationships between some circulating hormones, which are
implicated in both reproductive and metabolic functions of horse.
MATERIALS AND METHODS
In the study, 205 native Mongolian horses were selected, and sampled during June through October
and the samples were frozen for storage at -200C till testing.
1. Blood serum eCG concentration of mares: Blood serum eCG concentration was measured by DRG
ELISA test kit according to the manufacturers instruction.
2. Blood serum inhibin-B concentration of mares: Blood serum inihibin B concentration was measured
by DSL ELISA test kit according to the manufacturers instruction.
2. Blood serum FSH concentration of mares: Blood serum FSH concentration was measured by
Endocrine tech ELISA test kit according to the manufacturers instruction.
207
3. Blood serum prolactin concentration of mares: Blood serum prolactin concentration was measured
by DSL ELISA test kit according to the manufacturers instruction.
4. Blood serum inhibin-B, prolactin and FSH concentrations of stallions: Blood serum inhibin-B,
prolactin and FSH concentrations were measured by DSL and Endocrine tech ELISA test kits according
to the manufacturers instructions.
All data of measurements were calculated by using Student’s test.
RESULTS
Blood serum concentrations of eCG in native Mongolian mares at days 60 to 150 of pregnancy
were measured and results were shown in figure 1. The figure demonstrates peak concentration of
164.4±19.8 IU/ml occurs at day 70, then decreases gradually and finally becomes undetectable at day 150
approximately.
Figure 1. Serum gonadotropin dynamics of pregnant Mongolian mares
Stallions were divided into 2 groups in accordance with the conceptions rates of mares in the respective
harems and circulating hormones were measured and compared (Table 1).
Table 1.
Comparison of blood serum concentrations of FSH, inhibin-B and prolactin in stallions.
Groups
Average
Group 1
FSH, ng/ml
8.86±2.8
2.4±1.0
Inhibin-B, pg/ml
2959.58±396.4
3901.0±251.8
Prolactin, ng/ml
6.14±0.9
5.75±0.15
Group 2
13.17±1.5
2331.9±101.4
6.4±1.6
P
>0.010
<0.010
>0.500
Above table shows for stallions of group 1, concentration of FSH is low, and inhibin-B is high, while
for group 2 stallions they are vice versa and prolactin concentrations in groups were not significantly
different (P>0.500).
Comparisons of conception rates of mares in harems of both group stallions demonstrated that conception
rate of mares sired by those stallions with greater inhibin-B and lower FSH concentrations accounted for
66.7±9.1 %, whereas the rate of mares of another group accounted for 85.7±5.9 %(P<0.100).
In order to measure concentrations of blood serum hormones in mares, the animals were divided into
2 groups with that whether they are conceived or in estrus, and both groups were compared with each
others.
Table 2.
Comparison of blood serum concentrations of FSH, inhibin-B and prolactin in mares
208
Groups
FSH, ng/ml
Inhibin-B, pg/ml
Prolactin, ng/ml
Average
10.2±1.5
357.9±38.9
6.3±0.2
Conceived
4.45±0.5
486.1±37.7
6.25±0.2
In heat
19.6±1.1
148.05±12.4
6.3±0.4
P
<0.001
<0.001
>0.500
Table 2 shows higher FSH and lower inhibin-B concentration were found during estrus of mares, while
FSH decreases and inhibin-B increases after more than 40 days after covering by stallion.Concentrations
of FSH and inhibin-B in blood serum of horses have strong and negative correlation, while there were
none or very weak correlation between concentrations of prolactin and inhibin-B in blood serum of
horses.
Table 3.
Blood serum insulin and prolactin concentrations theircorrelations in Mongolian horse
Variables
No. of
amples
Prolactin, ng/ml
Insulin, —IU/ml
Correlation, r
Notes
1
Stallions
5
6.74±0.55 (5.6–8.4)
12.63±1.0 (10.4–13.0)
-0.81
Negative
2
Mares
33
6.28±0.17 (4.3–8.3)
9.75±1.42 (5.7–39.4)
0.1
Weak positive
>0.500
<0.001
6.3 (4.3–8.4)
10.1 (5.7–39.4)
0.07
Very weak
positive
<0.001
<0.001
P
3
Total
p
38
From table 3 it is demonstrated that insulin and prolactin concentrations of stallions have negative
correlation, whereas in mares they have weak positive correlation.
DISCUSSION. Cole and Hart (1930) reported that gonadotropic activity first appears in peripheral
serum of mares between 37 and 41 days after conception. These gonadotropin levels rise steeply to
reach a peak between days 60 and 80 of gestation. Our study revealed blood serm concentration of
PMSG reached its peak of 164.4±19.8 IU/ml at day 70, then decreases gradually and finally becomes
undetectable at day 150 approximately
Studies conducted by Bergfelt et al (1991), Watson et al (7), Nagaoka et al (9), and Goudet et al (10)
that concentrations of both inhibin-B and FSH were inversely related, decreasing in heat and increasing
during pregnancy, and associated with reproductive activity and semen quality of stallion are consistent
with the results of our study. Roser et al (7) measured concentrations of FSH, estradiole and inhibin
in mares in heat and stallions during late spring and autumn, when their reproductive activities differ.
Negative correlation between concentrations of circulating FSH and inhibin according to their study
(r=í0.7359, p<0.01) is consistent with the results of the present study (r=í0.77412). Studies of blood
serum concentrations of inhibin-B in horses in comparison with prolactin (12) found no significant
relationships between concentrations of both hormones. Based on above mentioned results, it has been
concluded that FSH and inhibin-B concentrations in blood of horses change with inverse relationships
and it is possible to determine reproductive activity of stallions with concentration of inhibin-B in blood
serum.
De Pew et al. (1994) found that stallions exhibited a prolactin response that was approximately twice
that observed in mares. Prolactin secretion in horses may be stimulated by aspects of eating other than the
feed-stuff itself. Total feed deprivation had little effect on the subsequent prolactin response to a meal or to
other known secretagogues (Nadal, 1997). According to results of our study, prolactin concnetration was
higher in stallions than mares, but it remains unclear whether prolactin response after grazing. Heidler et al
(2003) analyzed growth hormone (GH), insulin-like growth factor 1 (IGF-1), leptin, luteinizing hormone
(LH) and prolactin in mares from late pregnancy throughout lactation, and noted prolactin concentrations
reached a maximum in the week of foaling and decreased rapidly thereafter.
Despite there were some findings in regard to interrelationships between reproductive and metabolic
functions and endocrine regulations in our study, more detailed studies will be necessary in relation to
concentrations of a whole set of reproductive and metabolic hormones including above mentioned ones
during relevant physiological processes.
CONCLUSION
The study demonstrates that each hormones measured in this study have their own characteristics
depending on stages of both reproductive and metabolic functions. When mares are in heat, there was
negative correlation between FSH and inhibin-B in both mares and stallions, while no correlation observed
between inhibin-B and prolactin. From the results of this research, very weak positive or 0.07 correlation
between insulin and prolactin in blood serum of horse reveals both hormones dependent each from other.
As well, there is a tendency of having relationship between gestation length and metabolic hormones such
as insulin and prolactin.
209
Reference
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
Allen, W.R. (1980). Hormonal control of early pregnancy in the mare, In symposium on Equine Reproduction,
Vet. Clin. North Am.: Large Anim. Pract., 2:291–302
Bergfelt D.R., et al. Curculating concentrations of immunoreactive inhibin and FSH during the estrous cycle
of mares. J.Equine Vet.Sci., 1991, V 11: 319–321
Cole, H.H.and Hart, G.H (1930). The potency of blood serum of mares in progressive stage of pregnancy in
effecting the sexual maturity of the immature rat. Amer. J. Physiol. 93, 57–68
DeJong, F. Inhibin. Physiol. Rev., 1988, 68: 555- 595
Donadeu, F.X. et al, Changes in concentrations of follicular fluid factors during follicle selection in mares,
J.Biol.Reprod., p 1111–1118, 2001
Donrov, C., (1982). Hormonelle blutactivitat hiesiger mongolisher stuten, Archiv fur exerimentelle
Veterinarmedizin, Band 36, Heft 1, 21–25
Hadley, M.C. Endocrinology, Prentice Hall, 1992, p 459–460
Rivier, C., J.Rivier, and W.Vale. Inhibin-mediated feedback control of FSH secretion in the female rat. Science,
234, p 205–208
Ueno, N., et al. Isolation and partial characterisation of follistatin: a single-chain Mr 35000 monomeric protein
that inhibits the release of FSH, 1: Proc Natl Acad Sci USA, 1987, Dec; 84 (23) : p 8282–8286
Nagaoka, K. et al., A selective increase in circulating inhibin and inhibin pro-ĮC at the time of ovulation in the
mare, Am.J.Physiol Endocrinol Metab Vol. 277; E870-E875, 1999
Goudet, G. et al., Intrafollicular content of LH receptor, alfa inhibin, and aromatase in relation to follicular
growth, estrous cycle stage and oocyte competence for in vitro matuartion in the mare, J.Biol Reprod, Vol 60,
p 1120–1127
Roser, J.F., et al, Inhibin activity in the mare and stallion, J. Domestic Animal Endocrinology, Vol.11, 1994, p
87–100
Irvine C. H. G., et al, Reproductive hormone profiles in mares during the autumn transition asdetermined
by collection of jugular blood at 6 h intervals throughout ovulatory and anovulatory cycles, Journal of
Reproduction and Fertility, 2000, 118, p 101–10
Heidler B, Parvizi N, Sauerwein H, Bruckmaier RM, Heintges U, Aurich JE, Aurich C. Effects of lactation on
metabolic and reproductive hormones in Lipizzaner mares.DomestAnimEndocrinol. 2003 Jul;25(1):47–59.
Stewart F., Allen W.R., Moor R.M. (1976), Pregnant mare serum gonadotropin: ratio of FSH and LH activities
by radioreceptor assay. J.Endocrinol 71:419
Wide M., and Wide L., (1964) Diagnosis of pregnancy in mares by an immunological method. Nature, 198:
1017–1018
Wilsher S., and Allen W.R., (2011) Factors influencing equine chorionic gonadotrophin production in the
mare, Equine Veterinary Journal, V 43, 4: 430–438
Watson, E.D. et al., Plasma FSH, inhibin A and inhibin isoforms containing pro- and ĮC during winter
anoestrus, spring transition and the breeding season in mares. J.Reproduction, 123, p 535-542, 2002
Ying, S.Y. Inhibins, activins, and follistatinas: gonadal proteins modulating the secretion of FSH. Endocr. Rev.
9, p 267–293
RESULTS OF THE EXPERIMENTS FOR DETERMINATION
OF OPTIMAL DOSE OF PREPARATION FOR ABORTION
PROPHYLAXIS
DOLGORSUREN TS.1, BAYAR-ENKH. B1, ENKH-OYUN T2
Institute of Veterinary Medicine, Mongolian University of Life Sciences, Ulaanbaatar,
Mongolia, orgil0704@yahoo.com
Abstract.In order to determine optimal dose of mineral and humic acid containing Preparation for
abortion prophylaxis, experiment was performed on pregnant rabbits divided into 4 groups (1.6 g/dose –
group 1; 1.06 g/dose –group 2; 0.8 g/dose –group 3; and control – group 4).
Results of the testing reveals that both total proteins and albumin concentrations in rabbits of the
second group treated with the preparation in 1.06 g dose were significantly different from rabbits of other
groups. Therefore, optimal dose of the preparation is seen to be 1.06 g or 0.44 g/kg.
Key words: dose, rabbit, biochemistry, protein, hemoglobin.
INTRODUCTION
Many thousands of offspring are lost, various disorders of dam animal reproduction are caused,
numbers of dam animals are barren due to abortion and it becomes main condition of milk and meat
productivity decrease.
210
Researchers informed pregnant animals are affected with deficiencies of proteins, minerals and
vitamins and aborted due to non-infectious causes depending on shortages of nutrients in feeds under
biogeocenotic conditions of our country.
Experiments to determine optimal dose of the preparation containing both minerals and humic acids in
order to exert positive impact on metabolism, ensure animal body maintenance and prevent abortions for
pregnant animal were performed in laboratory of animal reproduction pathology and endocrinology.
MATERIALS AND METHODS
Based on results of the prior experiments and literature reviews, the experimental design for determining
optimal dose was described.
A dose of 13 g/kg determined by the experiment on acute toxicity was reduced by 10, 15 and 20 times
and the present experiment was performed in a16 pregnant rabbits divided into 4 groups.
Blood samples were collected at days 0, 5, 10 and 18 of the experiment and total protein, albumin,
globulin and hemoglobin concentrations and both red and white blood cell parameters were measured.
Total protein, albumin and globulin concentrations were measured by automatic analyzator, hemoglobin
concentration by Sahlihemometer, and both red and white blood cell counts by Goryaev camera.
RESULTS
Measurements of total protein concentrations in blood serum of experimental group rabbits for 0 to
15 days reveal the concentration in rabbits of the first group increased by 6.3 to 20.3 %, second group by
34.3 to 40.5 %, third group by 70.3 to 83.5 %, and fourth or control group by 44.2 %.
Table 1
Total protein
Dose
1.6 g
1.06 g
0.8 g
Day 0
20 November
58.5
50.1
35.8
Control
41.4
Total protein(g/L)
Day 5
Day 10
26 November
1 December
70.4
59.7
70.4
72.8
65.7
51.3
38.5
59.7
Day 15
6 December
62.2
67.3
61.0
59.7
For ratio of albumin and globulin of experimental groups for days 0 to 15, it dropped from 1.0 to 0.9
for first group, from 1.06 to 0.7 for second group, and from 1.5 to 1.1 for third group.
Table 2
Albumin and globulin concentrations in rabbits of first group treated with 1.6 g dose of the preparation (g/L)
Intervals
Day 0
Day 5
Day 10
Day 15
Albumin
29.3
34.1
39.9
30.5
Globulin
29.2
36.3
29.8
31.7
Ⱥ/G
1.0
0.9
2.0
0.9
Table3
Albumin and globulin concentrations in rabbits of second group treated with 1.06 g dose of the preparation (g/L)
Intervals
Albumin
Globulin
Ⱥ/G
Day 0
25.8
24.3
1.06
Day 5
33.5
36.9
0.9
Day 10
38.5
34.3
1.1
Day 15
29.2
38.1
0.7
Table4
Albumin and globulin concentrations in rabbits of third group treated with 0.8 g dose of the preparation (g/L)
Intervals
Albumin
Globulin
Ⱥ/G
Day 0
22.0
23.8
1.5
Day 5
32.3
33.4
0.9
Day 10
34.9
16,4
2.1
Day 15
34.1
28.9
1.1
211
Figure1.
White blood cell counts in rabbits of experimental groups 1 and 2 before the experiment were lower
than the normal level, while they reached normal minimal level at days 5 and 10, and then dropped below
the normal level. White blood cell counts of both second and control group rabbits fluctuated at normal
levels (Figure 2).
Figure 2
Comparisons of hemoglobin concentrations of 3 experimental groupsshows hemoglobin concentrations
in first group rabbits are lower than normal level before the experiment or 7.5 g/dl, while it reached to
normal level or 13.4g/dl. Hemoglobin of both second and third groups increased by 1.2 g/dl and g/dl
respectively or at normal level. Hemoglobin of control group rabbits increased by g/dl (Figure 3).
Figure 3
212
Comparison of above values demonstrates that among the values after the experiment, total protein
concentration increase in the second group was the highest as compared to other groups and therefore the
dose was chosen as the optimal dose. Conversion it to 1 kg live weight, the optimal dose is 0.44 g/kg.
DISCUSSION
M.Trechkova, researcher of Veterinary medical institute, Brno, Czech Republic, and others
investigated dry matter of peat containing humin estimated to account for 8 % was given to fattening
pigs as supplemental feed for 90 days, and their physiological and biochemical values were measured.
Of all biochemical parameters, concentrations of total proteins and albumin were 51.9 to 57.8 g/L and
22.8 to 32.7 g/L respectively or increased to physiologically normal level, while according to our study,
the preparation containing humin in dose of 1.06 g given for 15 days resulted in fluctuations of total
proteins and albumin from 50.1 to 67.3 g/L, and 25.8 to 29.2 g/L respectively at normal levels, which are
consistent with the results of above s tudy.L.M.Stepanchenko, L.V.Zorina and L.V. Kravtsova, researchers
of Russian Federation used sodium humate as feed supplement in poultry farm and investigated the
effects on metabolism and resistance in broiler chicken and as a result, it increased body weight by 5 to
7 %, protein, lipid and mineral values were at normal levels, and improved animal body protective and
adaptive capabilities. As well as, according to the study by Russian researcher T.D.Lotoshin, it is reported
that red blood cell number and hemoglobin concentrations in animals treated with humate were at normal
level as compared to control group. Our experiments revealed that red blood cell number and hemoglobin
concentrations in rabbits treated with the preparation in optimal dose were also at normal levels both
before and after the experiment.
CONCLUSIONS
1.It is determined that optimal dose of the preparation is 0.44 g/kg.
2.Total protein values of both control and experimental group increased at the end of experiment and
values in second group were the highest.
3.Oral administration of the preparation in dose of 1.06 g in pregnant rabbits for 15 days resulted in
being red blood cell counts and hemoglobin concentrations at normal level.
References
15.
16.
17.
18.
19.
20.
P.Enkhtuya, 1996, Results of the study of causes of dairy cow infertility in regard to multiple characters of
property and different conditions of farms, Research report
P.Enkhtuya, Ts.Dolgorsuren, 2010, Development of technology for production of new drug for prevention of
mineral disorders, Report of Scientific and technological project.
Ts.Tsendsuren, J.Dugarjav, Sh.Munkhjargal, Biological effects, pharmacological and toxicological properties
of humic acids of clay and coal, Report of Scientific and technological project.
The effect of sodium humateon metabolism and resistance in highly productive poultry. Stepchenko, L. M.;
Zhorina, L. V.; Kravtsova, L. V. NauchnyeDokiVyssShkolyBiolNauki, 1991; Issue 10; Pages 90–95.
Experimental bases and prospects for the use of humic acid preparations from peat in medicine and agricultural
production. Lotosh, T. D. nauchnyeDokiVyssShkolyBiolNauki, 1991; Issue 10; Pages 99–103.
“Effectsofpeatfeedingontheperformanceandhealthstatus of fattening pigs and environmentally derived
mycobacteria”, M. TRCKOVA, Z. ZRALY, L. MATLOVA, V. BERAN, M.MORAVKOVA, J.SVOBODOVA,
I.PAVLIK, VeterinarniMedicina, 51, 2006 (12): 533–543, Veterinary Research Institute, Brno, Czech Republic,
Regional Institute of Public Health, Brno, Czech Republic.
SEROLOGICAL SURVEY INFECTIOUS BOVINE
RHINOTRACHETIS VIRUS, BRUCELLOSIS, BOVINE
MYCOBACTERIUM BOVIS AND BOVINE PARATUBERCULOSIS
OF DAIRY CATTLE HERDS IN MONGOLIA
DULAM PUREVTSEREN1,2, ZHOU WEI GUAN2, ERDENECHIMEG DASHZEVGE3,
MYAGMARSUKH YONDON3, ODBILEG RAADAN3, PUREVTSEREN BYAMBA3,
BOLDBAATAR BAZARTSEREN3
1-State Central Veterinary Laboratory, Ulaanbaatar, Mongolia
2-Inner Mongolian Agriculture University, Faculty of Veterinary Medicine, P.R.China
3-Institute of Veterinary Medicine, Mongolian University of Life Sciences, Ulaanbaatar,
Mongolia, Email: Chimgee_vet@yahoo.com
Abstract. The goal of this study was to conduct serological screening for antibodies to Infectious Bovine
Rhinotrachetis Virus (IBR), Brucelosis, Bovine Mycobacterium Bovis and Bovine Paratuberculosis dairy
213
cows in Mongolia. Totally 168 blood sera were collected from dairy cows in Selenge and Tuv provinces
of Mongolia during 2013 and 2014 and used in this study. The Selenge and Tuv provinces are major
industrial dairy production in Mongolia. ELISA for antibodies of IBR, Brucelosis, Bovine Mycobacterium
Bovis and Bovine Paratuberculosis was used to detect the seropositive animals.
An overall seroprevalence of antibodies against IBR was found to be 60.7 %. For the Brucelosis,
8.2 % positive samples to be found. And seroprevalence of antibodies against Bovine Paratuberculosis
was found to be 0.6. However, none of the samples were positive for Bovine Mycobacterium Bovis.
Keywords. IBR, Brucelosis, Bovine Mycobacterium Bovis and Bovine Paratuberculosis, ELISA
25. INTRODUCTION. Cattle are the natural host of some virus and bacterial diseases. Infectious
Bovine Rhinotrachetis Virus (IBR-1), Brucelosis, Bovine Mycobacterium Bovis and Bovine
Paratuberculosis are still occurs in many countries including Mongolia. In Mongolia, first time IBR was
diagnosed from dairy cow at 1982 in Central province where dairy cow farm developed. Since that
time, dairy cow farms were collapsed because Mongolia transmitted from socialist to democrat system.
But since 2000, many dairy cow farms are redeveloping in Mongolia. To improve the milking product,
Mongolia is continuing to import a large number of cows from other countries. In this regard, there are
many viral and bacterial diseases diagnosing in cow population. Nowadays it is observed that prevalence
(outbreak) of viral and bacterial (mucous) diseases among highly profitable dairy cattle in Mongolia is
increasing, so that it is necessary to improve diagnostic, fighting and preventative methods for those
diseases as quickly as possible.
Due to transition of Mongolian economy to market economy, dairy cattle farms were privatized,
furthermore control on those diseases was weakened and study of viral & bacterial diseases was
abandoned.
Therefore, we have involved in this study Mongolian dairy cow farms. This study was undertaken to
determine the viral and bacterial diseases in the cow population.
26. MATERIALS AND METHODS
Fig 1. Mongolian map: selected Selenge and Tuv province are in pink shade
Seven organized dairy farms located in northern and central regions of Mongolia which development
dairy farm were identified for this study during the year 2013–2014 (Figure -1).
For serological investigations, a total of 168 cattle serum samples collected from dairy farms for
screening against IBR, Brucellosis, Bovine Paratuberculosis and Bovine Mycobacterium Bovis. All
serum and blood samples were stored at -200C until used for testing. Before performing all tests, all serum
samples heat inactivated at 560C for 30 minutes.
a. Infectious Bovine Rhinotrachetis Virus (IBR)
Antibody ELISA
Diagnosis of IBR was carried out by detection of antibodies against BHV-1 virus from serum by
using CHEKIT- Trachitest Serum- Screening, an ELISA kit from IDEXX Europe, B.V., The Netherlands.
All serum samples heat inactivated at 560C for 30 minutes and diluted 1:2 times in dilution buffer. The
absorbance at 650nm, A(650), is measured using a spectrophotometer. Results are calculated by dividing
the A(650) of the sample by the mean A(650) of the negative control, resulting in an S/N value.
b. Brucelosis
Antibody ELISA
Microplates are coated with Brucella lipopolysaccharide (LPS). Sample to be tested are diluted and
incubated in the wells. Upon incubation of the test sample in the coated wells, Brucella specific Antibodies
214
form immune-complexes with Brucella LPS. After washing away unbound material, an anti-ruminant
Antibody enzyme Conjugate is added which binds to any immune-complex Brucella LPS-Antibody.
Unbound Conjugate is washed away and enzyme Substrate (TMB) is added. In presence of the enzyme,
the Substrate is oxidized and develops a blue compound becoming yellow after blocking. Subsequent
color development is directly is related to the amount of Antibody to Brucella present in the test sample.
c. Bovine Mycobacterium Bovis
Antibody ELISA. The M.bovis antibody test kit is enzyme immunoassay designed to detect the presence
of antibody to M.bovis in bovine serum and plasma samples. A microtiter format has been configured
by coating M. bovis recombinant antigens in the wells of 96-well microtiter plates. Upon incubation of
the test sample in the coated well, antibody to M. bovis forms a complex with the coated antigens. After
washing away unbound material from the wells, anti-bovine; horseradish peroxidase conjugate is added
that binds to any bovine antibody attached in the wells. Unbound conjugate is washed away and TMB
substrate is added. Color development is related to the amount of bound antibodies against M. bovis.
d. Bovine Paratuberculosis
Antibody ELISA
Diagnosis of Bovine Paratuberculosis was carried out by detection of antibodies against Bovine
Paratuberculosis from serum by using ELISA kit from IDEXX Europe, B.V., The Netherlands. All serum
samples heat inactivated at 560C for 30 minutes and samples undiluted.
27. RESULTS
a. Seroprevalence of Infectious Bovine Rhinotrachetis Virus
A total of 168 sera collected from 2 provinces of Mongolia. The samples collected area was shown in
figure 1. The overall seroprevalence for detection of antibodies against Infectious Bovine Rhinotrachetis
virus was 60.7 % (102/168) and six farms had positive samples.
Moreover, the prevalence rates varied greatly in different provinces from 40 % to 94.1 % (Table 1).
b. Seroprevalence of Brucelosis
A total of 168 sera collected from 2 provinces of Mongolia. The overall seroprevalence for detection
of antibodies against Brucelosis was 8.9 % (15/168) and five farms had positive samples. Moreover, the
prevalence rates varied greatly in different provinces from 3.03 % to 23.5 % (Table 1).
c. Serosprevalence of Bovine Mycobacterium Bovis
A total of 168 sera collected from 2 provinces of Mongolia. For the Bovine Mycobacterium Bovis,
none samples were positive. Data was not shown.
d. Serosprevalence of Bovine Paratuberculosis
A total of 168 sera collected from 2 provinces of Mongolia. The overall seroprevalence for detection
of antibodies against Bovine Paratuberculosis was 0.6 % (1/168) only one farm had positive sample
(Table 1).
Table 1
Seroprevalence of infectious bovine rhinotrachetis virus, brucellosis, bovis and bovine paratuberculosis
Positive rates
( %)
Batsumber
Arhust
Total
No. of sera
positive
antibody
Bornuur
Tuv
Altangerel
Suhbat
Bayanmumh
Altai
Tsetsgee
Lhagvaa
Nuudelchin
Positive rates
( %)
Bayangol
No. of sera
positive
antibody
Selenge
Name of farms
Positive rates
( %)
Name of
Sum
Bovine Paratuberculosis
No. of sera
positive
antibody
Provinces
Bovine Brucelosis
No. of sera
tested (heads)
Bovine Rhinotrachetis
20
33
17
25
25
25
23
168
9
25
16
20
15
17
102
40
75.7
94.1
80
60
68
60.7
1
4
5
3
2
15
3.03
23.5
20
12
8
8.9
1
1
4
0.6
28. DISCUSSION. In organized dairy farms, high economic losses are attributed mainly due to
reproductive disorders, caused by infectious agents like IBR, Brucelosis, Bovine Mycobacterium Bovis
and Bovine Paratuberculosis etc. Hence, in the present of abortions were screened against the diseases,
bovine brucellosis and IBR, so as to pinpoint a disease control strategy.
Study of IBR in Mongolia was performed by Mongolian scientist Purevtseren. B in 1989. In 1988–
1989, Antibody detection test (Virus neutralization assay) for Bovine rhinotracheitis was carried out on
215
1713 bovine blood samples from 22 farms and 614 (35.8 %) of them were positive [Purevtseren et all].
Since that time, study on IBR (Infectious bovine rhinotracheitis) hasn’t been done. As a result of our
study, Antibody detection test result for Bovine rhinotracheitis is 60.7 % (102/168) which is higher than
previous study, and it shows that prevalence of this disease seems to be increased.
Besides, Mongolia is considered to be the country where Bovine and human Brucelosis infection
is high. Particularly, prevalence of bovine brucellosis higher than the sheep [Batbaatar et all]. Human
population has big risk to be infected through semi-processed dairy products. As a result of our study,
prevalence of bovine brucellosis is 8.9 % (15/168) and our result is correlated to other researchers study
result, IVM (Institute of Veterinary Medicine), Mongolia (2010–2012). In the study of researchers above,
prevalence of bovine brucellosis in western provinces was 10–15 % [Zolzaya et all].
On the other hand, in Mongolia last incidence of Bovine Mycobacterium Bovis and Bovine
Paratuberculosis were diagnosed in 1980, and these 2 diseases haven’t been diagnosed again yet
[Damdin et al.]. In our study, Bovine Mycobacterium Bovis isn’t detected, while prevalence of Bovine
Paratuberculosis is 0.6 % (1/168), which should be retested and confirmed.
Acknowledgments. I would sincerely like to thank my supervisor Zhou Wei Guan and Laboratory of
Virology staffs and sstudents especially Mr. Zang Fan, Zang Zie Fei, Ms. Xue Lei for their best guidance
in virology, Inner Mongolian Agriculture University Veterinarian Medicine Faculty.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
Bhavesh Trangadia., Samir Kumarb Rana., Falguni Mukherjee., Villuppanoor Alwar Srinivasan. 2010.
Prevalence of brucellosis and infection bovine rhinotracheitis in organized dairy farms in India. Trop Anim
Health Prod. 42; 203–207.
D-H. Lee., S-W. Park., E-W. Choi., C-W. Lee. 2011. Investigation of the prevalence of bovie viral diarrhea
virus in dairy cows in South Korea.The Veterinary Record. 162, 211–213
Francisco J. Dieguez., Eduardo Yus., Maria J. Sanjuan., Ignacio Arnaiz. 2009. Effect of the bovine viral
diarrhea virus (BVDV) infection on dairy calf rearing. Research in Veterinary Science. 87, 39–40.
H. Guarino., A. Nunez., M.V. Repiso., A. Gil., D.A. Dargatz. 2008. Prevalence of antibodies to bovine
herpesvirus-1 and bovine viral diarrea virus in beef cattle in Uruguay. Preventive Veterinary Medicine. 85,
34-40
Jaruwan Kampa., Stefan Alenius., Ulf Emanuelson., Aran Chanlun., Suneerat Aiumlamai., 2009. Bovine
herpesvirus type 1(BHV-1)and bovine viral diarrhea virus (BVDV) infections in dairy herds; Self clearance
and the detection of seroconversions against a new atypical pestivirus. The Veterinary Journal. 223–230.
K. Raaperi., I. Nurmoja., T. Orro., A. Viltrop. 2010. Seroepidemiology of bovine herpesvirus 1 (BHV-1)
infection among Estonian dairy herds and risk factors for the spread within herds. Preventive Veterinary
Medicine. 96, 74–81.
Michal Czopowicz., Jaroslaw Kaba., Horst Schirrmeier., Emilia Bagnicka., Olga Szalus- Jordanow., et all.
2011. Serological Evidence for BVDV-1 infection in goats in Poland- Short communication. Acta Veterinaria
Hungarica. 59, 399–404.
Perenlei.L. 1988. Cell Culture. Book. Mongolian. p-37–85
Purevtseren Baymba.1988. Serosurveillance of Bovine rhinotracheitis, Mongolia. Sodnomdarjaa.R.,
Tserenchimed.S., Batamgalan.H., et all. 2014(8) SCVL- Proceedings . p-57–128.
S. Julia., M.I. Craig., L.S. Jimenez., G.B. Pinto., E.L. Weber. 2009. First report of BVDV circulation in sheep
in Argentina. Preventive Veterinary Medicine. 90, 274–277.
Tsegmed.G. 2000. Animal infection disease, Mongolian. Book. p-283-323
Yan,B.F., Chao,Y.J., Chen, Z., et all. 2008. Serological survey of bovine herpesvirus type 1 infection in China.
Vet of microbiology. 127, 136–141
Zolzaya.B., Selenge.T., Narangarav.T., Gantsetseg.D., Erdenechimeg.D., et all. 2014. Representative
seroprevalences of human and livestock brucellosis in two Mongolian provinces. Ecohealth. 356–71.
SOME RESULTS OF THE STUDY ON ANITBIOTIC STUDY
ON ANTIBIOTIC-LIKE ACTION OF MUMIE
LKHAGVASUREN N., ENKHOYUN T., DOLGORSUREN TS., NARANGEREL B.,
Institute of Veterinary Medicine, Mongolian University of Life, Sciences, Ulaanbaatar,
Mongolia, e-mail: Lkhagva.vet@gmail.com
ABSTRACT
Mumieis mostly used during various cutaneous conditions including purulent dermatitis, wounds,
burns and boil and many digestive organ inflammatory diseases in practice of traditional ethno-medicine.
Therefore, the antibacterial effect of mumie was investigated. For the present study, mumie extractions
216
diluted at ratios 1:1, 1:5 and 1:10, as well as 0.5 and 1.0 million CFU of E.coli and S.aureus cultures
respectively were used. Mumie extractions diluted at ratios 1:1, 1:5 and 1:10 inhibited S. aureus resulting
in formation of 11–16 mm zone, whereas they had no effects on E.coli cultures.
Key words: E.coli, S. aureus, colony, mumie
INTRODUCTION
Natural complex substance called “mumie” (baragshun) distributed across all mountainous areas
of Asia was discovered and used by human beings 3000 years ago.
In ”Jud Shi” (Four Principles
of Medicine) it was written that mumie was both orally and topically used for curing inflammatory
diseases of liver, kidney and stomach, various sepses, open wounds and other types of inflammations.
Therefore, one of the important issues of current period is to investigate the whether Mongolian
mumieexerts antibacterial therapeutic effects on inflammatory diseases of skin and visceral organs.
In order to study antibiotic-like effect of mumie against bacteria the following objectives were
accomplished:
To count bacteria in the study with colony forming units on solid nutrient media and determine the
virulence in white mice;
To determine antibiotic-like effect of mumieagainst bacteria by using cultures of both S.aureus,
whichproduces pus and E.coli, whichcauses food intoxication.
MATERIALS AND METHODS
Samples of mumie collected from Khovdaimag in western region of Mongolia were used in the study.
Cultures of both S.aureus, which produces pus and E.coli, which causes food intoxication were employed
in the present study.
Before measuring antibacterial activity, growth rate, cultuvability, morphology, size and stainability of
the cultures were determined by use of enriched nutrient media, and Gram stain.
Both pathogenicity and virulence of both bacteria were determined in white mice, and count of bacteria
in CFU on solid nutrient media.
We following methods were used for the study:
Sterility of mumie sample was tested on 4 types of both liquid and solid nutrient media according to
conventional microbiological methods.
Fifty microliter of each solutions of mumie diluted at the ratios 1:1, 1:5 and 1:10 was added into
prepared sterile disc and dried in sterile room.
Pathogenic bacteria of 2 mln, 1 mln and 0.5 mln CFU were added onto TSA in Petri dish used for
sterility test and evenly spread on the medium.
After becoming the surface of the medium slightly dried, discs on which mumie extracts at certain
dilutions were absorbed, were placed in Petri dish estimated to be 6 discs per dish.
Results were obtained by incubation of Petri dishes with nutrient medium on whichmumiediscs were
placed, at 370C for 24 hours.
RESULTS
Results of counting bacteria with colony forming units and virulence testing Antibiotic-like effect of
mumiewas investigated in cultures of S.aureus and E.coli, which are selected in the present study.
Cultivation of the bacteria in liquid and on solid nutrient media to be used for the study demonstrated
that pathogenic bacteria chosen in our study have their own characteristics in broth, solid and selective
nutrient media(Photos 1and 2).
To count the bacteria with colony forming unit, bacterial stock culture diluted at 1:10 ratio was
inoculated on solid nutrient medium, and number of grown colonies are then counted.
Photos 1 and 2. Growth of S.aureus in liquid and on solid nutrient media
217
Virulence of the cultures was determined my intraperitoneal injection of laboratory white mice
(table 1).
Table 1
Results of bacterial colony count and virulence determination
1.
2.
Variables
Bacterial colony count
VirulenceLD50
S.aureus
5mln CFU
320 mln CFU
E.coli/ETEC/
5 bln CFU
500 mln CFU
Photo 3. Injection of white mice with bacterial culture
Results of study on effect of purified mumie against S.aureus
The following results were obtained when effect of mumie was tested in several replicates against
S.aureus according to the method (Table 2).
Results of experiments in several replicates show extracts of mumie diluted at 1:5 and 1:10 ratios
suppress the growth of 1 mln CFU S.aureus culture causing 11–16 mm zone (Photo 4).
Photo 4.Supression of S.aureus growth by mumie causing the zone
Results of study on effect of purified mumie against E.coli
Effect of mumie preparation against E.coli was studied as described in the method. Results of the
repeated experiments show no any effect against E.coli.
218
Table 2
Effect of mumie against bacteria
ʋ
Dilutions of mumie preparation
1.
2.
3.
1:1
1:5
1:10
St.aureus
1 mlnCFU
14 mm
12 mm
14 mm
E.coli
500,000 CFU
16 mm
15 mm
16 mm
10–4
-
10–5
-
CONCLUSION
Effect of purified mumie causing 11 to 16 mm inhibition zone suppressing the growth of S.aureus
demonstrates that mumie is possible to be used for curing various wounds.
Purified mumie has no any effect against E.coli.
REFERENCES:
1.
2.
3.
4.
5.
6.
7.
8.
Nuraliev Y.,Denisenko H. Mumie and its medicinal properties. Dushanbe, 1997.
Madjidov. M.N et al. Mumie- stimuli’s and regenerative. Tashkent. 1989.
G.GɚnbɚɚtɚrHealingPower of Mumie.UB 1998
Igor Schepetkin, Andrei Khlebnikob and Byoung Se Know. Medical Drugs from humus matter: Focus on
Mumie. J. Drug development research. 2002. 140–159.
Anna Aiello, ErnestoFattorusso and Werner E. G. Müller.Mumijo Traditional Medicine: Fossil Deposits from
Antarctica (Chemical Composition and Beneficial Bioactivity)
EnkhOyun T. Using pure native mineral compounds as mumie in veterinary practice”. Report of project.
“Training of rural development” project Funded by CIDA. 2007.
Manual of Standards for Diagnostic Tests and Vaccines
National Committee for Clinical Laboratory standards. (1993) Performance Standards for Antimicrobial
Disk
SOME RESULTS OF EMBRYO TRANSFER IN MONGOLIAN
SHEEP AND GOATS
OTGONJARGAL S. AND GANBAT S.,
School of veterinary medicine and biotechnology, Mongolian University of Life Sciences,
Ulaanbaatar, Mongolia
Abstract:
Thestudyaims at transfer of embryos from Suffolk breedbred in Mongolia in native Mongolian sheep.
Fresh embryos flushed from pure Suffolk sheep super ovulated were transferred to local recipient ewes.
Totally 39 embryos from 8 donor pure breed sheep were flushed and transferred to recipients.
Key words: Suffolk sheep. Embryo transfer, donor and recipient ewes
Introduction
As results of animal reproduction biotechnology development, embryo transfer in farm animals to
enable easier adaptation of high productive breeds and strains created in the place to conditions in other
ones and rapid growth of superior sires or dams for short time.
The technology for embryo transfer enables to rapid multiplication of genetically superior sires and
dams. So that it leads to creation of dam line with high productivity and rapid reproduction of rare animals
/ Ɇɫɤɟlvɟɭ 1985/.
Conventional selection method with embryo transfer enables to increasing the selection intensity
shortening generation interval and good selection response. /Russel 1989/.
Warwick Bewy (1932) firstly reported on embryo transfer in sheep and Orlache (1933) obtained first
kids by embryo transfer. Mutter /1964/ and Sugie /1965/ reported on successful nonsurgical embryo
transfer.
Government of Mongolia supports the scientific projects on frozen embryo transfer of foreign high
productive animals in local ones. As result of this, it is possible to create high productive and good
adapted animals to harsh condition of the country by embryo transfer.
Material and methods
The experimental work was done based on animal reproduction and biotechnology laboratory of
Research Institute of Animal Husbandry and department of animal surgery and reproduction biology
219
of School of Veterinary medicine and biotechnology including sheep farm located in Zuunburensoum,
Selengeaimag of Arvin khurCo.LTD.
Pure Suffolk breed ewes obtained by transfer of frozen embryos imported from China were selected
as donors and local Mongolian ewes as recipients. Progesterone sponge (CIDR) were inserted into vulva
of donors and recipients for their estrus synchronization during 12 days. Donor ewes were administrated
2 ml of FSH with 12 hours interval during 4 days, using dose decreasing procedure after their sponge
removalDonor and recipient ewes in heat were determined by vasectomed rams within 24–96 hours after
sponge removal. Donor ewes in estrus were inseminated by fresh semen using laparoscopy. On 5-6th day
after insemination, from uterine horn of donor ewes were flushing embryos. Embryos graded as very
good and good were transferred to recipient ewes.
Results
All donor ewes and 97.5 % of recipient ewes were in estrus synchronization Table 1. After estrus
synchronization of donor and recipients, the donor ewes were administrated FSH for their super
ovulation.
Table 1
Results of estrus synchronization in donor and recipient ewes
Donor ewes
Recipient ewes
No. of animals inserted sponge
8
120
No. of animals in estrus
8
117
%
100
97.5
Totally 73 follicles were observed in 8 donor ewes and 39 embryos (53.4 %) were flashed by surgical
method Table 2. Table 3. shows morphological evaluation of embryos. By morphological evaluation, total
30 embryos in morula stage were graded as follows: very good – 25, good- 5, and 9 embryos in blastocyst
stage: very good -4, good- 5.
Embryos graded as very good and good were transferred to uterine horn of 39 recipient ewes by
surgical method.
Figure 1. Procedure on embryo flushing, evaluation and transfer
220
Table 2
Some results of super ovulation in donor ewes
Number of embryos flushed
ʋ
Follicles observed
1
2
3
4
5
6
7
8
Total
Right horn
n
6
2
7
5
3
2
1
1
27
12
9
16
9
8
9
6
4
73
Left horn
%
100
50
70
100
60
40
33
33
n
2
3
2
3
2
12
Total
%
50
30
40
60
66
-
6
4
10
5
5
5
3
1
39
Table 3.
Morphological evaluation of embryos flushed
n
Stages
Morula
Blastocyst
Total
Number
30
9
39
Evaluation
Good
Very good
n
25
4
29
%
83.3
44.4
74.3
n
5
5
10
%
16.7
55.5
25.0
Satisfactory
n
-
%
-
Discussion
One of important stage for the embryo transfer procedure is preparation of recipient animals. For estrus
synchronization of recipient animals, are used hormones named progesterone and prolactin separately
and together of them.
Prof. N.Altankhuyagreported that use of progesterone sponge for estrus synchronization of recipient
does for 15–20 days during mating season leads to estrus of 95.7 % of them within 24-36 hours.
Some researchers found that prostaglandin enables to estrus on 80 % of recipient animals on 7–12
days of estrus cycle (Altankhuyag and Begzjav, 1989, Bolikhorloo and others 1994).
Result of our study is in good agreement with findings of above mentioned scientists.
Researcher Altankhuyag/1994 / reported that progesterone+FSH variant from 7 variants has more
positive effect on corpora lutea formation including flushing 12.7 embroys from 16 follicles on average
during one estrus cycle.
We were flushing 39 embryos from 73 follicles. Our results are not so good in comparison with that of
Dr.Altankhuyag N. It is may be connected with some errors in embryo flushing.
Conclusions
1.Progesterone sponge are suitable for estrus synchronization of both donor and recipient animals.
2. FSH can be used for super ovulation of pure Suffolk ewes under grazing condition. 3. Embryos
flushed on 5-6th days have good quality.
Literature:
Altankhuyag N. Experimental results of embryo transfer in mongolian goats. Abstract of PhD degree
dissertation. UB, 1994.
Bolikhorloo D. Altankhuyag N. Begzjav N. and Yanjinsuren D., Research report on embryo transfer
trail in goats. UB, 1990.
Khugjilt B., Some experimental study on embryo transfer technology in animal production. PhD
degree dissertation 2007.
GurjavKh. Intensified reproduction in farm animals. Veterinary medicine of Mongolia. 1998, ʋ4,
24–26
Otgonjargal S., Some results of embryo transfer in goat and sheep. Bachelor degree work. UB, 2012.
221
PREDOMINANCE OF CANINE PARVOVIRUS TYPE 2B IN DOGS
OF ULAANBAATAR CITY
TUMENJARGAL. SH., CHIMEDTSEREN B., ARIUNAA TS., TUNGALAG CH.,
Veterinary School, Mongolian University of Life Sciences Zaisan-53, Khan-Uul district,
Ulaanbaatar, Mongolia, tumee@muls.edu.mn
Abstract
Canine parvovirus is highly contagious and fatal disease of dogs, causing acute hemorrhagic enteritis
and myocarditis. The aim of this work is to detect canine parvovirus 2 (CPV-2) by standard polymerase
chain reaction (PCR). Viral DNA was isolated from faecel samples of 36 puppies with suspicious symptoms
for parvovirus infection and used as template in standard PCR. 23 samples were of CPV-2b serotype, 9
samples of CPV-2a serotype but 4 samples were neither 2b and nor 2a. We used two different primer sets,
one specific both serotypes CPV-2a and CPV-2b and one specific only for CPV-2b. This allowed us to
differentiate the serotypes from each other. The further extension of this work will be essential for the
epidemiology, viral evolution and phylogenetic studies of the mongolian domestic canine, cats and wild
carnivores.
Key words: canine parvovirus (CPV), bloody diarrhea, hemorrhagic enteritis, myocarditis, polymerase
chain reaction (PCR)
Introduction
Canine parvovirus 2 (CPV-2) is a highly contagious, often fatal disease, characterized by vomiting
and hemorrhagic gastroenteritis in dogs of all age (1), and mycarditis and subsequent heart failure in
pups of less than 3 months of age (2). Canine parvovirus 2, so named to differentiate it from CPV-1, the
genetically and antigenically distinct minute virus of canines, is a small, nonenveloped, single-stranded
DNA virus (1). Canine parvovirus 2, along with Feline panleukopenia virus (FPV), Raccoon parvovirus
(RPV), and Blue fox parvovirus (BFPV), comprise the Feline parvovirus (FPV) subgroup of the genus
Parvovirus. CPV-2 emerged in 1978 as the cause of new disease in dogs throughout the world, when
it rapidly spread in domestic dog populations as well as wild dogs with high morbidity (100 %) and
frequent mortality up to 10 % (1, 2).
The main source of infection is the feces of infected dogs containing large numbers of virus particles
(109 virus particles/g of faeces) that excreted in the faeces. Between 1979 and 1981 the original (1978)
strain of the virus (CPV-2) had been replaced by a genetically and antigenically variant strain termed CPV2a (5). The two viruses differ in 5-6 amino acids, which constitute two different neutralizing antigenic
sites on the surface of the capsid. In 1984, a further antigenically variant virus was detected which differ
in only a single epitope, designated as CPV-2b (6).The CPV-2, a non-enveloped virus with an approximate
diameter of 20 nm, is a member of the genus Parvovirus of the family Parvoviridae.
Materials and Methods
The faecal samples were collected from 36 dogs came to Veterinary hospital (Ulaanbaatar, Sukhbaatar
district) between March-June/ 2013 that showing the symptoms of fever, diarrhoea or hemorrhagic
diarrhoea and vomition, clinically suspected for CPV infections. The faecal samples were collected by
rectal disposable swab, and directly transferred in ice to the laboratory of Veterinary School for strategic
studies and scientific researches, stored at (-20°C) until the DNA was extracted. A commercially available
inactivated vaccine was used as a positive control of CPV and a stool sample from a healthy dog processed
similarly was used as a negative control. The viral DNA was extracted from fecal sample using Genomic
DNA extraction kit (Intron Biotech, Korea) according to the manufacturer’s protocol.
The PCR was standardized for the primer set CPV-2ab and CPV-2b, as designed under the scientific
standards in primer designing with slight modifications. The details of primers are given in Table 1.
The PCR reaction mixture contained 100 ȝM dNTPs, 10 pmol of each primer, 1X PCR reaction mixture
containing 12.5 mM MgCl2 and 2 ȝL of processed sample as source of template DNA. Amplification was
performed in a thermocycler (AppliedBiosystems). 1 ȝL of DNA polymerase (1 IU/ȝL) was added to
above reaction mixture after initial denaturation was done at 95°C for 5 min in the thermocycler. The
cyclic condition was denaturation at 95°C for 1 min, primer annealing at 55°C for 2 min and extension at
72°C for 0.5 min. The cyclic condition was repeated for 30 times and a final extension at 72°C was given
for 10 min. After PCR, the amplified products were analyzed on 1.0 % agarose gel containing ethidium
bromide to a final concentration of 0.5 ȝg/mL. 10 ȝL of amplified product was loaded into the well and
run along with 100 bp to 1 Kbp DNA ladder in 1X TBE electrophoresis buffer at 5 volts/cm2 and the
progress of mobility was monitored by migration of dye. At the end of the electrophoresis, the gel was
visualized under the UV transilluminator.
222
Table 1.
Details of primer sets
Forward and reverse
primers
Primer sequence
ɇɉȼ-2ab (F)
ɇɉȼ-2ab (R)
5’-GAAGAGTGGTTGTAAATAATT-3’
5’-CCTATATAACCAAAGTTAGTA-3’
ɇɉȼ -2b (F)
ɇɉȼ -2b (R)
5’-CTTTAACCTTCCTGTAACAG-3’
3685-3706
4043-4062
5’-CATAGTTAAATTGGTTATCTA-3’
4449–4470
Position in genome
Annealing
temperature and
product size
3025-3045
55 C
681bp
55 C
427bp
Results and discussion
In the present study, PCR was carried out on 36 stool samples collected from CPV suspected dogs
and used as template to amplify the VP2 structural gene of CPV genome. Of the 36 stool samples from
the suspected cases of CPV infections, 23 were found to be positive by CPV-2b primer set, whereas all
of them are amplified by CPV-2ab primer set. The CPV-2ab primer set amplified portion of VP2 gene of
both CPV-2a and CPV-2b variants (3025 to 3706 nucleotide position of CPV genomic DNA) to yield a
product size of 681bp (Fig.1).
The CPV-2b primer pair amplified specific portion VP2 gene of only CPV-2b (4043 to 4470 nucleotide
position of CPV genomic DNA) to yield a product size of 427bp and thereby differentiate between CPV2a and CPV-2b (Fig. 1). So the results showed that out of 36 samples 23 were of CPV-2b variant, while
9 were CPV-2a strain.
But 4 samples showed an amplicon with neither CPV-2ab nor CPV-2b primers which indicate these
samples don’t have this serotypes or no CPV.
Figure 1. Picture of PCR amplicons and 100bp standard
Table 2
PCR results, + indicate presence of a PCR band , – indicate absence of a PCR band
sample
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
CPV-2b
+
+
+
+
+
+
+
+
+
+
CPV-2ab
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
sample
19
20
21
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
CPV-2b
+
+
+
+
+
+
+
+
+
+
+
+
+
CPV-2ab
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
+
223
Canine parvovirus infections have been emerged as the most important killer disease of pups in recent
time as it causes vomiting, myocarditis and hemorrhagic gastroenteritis (9). Although adult dogs show less
severe symptoms of gastroenteritis, the dogs serve as a source of infection. Due to its immunosuppressive
nature, CPV decreases the animal’s ability to fight against infections (10). After emergence of the CPV-2,
two more mutants, namely CPV-2a and CPV-2b, have been reported and completely replaced the original
strain (CPV2) around the world (4). Decaro (11) identified different variants of CPV circulating in dog
population in Spain. Truyen (12) studied that CPV-2a and CPV-2b have almost completely replaced the
original CPV2 in canine population in Germany. Pereira (8) reported that the predominant strain found
in Brazil during 1980 was CPV-2a and CPV-2b during 1990–1995. Wang (13) reported both antigenic
types CPV-2a and CPV-2b prevailing in Taiwan. Battilani (14) showed that both antigenic types 2a and
2b co-exist in canines in Italy.
The commercial available rapid diagnostic kits for CPV can’t distinguish the virus serotypes but often
used for rapid routine diagnosis. Ts. Ariunaa analyzed more than 100 canine faeces with CPV-rapid
diagnostic test 2011 which resulted in high infection rate (15).
This study is the first one carried out CPV-specific PCR in Mongolia, thus, PCR technique can be
adopted to diagnose rapidly, reproducibly and accurately the CPV infections. Further, different antigenic
variants of CPV can also be differentiated by employing PCR with different combination of primer sets.
From the present study, it is inferred that CPV-2b is more prevalent in dog population in Ulaanbaatar
city as revealed in PCR based diagnosis. So, necessary measures should be taken to control the disease in
dogs by incorporating the indigenous strain of CPV in the preparation of vaccine.
Acknowledgement
Authors thank the veterinarian Mr. Munkhbaatar of “Jonon” Veterinary Clinic for sample collection.
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
224
Appel,MJ .; Scott, FW.and Carmichael, LE. (1979).Isolation and immunization studies of a canine parvo-like
virus from dogs with hemorrhagic enteritis, Vet. Res., 105: 156–159.
Kelly, WR.and Atwell R B, (1979). Diffuse subacute myocarditis of possible viral etiology: A cause of sudden
death in pups. Aust. Vet. J., 55: 36-37.
Parrish, C. R.; O’Connell, P. H.;Evermann, J. F.andCarrmichael, L. E.(1985).Natural variation of canine
parvovirus. Science, 230: 1046–1048.
Parrish, C. R.;Aquadro, C. F.and Carmichael, L. E.(1988).Canine host range and a specific epitope map along
with variant sequences in the capsid protein gene of canine parvovirus and related feline mink and racoon
parvoviruses. Virology, 166: 293-307.
Ali, M. H.(2009). Detection and isolation of Canine Parvovirus in Iraq, MSc. thesis Baghdad, University of
Baghdad.
Sambrook, J.and Russell, D. W.(2001). Molecular cloning: A laboratory manual. 3rd ed. Cold Spring Harbor
laboratory Press, New York.
Nandi, S.;Pandey, A. B.; Sharma, K.andChauhan, R. S. (2008). Polymerase chain reaction for the detection of
canine parvoviral DNA in vaccines. Indian J.Virol, 19: 9–11.
Schunck, B.; Kraft, W.andTruyen, U. A. (1995). Simple touch-down polymerase chain reaction for the
detection of canine parvovirus and feline panleukopenia virus in feces. J.Virol.Methods, 55: 427–33.
Pereira, C. A.;Monezi, T. A.; Mehnert, D. U.;D’Angelo, M.andDurigon, E. L. (2000). Molecular characterization
of canine parvovirus in Brazil by PCR. Vet.Microbiol., 75:127–133.
Legendre, A. M.(2000). Parvovirus in dog in Text book of veterinary internal medicine. Diseases of the dog
and cat.Vth ed. S J Ettingerand E C Feldman (W B Saunders Co., Philadelphia, USA.,pp: 1958.
Decaro, N.;Martella, V.;Desario, C.;Bellaciccio, A. L.;Camero, M.(2006). First detection of canine parvovirus
type 2c in pups with haemorrhagic enteritis in Spain. J. Vet. Med., 53: 468–472.
Truyen, U.;Platzer, G.and Parrish, C. R.(1996). Antigenic type distribution among canine parvoviruses in dogs
and cats in Germany. Vet. Rec., 138: 365-366.
Wang, H. C.; Chen, W.D.;Lin, S. L.; Chan, J. P.and Wong, M. L. (2005). Phylogenetic analysis of canine
parvovirus VP2 gene in Taiwan. Virus Gene., 31: 171–174.
Battilani, M.;Scagliarini, A.;Tisato, E.;Turilli, C.andJacoboni, I.(2001). Analysis of canine parvovirus
sequences from wolves and dogs isolated in Italy. J. Gen.Virol., 82: 1555–1560.
Ariunaa Ts. (2010). Diagnostic and spreads of canine parvovirus in the UB city. Mongolian Journal of Infectious
Disease 6, pp27
ɍȾɄ 636.082.42
ɂɋɄɍɋɋɌȼȿɇɇɈȿ ɈɋȿɆȿɇȿɇɂȿ ɄɈɊɈȼ
ɂ ɌȿɅɈɄ ɆəɋɇɈȽɈ ɇȺɉɊȺȼɅȿɇɂə
ȺɅɂɆȻȺȿȼ Ɇ.Ʉ., ɌȺɀɂȻȺȿȼ ɀ.Ʉ.,
ɌɈɈ «ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ», ɚ. Ȼɟɫɤɨɥɶ, Ʉɚɡɚɯɫɬɚɧ, ɟ-mail: sevɤaz_agroinnov@inbox.ru
Ɉɞɧɢɦ ɢɡ ɤɥɸɱɟɜɵɯ ɧɚɩɪɚɜɥɟɧɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɩɪɨɝɪɚɦɦɵ ɪɚɡɜɢɬɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ
ɢ ɪɟɝɭɥɢɪɨɜɚɧɢɹ ɪɵɧɤɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɹɜɥɹɟɬɫɹ ɫɬɪɚɬɟɝɢɹ ɪɚɡɜɢɬɢɹ ɦɹɫɧɨɝɨ
ɫɤɨɬɨɜɨɞɫɬɜɚ ɜ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ.
Ɉɞɧɢɦ ɢɡ ɫɞɟɪɠɢɜɚɸɳɢɯ ɮɚɤɬɨɪɨɜ ɜ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɪɚɡɜɢɬɢɹ ɦɹɫɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɧɚɲɟɣ ɨɛɥɚɫɬɢ ɹɜɥɹɟɬɫɹ ɧɟɞɨɫɬɚɬɨɱɧɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɜɫɟɯ ɜɨɡɦɨɠɧɨɫɬɟɣ ɜ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɟ ɫɬɚɞɚ.
ɉɪɢ ɷɬɨɦ ɧɟɨɛɯɨɞɢɦɨ ɨɫɨɛɨɟ ɜɧɢɦɚɧɢɟ ɭɞɟɥɢɬɶ ɩɪɨɛɥɟɦɟ ɩɟɪɟɯɨɞɚ ɧɚ ɢɫɤɭɫɫɬɜɟɧɧɨɟ ɨɫɟɦɟɧɟɧɢɟ,
ɥɢɤɜɢɞɚɰɢɢ ɛɟɫɩɥɨɞɢɹ ɢ ɹɥɨɜɨɫɬɢ, ɢɡ-ɡɚ ɱɟɝɨ ɢɞɟɬ ɧɟɞɨɩɨɥɭɱɟɧɢɟ ɦɨɥɨɞɧɹɤɚ, ɚ ɩɨɥɭɱɟɧɧɵɣ ɜ
ɛɨɥɶɲɢɧɫɬɜɟ ɫɜɨɟɦ ɢɦɟɟɬ ɧɢɡɤɭɸ ɩɥɟɦɟɧɧɭɸ ɰɟɧɧɨɫɬɶ. ȼ ɦɹɫɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ ɞɨ ɫɢɯ ɩɨɪ ɢɫɩɨɥɶɡɭɸɬɫɹ ɛɵɤɢ-ɩɪɨɢɡɜɨɞɢɬɟɥɢ, ɬɨɝɞɚ ɤɚɤ ɫɬɪɚɧɵ ɫ ɪɚɡɜɢɬɵɦ ɦɹɫɧɵɦ ɫɤɨɬɨɜɨɞɫɬɜɚɦ ɩɟɪɟɲɥɢ ɧɚ
ɢɫɤɭɫɫɬɜɟɧɧɨɟ ɨɫɟɦɟɧɟɧɢɟ.
Ɉɞɧɢɦ ɢɡ ɧɚɩɪɚɜɥɟɧɢɣ ɢɧɧɨɜɚɰɢɨɧɧɨɝɨ ɪɚɡɜɢɬɢɹ ɜ ɚɝɪɚɪɧɨɣ ɫɮɟɪɟ ɹɜɥɹɟɬɫɹ ɨɪɝɚɧɢɡɚɰɢɹ ɦɚɫɫɨɜɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɝɨɜɹɞɢɧɵ. Ɋɚɡɜɢɬɢɟ ɦɹɫɧɨɝɨ ɫɤɨɬɨɜɨɞɫɬɜɚ – ɨɞɧɨ ɢɡ ɭɫɥɨɜɢɣ
ɭɜɟɥɢɱɟɧɢɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɜɵɫɨɤɨɤɚɱɟɫɬɜɟɧɧɨɣ ɝɨɜɹɞɢɧɵ.
ɉɨɜɵɲɟɧɧɵɣ ɢɧɬɟɪɟɫ ɤ ɦɹɫɧɨɦɭ ɫɤɨɬɨɜɨɞɫɬɜɭ ɡɚ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɨɛɨɡɧɚɱɢɥ ɩɨɡɢɬɢɜɧɭɸ ɬɟɧɞɟɧɰɢɸ ɪɨɫɬɚ ɱɢɫɥɟɧɧɨɫɬɢ ɦɹɫɧɨɝɨ ɫɤɨɬɚ ɧɚɢɛɨɥɟɟ ɜɨɫɬɪɟɛɨɜɚɧɧɵɯ ɩɨɪɨɞ (ɚɛɟɪɞɢɧ-ɚɧɝɭɫɫɤɨɣ,
ɝɟɪɟɮɨɪɞɫɤɨɣ), ɚ ɬɚɤɠɟ ɚɤɬɢɜɧɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɨɬɟɱɟɫɬɜɟɧɧɵɯ ɩɨɪɨɞ (ɤɚɡɚɯɫɤɨɣ ɛɟɥɨɝɨɥɨɜɨɣ).
Ʉɚɤ ɢ ɜ ɞɪɭɝɢɯ ɨɬɪɚɫɥɹɯ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ, ɧɚɢɛɨɥɟɟ ɩɪɨɝɪɟɫɫɢɜɧɵɦ ɦɟɬɨɞɨɦ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ
ɫɬɚɞɚ ɜ ɦɹɫɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ ɹɜɥɹɟɬɫɹ ɢɫɤɭɫɫɬɜɟɧɧɨɟ ɨɫɟɦɟɧɟɧɢɟ. Ɉɧɨ ɩɨɡɜɨɥɹɟɬ ɛɨɥɟɟ ɢɧɬɟɧɫɢɜɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɥɭɱɲɢɯ ɛɵɤɨɜ ɢ ɩɨɥɭɱɚɬɶ ɨɬ ɧɢɯ ɛɨɥɶɲɨɟ ɤɨɥɢɱɟɫɬɜɨ ɩɨɬɨɦɤɨɜ – ɞɨ ɧɟɫɤɨɥɶɤɢɯ
ɬɵɫɹɱ ɝɨɥɨɜ ɜ ɝɨɞ.
ɂɫɤɭɫɫɬɜɟɧɧɨɟ ɨɫɟɦɟɧɟɧɢɟ ɹɜɥɹɟɬɫɹ ɝɥɚɜɧɵɦ ɡɨɨɬɟɯɧɢɱɟɫɤɢɦ ɦɟɬɨɞɨɦ ɢɧɬɟɧɫɢɜɧɨɝɨ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɫɟɥɟɤɰɢɨɧɧɨ-ɩɥɟɦɟɧɧɨɣ ɪɚɛɨɬɵ, ɬɚɤ ɤɚɤ ɨɞɧɢɦ ɢɡ ɝɥɚɜɧɵɯ
ɟɝɨ ɞɨɫɬɨɢɧɫɬɜ ɹɜɥɹɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ ɲɢɪɨɤɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɨɫɨɛɟɧɧɨ ɰɟɧɧɵɯ ɩɪɨɢɡɜɨɞɢɬɟɥɟɣ,
ɜɥɢɹɧɢɟ ɤɨɬɨɪɵɯ ɩɪɢ ɟɫɬɟɫɬɜɟɧɧɨɦ ɫɩɚɪɢɜɚɧɢɢ ɧɟ ɨɱɟɧɶ ɜɟɥɢɤɨ.
ɇɨ ɩɪɟɢɦɭɳɟɫɬɜɚ ɷɬɨɝɨ ɦɟɬɨɞɚ ɜ ɩɨɥɧɨɣ ɦɟɪɟ ɩɪɨɹɜɥɹɸɬɫɹ ɬɨɥɶɤɨ ɩɪɢ ɩɪɨɜɟɞɟɧɢɢ ɜ ɤɨɦɩɥɟɤɫɟ
ɜɫɟɯ ɡɨɨɬɟɯɧɢɱɟɫɤɢɯ, ɜɟɬɟɪɢɧɚɪɧɵɯ ɢ ɯɨɡɹɣɫɬɜɟɧɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ, ɩɪɢ ɩɨɥɧɨɰɟɧɧɨɦ ɤɨɪɦɥɟɧɢɢ,
ɯɨɪɨɲɟɦ ɭɯɨɞɟ ɢ ɫɨɞɟɪɠɚɧɢɢ, ɧɚɥɢɱɢɢ ɤɜɚɥɢɮɢɰɢɪɨɜɚɧɧɵɯ ɤɚɞɪɨɜ.
ɂɫɤɭɫɫɬɜɟɧɧɨɟ ɨɫɟɦɟɧɟɧɢɟ ɤɨɪɨɜ ɢ ɬɟɥɨɤ ɜ ɦɹɫɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ ɢɦɟɟɬ ɫɜɨɢ ɨɫɨɛɟɧɧɨɫɬɢ.
Ɉɫɟɦɟɧɟɧɢɟ ɠɢɜɨɬɧɵɯ ɩɪɨɜɨɞɹɬ ɫɟɡɨɧɧɨ ɢ ɜ ɛɨɥɶɲɢɧɫɬɜɟ ɯɨɡɹɣɫɬɜ ɜ ɥɟɬɧɢɣ ɩɟɪɢɨɞ. Ɏɟɪɦɵ ɢ ɝɭɪɬɵ ɪɚɫɩɨɥɚɝɚɸɬ, ɤɚɤ ɩɪɚɜɢɥɨ, ɧɚ ɛɨɥɶɲɢɯ ɪɚɫɫɬɨɹɧɢɹɯ ɞɪɭɝ ɨɬ ɞɪɭɝɚ. Ʉɪɨɦɟ ɬɨɝɨ, ɩɨ ɦɧɟɧɢɸ ɪɹɞɚ
ɢɫɫɥɟɞɨɜɚɬɟɥɟɣ, ɜɵɫɨɤɚɹ ɬɟɦɩɟɪɚɬɭɪɚ, ɤɨɬɨɪɚɹ ɞɟɪɠɢɬɫɹ ɨɛɵɱɧɨ ɜ ɫɬɟɩɧɵɯ ɪɚɣɨɧɚɯ ɜ ɫɥɭɱɧɨɣ
ɫɟɡɨɧ, ɭɝɧɟɬɚɟɬ ɠɢɜɨɬɧɵɯ, ɜ ɪɟɡɭɥɶɬɚɬɟ ɱɟɝɨ ɢɯ ɨɯɨɬɚ ɱɚɫɬɨ ɨɫɬɚɟɬɫɹ ɧɟɡɚɦɟɱɟɧɧɨɣ ɱɟɥɨɜɟɤɨɦ. ȼ
ɷɬɢɯ ɭɫɥɨɜɢɹɯ ɜɚɠɧɨ ɫɜɨɟɜɪɟɦɟɧɧɨ ɨɛɟɫɩɟɱɢɬɶ ɞɨɫɬɚɜɤɭ ɧɚ ɩɭɧɤɬɵ ɫɟɦɟɧɢ ɡɚɤɪɟɩɥɟɧɧɵɯ ɛɵɤɨɜ,
ɜɵɹɜɥɟɧɢɟ ɠɢɜɨɬɧɵɯ ɜ ɨɯɨɬɟ ɢ ɢɯ ɨɫɟɦɟɧɟɧɢɟ.
ȼ ɌɈɈ «Ɇɚɦɛɟɬɨɜ ɢ Ʉ» Ɇɚɦɥɸɬɫɤɨɝɨ ɪɚɣɨɧɚ, ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɨɣ ɨɛɥɚɫɬɢ ɩɥɟɦɟɧɧɵɟ ɧɟɬɟɥɢ ɚɛɟɪɞɢɧ-ɚɧɝɭɫɫɤɨɣ ɩɨɪɨɞɵ ɛɵɥɢ ɡɚɜɟɡɟɧɵ ɢɡ Ⱥɦɟɪɢɤɢ ɜ 2012 ɝɨɞɭ ɜ ɤɨɥɢɱɟɫɬɜɟ 200 ɝɨɥɨɜ.
ȼɫɟ ɪɚɫɬɟɥɢɥɢɫɶ ɜ ɷɬɨɦ ɠɟ ɝɨɞɭ. ȼ 2012 ɝɨɞɭ 194 ɝɨɥɨɜɵ ɩɨɤɪɵɬɵ ɛɵɤɚɦɢ-ɩɪɨɢɡɜɨɞɢɬɟɥɹɦɢ, ɡɚɜɟɡɟɧɧɵɦɢ ɢɡ Ⱥɦɟɪɢɤɢ. ȼɵɯɨɞ ɬɟɥɹɬ ɫɨɫɬɚɜɢɥ ɧɚ 100 ɦɚɬɨɤ 70 %. ɗɬɨɬ ɩɨɤɚɡɚɬɟɥɶ ɜ ɦɹɫɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ ɷɤɨɧɨɦɢɱɟɫɤɢ ɧɟ ɜɵɝɨɞɟɧ, ɬɚɤ ɤɚɤ ɱɚɫɬɶ ɬɟɥɹɬ ɜɵɛɵɜɚɟɬ ɜ ɩɟɪɢɨɞ ɜɵɪɚɳɢɜɚɧɢɹ ɢɡ-ɡɚ
ɛɨɥɟɡɧɟɣ, ɩɥɨɯɢɯ ɭɫɥɨɜɢɣ ɤɨɪɦɥɟɧɢɹ ɢ ɫɨɞɟɪɠɚɧɢɹ. Ⱥ ɨɬ ɤɨɪɨɜ ɦɹɫɧɵɯ ɩɨɪɨɞ ɦɨɠɧɨ ɩɨɥɭɱɢɬɶ
ɬɨɥɶɤɨ ɬɟɥɹɬ.
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɜ 2013 ɝɨɞɭ ɛɵɥ ɩɪɨɜɟɞɟɧ ɚɧɚɥɢɡ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ ɫɬɚɞɚ ɤɨɪɨɜ (n=194) ɢ ɬɟɥɨɤ
(n=70). ɂɡ ɧɢɯ 262 ɝɨɥɨɜɵ ɢɫɤɭɫɫɬɜɟɧɧɨ ɨɫɟɦɟɧɟɧɨ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɝɨɪɦɨɧɚɥɶɧɵɯ ɩɪɟɩɚɪɚɬɨɜ ɩɪɨɫɬɨɝɥɚɧɞɢɧ (ɷɫɬɪɨɮɚɧ). ɉɪɟɩɚɪɚɬ ɩɪɢɦɟɧɹɥɢ ɞɜɭɤɪɚɬɧɨ ɫ ɢɧɬɟɪɜɚɥɨɦ 11 ɞɧɟɣ ɢ ɢɧɴɟɤɰɢɪɨɜɚɥɢ
ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɣ ɩɪɟɩɚɪɚɬ «ȿ-ɫɟɥɟɧ». ȼɵɯɨɞ ɬɟɥɹɬ ɧɚ 100 ɝɨɥɨɜ ɫɨɫɬɚɜɢɥ 87 %. ȼ 2014 ɝɨɞɭ
ɨɬ 229 ɤɨɪɨɜ ɢ ɨɬ 65 ɬɟɥɨɤ ɨɫɟɦɟɧɟɧɧɵɯ ɢɫɤɭɫɫɬɜɟɧɧɨ ɩɨɥɭɱɟɧɨ ɬɟɥɹɬ ɧɚ 100 ɦɚɬɨɤ 92 %. ɉɨ ɫɪɚɜɧɟɧɢɸ ɫ ɟɫɬɟɫɬɜɟɧɧɵɦ ɨɫɟɦɟɧɟɧɢɟɦ ɩɪɨɰɟɧɬ ɨɩɥɨɞɨɬɜɨɪɹɟɦɨɫɬɢ ɜɵɲɟ ɧɚ 14–19 % ɜ ɢɫɤɭɫɫɬɜɟɧɧɨɦ ɨɫɟɦɟɧɟɧɢɢ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɝɨɪɦɨɧɚɥɶɧɵɯ ɩɪɟɩɚɪɚɬɨɜ.
225
ȼ ɦɹɫɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ ɟɞɢɧɫɬɜɟɧɧɵɦ ɫɪɟɞɫɬɜɨɦ ɩɨɜɵɲɟɧɢɹ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɨɬɪɚɫɥɢ ɹɜɥɹɟɬɫɹ
ɨɛɹɡɚɬɟɥɶɧɨɟ ɩɨɥɭɱɟɧɢɟ ɨɬ ɤɚɠɞɨɣ ɤɨɪɨɜɵ ɠɢɡɧɟɫɩɨɫɨɛɧɨɝɨ ɬɟɥɟɧɤɚ. ɋ ɷɬɨɣ ɰɟɥɶɸ ɤɚɠɞɨɦ ɫɬɚɞɟ
ɧɟɨɛɯɨɞɢɦɨ ɪɚɡɪɚɛɨɬɚɬɶ ɱɟɬɤɢɣ ɢ ɪɟɚɥɶɧɨ ɜɵɩɨɥɧɢɦɵɣ ɩɥɚɧ ɩɨ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɭ, ɨɫɧɨɜɚɧɧɵɣ ɧɚ
ɩɨɜɵɲɟɧɢɢ ɜɨɫɩɪɨɢɡɜɨɞɢɬɟɥɶɧɵɯ ɮɭɧɤɰɢɣ ɠɢɜɨɬɧɵɯ.
Ⱦɥɹ ɭɥɭɱɲɟɧɢɹ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ ɧɟɨɛɯɨɞɢɦɨ ɩɪɨɜɨɞɢɬɶ ɢɫɤɭɫɫɬɜɟɧɧɨɟ ɨɫɟɦɟɧɟɧɢɟ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɫɟɦɟɧɢ ɛɵɤɚ-ɩɪɨɢɡɜɨɞɢɬɟɥɹ ɫ ɯɨɪɨɲɟɣ ɨɩɥɨɞɨɬɜɨɪɹɸɳɟɣ ɫɩɨɫɨɛɧɨɫɬɶɸ. Ɉɫɟɦɟɧɟɧɢɟ ɫɥɟɞɭɟɬ ɩɪɨɜɨɞɢɬɶ ɫ ɭɱɟɬɨɦ ɫɟɡɨɧɧɵɯ ɨɬɟɥɨɜ, ɤɨɬɨɪɵɟ ɩɨɡɜɨɥɹɸɬ ɩɨɥɭɱɚɬɶ ɛɨɥɶɲɨɟ ɤɨɥɢɱɟɫɬɜɨ ɬɟɥɹɬ
ɜ ɤɨɪɨɬɤɢɟ ɫɪɨɤɢ. ɗɬɨ ɨɛɥɟɝɱɢɬ ɩɨɞɝɨɬɨɜɤɭ ɤɨɪɨɜ ɤ ɨɫɟɦɟɧɟɧɢɸ, ɨɪɝɚɧɢɡɚɰɢɸ ɤɨɪɦɥɟɧɢɹ, ɭɯɨɞ ɩɨ
ɫɨɞɟɪɠɚɧɢɸ ɡɚ ɤɨɪɨɜɚɦɢ-ɦɚɬɟɪɹɦɢ ɢ ɢɯ ɬɟɥɹɬɚɦɢ. ɉɨɥɭɱɟɧɧɵɟ ɬɟɥɤɢ ɛɭɞɭɬ ɝɨɬɨɜɵ ɤ ɨɫɟɦɟɧɟɧɢɸ
ɩɪɢɦɟɪɧɨ ɜ ɨɞɧɨ ɢ ɬɨ ɠɟ ɜɪɟɦɹ, ɱɬɨ ɫɨɡɞɚɫɬ ɭɫɥɨɜɢɹ ɞɥɹ ɞɚɥɶɧɟɣɲɟɝɨ ɩɨɞɞɟɪɠɚɧɢɹ ɫɟɡɨɧɧɨɫɬɢ
ɨɬɟɥɨɜ.
ɉɟɪɢɨɞ ɚɩɪɟɥɶ-ɦɚɣ ɯɚɪɚɤɬɟɪɢɡɭɟɬɫɹ ɧɚɢɛɨɥɟɟ ɛɥɚɝɨɩɪɢɹɬɧɵɦ ɞɥɹ ɨɩɥɨɞɨɬɜɨɪɟɧɢɹ. ɉɨɥɭɱɟɧɧɵɟ
ɬɟɥɹɬɚ ɜ ɹɧɜɚɪɟ-ɦɚɪɬɟ ɜ ɡɢɦɧɟ-ɜɟɫɟɧɧɢɣ ɩɟɪɢɨɞ ɞɨɫɬɢɝɚɸɬ ɧɚɢɥɭɱɲɟɝɨ ɪɚɡɜɢɬɢɹ, ɬɚɤ ɤɚɤ ɨɧɢ ɜ
ɩɨɞɫɨɫɧɵɣ ɩɟɪɢɨɞ ɧɚɯɨɞɹɬɫɹ ɜɦɟɫɬɟ ɫ ɦɚɬɟɪɹɦɢ ɧɚ ɩɚɫɬɛɢɳɚɯ. Ⱥ ɜ ɨɤɬɹɛɪɟ-ɧɨɹɛɪɟ ɨɬɴɟɦ ɬɟɥɹɬ ɨɬ
ɤɨɪɨɜ ɩɨɡɜɨɥɹɟɬ ɫɮɨɪɦɢɪɨɜɚɬɶ ɝɭɪɬɵ ɨɞɧɨɜɨɡɪɚɫɬɧɵɯ, ɫ ɨɞɢɧɚɤɨɜɨɣ ɠɢɜɨɣ ɦɚɫɫɨɣ ɠɢɜɨɬɧɵɯ. ȼ
ɢɬɨɝɟ ɭɠɟ ɧɚ ɫɥɟɞɭɸɳɢɣ ɝɨɞ ɜ ɜɨɡɪɚɫɬɟ 14–15 ɦɟɫɹɰɟɜ ɦɨɠɧɨ ɢɧɬɟɧɫɢɜɧɨ ɜɟɫɬɢ ɪɟɦɨɧɬ ɫɬɚɞɚ.
ɍȾɄ 619.616.9 – 0.36.22
ɊȺɁɊȺȻɈɌɄȺ ɂ ȼɇȿȾɊȿɇɂȿ ɋɉɈɋɈȻȺ
ɍɋɄɈɊȿɇɇɈȽɈ ɄɈɆɉɅȿɄɋɇɈȽɈ
ȾɂɎɎȿɊȿɇɐɂȺɅɖɇɈ-ȾɂȺȽɇɈɋɌɂɑȿɋɄɈȽɈ
ɂɋɋɅȿȾɈȼȺɇɂə ɇȺ ɌɍȻȿɊɄɍɅȿɁ ɂ ɆɂɄɈȻȺɄɌȿɊɂɈɁ
ɄɊɍɉɇɈȽɈ ɊɈȽȺɌɈȽɈ ɋɄɈɌȺ ȼ ȻɅȺȽɈɉɈɅɍɑɇɈɆ
ɉɈ ɌɍȻȿɊɄɍɅȿɁɍ ɏɈɁəɃɋɌȼɍɘɓȿɆ ɋɍȻɔȿɄɌȿ
ȻȺɋɕȻȿɄɈȼ ɋ.ɀ., ɌɍɊȽȿɇȻȺȿȼ Ʉ.Ⱥ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɜɟɬɟɪɢɧɚɪɧɵɣ ɢɧɫɬɢɬɭɬ»,
E.mail:kaznivi@itte.kz
Ɋɟɡɸɦɟ. ȼ ɫɬɚɬɶɟ ɩɪɢɜɟɞɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɜɧɟɞɪɟɧɢɹ ɜ 2011–2013 ɝɝ. ɪɚɡɪɚɛɨɬɚɧɧɨɝɨ ɷɤɫɩɪɟɫɫ
ɦɟɬɨɞɚ ɩɪɢɠɢɡɧɟɧɧɨɣ ɞɢɮɮɟɪɟɧɰɢɚɰɢɢ ɬɭɛɟɪɤɭɥɢɧɨɜɵɯ ɪɟɚɤɰɢɣ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɫ
ɩɪɢɦɟɧɟɧɢɟɦ ɤɨɦɩɥɟɤɫɧɨɝɨ ɚɥɥɟɪɝɨɞɟɩɪɟɫɫɚɧɬɚ Ʉɚɡɇɂȼɂ ɜ 3-ɯ ɛɥɚɝɨɩɨɥɭɱɧɵɯ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ
ɫɟɥɶɯɨɡɮɨɪɦɢɪɨɜɚɧɢɹɯ Ⱥɥɦɚ-ɬɢɧɫɤɨɣ ɨɛɥɚɫɬɢ. ɉɪɟɞɥɨɠɟɧɚ ɫɯɟɦɚ ɤɨɦɩɥɟɤɫɧɨɣ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ.
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: ɄɊɋ, ɬɭɛɟɪɤɭɥɟɡ, ɦɢɤɨɛɚɤɬɟɪɢɨɡ, ɞɢɚɝɧɨɫɬɢɤɚ, ɚɥɥɟɪɝɨɞɟɩɪɟɫɫɚɧɬ.
Ɉɞɧɢɦ ɢɡ ɫɭɳɟɫɬɜɟɧɧɵɯ ɧɟɞɨɫɬɚɬɤɨɜ ɚɥɥɟɪɝɢɱɟɫɤɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɬɭɛɟɪɤɭɥɟɡɚ ɭ ɠɢɜɨɬɧɵɯ ɹɜɥɹɟɬɫɹ ɩɪɨɹɜɥɟɧɢɟ ɧɟɫɩɟɰɢɮɢɱɟɫɤɢɯ ɬɭɛɟɪɤɭɥɢɧɨɜɵɯ ɪɟɚɤɰɢɣ [1], ɨɛɭɫɥɚɜɥɢɜɚɟɦɵɯ ɫɟɧɫɢɛɢɥɢɡɚɰɢɟɣ ɢɯ ɨɪɝɚɧɢɡɦɚ ɚɬɢɩɢɱɧɵɦɢ ɦɢɤɨɛɚɤɬɟɪɢɹɦɢ, ɪɚɫɩɪɨɫɬɪɚɧɟɧɧɵɦɢ ɫɬɨɥɶ ɲɢɪɨɤɨ ɜ ɩɪɢɪɨɞɟ (300 ɜɢɞɨɜ) [2], ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɧɨɝɨ ɩɚɪɚɡɢɬɨɰɟɧɨɡɚ ɧɚ ɮɨɧɟ ɩɟɪɜɢɱɧɨɝɨ ɩɨɪɚɠɟɧɢɹ ɨɪɝɚɧɨɜ
ɝɟɥɶɦɢɧɬɚɦɢ, ɝɪɢɛɤɚɦɢ ɢ ɚɝɟɧɬɚɦɢ ɧɟɦɢɤɨɛɚɤɬɟɪɢɚɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ. [3-4].Ɍɚɤɢɟ ɪɟɚɤɰɢɢ ɭ
ɠɢɜɨɬɧɵɯ ɦɨɝɭɬ ɜɵɡɜɚɬɶ ɫɬɪɟɫɫɨɜɵɟ ɮɚɤɬɨɪɵ, ɝɧɨɣɧɨ-ɧɟɤɪɨɬɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ ɢ ɬ.ɩ.[5-6].
Ⱦɥɹ ɪɚɡɪɟɲɟɧɢɹ ɞɚɧɧɨɝɨ ɜɨɩɪɨɫɚ ɧɚɦɢ ɛɵɥ ɪɚɡɪɚɛɨɬɚɧ ɭɫɤɨɪɟɧɧɵɣ (ɜ ɬɟɱɟɧɢɟ ɧɟɞɟɥɶɧɨɝɨ
ɫɪɨɤɚ) ɦɟɬɨɞ ɞɢɮɮɟɪɟɧɰɢɚɰɢɢ ɫɩɟɰɢɮɢɱɟɫɤɢɯ ɢ ɧɟɫɩɟɰɢɮɢɱɟɫɤɢɯ ɬɭɛɟɪɤɭɥɢɧɨɜɵɯ ɪɟɚɤɰɢɣ ɭ
ɠɢɜɨɬɧɵɯ ɩɭɬɟɦ ɩɪɢɦɟɧɟɧɢɹ ɤɨɦɩɥɟɤɫɧɨɝɨ ɚɥɥɟɪɝɨɞɟɩɪɟɫɫɚɧɬɚ Ʉɚɡɇɂȼɂ ɜ ɬɟɱɟɧɢɟ 4-ɯ ɫɭɬɨɤ
ɧɚ ɪɟɚɝɢɪɭɸɳɟɦ ɩɨ ȼɌɉ ɠɢɜɨɬɧɨɦ ɫ ɩɨɫɥɟɞɭɸɳɢɦ ɩɟɪɟɢɫɫɥɟɞɨɜɚɧɢɟɦ ɩɚɪɚɥɥɟɥɶɧɨɣ ɩɨɫɬɚɧɨɜɤɨɣ ɜɧɭɬɪɢɤɨɠɧɨɣ ɢ ɩɚɥɶɩɟɛɪɚɥɶɧɨɣ ɬɭɛɟɪɤɭɥɢɧɨɜɵɯ ɩɪɨɛ. ɇɚɭɱɧɚɹ ɧɨɜɢɡɧɚ ɞɚɧɧɨɣ ɪɚɡɪɚɛɨɬɤɢ
ɷɤɫɩɪɟɫɫ ɦɟɬɨɞɚ ɩɨɞɬɜɟɪɠɞɟɧɚ ɩɨɥɭɱɟɧɢɟɦ ɂɧɧɨɜɚɰɢɨɧɧɨɝɨ ɩɚɬɟɧɬɚ ɊɄ ʋ24206 ɨɬ 13.02.2011 ɝ.
«ɋɩɨɫɨɛ ɩɨɜɵɲɟɧɢɹ ɫɩɟɰɢɮɢɱɧɨɫɬɢ ɜɧɭɬɪɢɤɨɠɧɨɣ ɬɭɛɟɪɤɭɥɢɧɨɜɨɣ ɩɪɨɛɵ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɤɨɦɩɥɟɤɫɧɨɝɨ ɚɥɥɟɪɝɨɞɟɩɪɟɫɫɚɧɬɚ ɞɥɹ ɭɫɤɨɪɟɧɧɨɣ ɩɪɢɠɢɡɧɟɧɧɨɣ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ
ɬɭɛɟɪɤɭɥɟɡɚ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɚ ɠɢɜɨɬɧɵɯ». ɗɬɨɬ ɷɤɫɩɪɟɫɫ ɦɟɬɨɞɚ, ɢɦɟɧɭɟɦɵɣ ɤɚɤ «ɀɟɞɟɥ ɚɠɵɪɚɬɭɞɵɧ ɬɢɵɦɞɵ ɚɞɢɫ», ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬ ɩɪɢɦɟɧɟɧɢɟ ɚɥɥɟɪɝɨɞɟɩɪɟɫɫɚɧɬɚ «Ʉɚɡɇɂȼɂ» ɞɥɹ ɩɪɢɠɢɡɧɟɧɧɨɣ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɬɭɛɟɪɤɭɥɟɡɚ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɨɜ ɢ ɪɚɫɩɨɡɧɨɜɚɧɢɹ
ɧɟɫɩɟɰɢɮɢɱɟɫɤɢɯ ɬɭɛɟɪɤɭɥɢɧɨɜɵɯ ɪɟɚɤɰɢɣ (ɫ ɪɚɡɦɟɪɚɦɢ ɞɨ 11 ɦɦ) ɭ ɪɚɧɟɟ (7 ɫɭɬɨɤ ɫɩɭɫɬɹ)
ɪɟɚɝɢɪɨɜɚɜɲɟɝɨ ɧɚ ȼɌɉ ɫɤɨɬɚ.
226
Ɋɢɫ. 1. ɋɯɟɦɚ ɤɨɦɩɥɟɤɫɧɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ ɬɭɛɟɪɤɭɥɟɡ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ɜ ɛɥɚɝɨɩɨɥɭɱɧɨɦ ɯɨɡɹɣɫɬɜɭɸɳɟɦ ɫɭɛɴɟɤɬɟ
ɗɬɨ ɹɜɢɥɨɫɶ ɫɭɳɟɫɬɜɟɧɧɵɦ ɞɨɩɨɥɧɟɧɢɟɦ ɜ ɪɚɧɟɟ ɪɚɡɪɚɛɨɬɚɧɧɵɟ ɧɚɦɢ ɪɟɤɨɦɟɧɞɚɰɢɢ «ɋɯɟɦɚ
ɩɨɫɬɚɧɨɜɤɢ ɩɟɪɜɢɱɧɨɝɨ ɞɢɚɝɧɨɡɚ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɜ ɪɚɧɟɟ ɛɥɚɝɨɩɨɥɭɱɧɵɯ ɮɟɪɦɚɯ», ɭɬɜɟɪɠɞɟɧɧɵɟ ɜ
1999 ɝ. Ƚɍȼ Ɇɋɏ ɊɄ [7] ɢ ɨɫɧɨɜɚɧɢɟɦ ɪɚɡɪɚɛɨɬɤɢ ɫɯɟɦɵ ɤɨɦɩɥɟɤɫɧɨɣ ɞɢɮɮɟɪɟɧɰɢɚɰɢɢ ɧɟɫɩɟɰɢɮɢɱɟɫɤɢɯ ɬɭɛɟɪɤɭɥɢ-ɧɨɜɵɯ ɪɟɚɤɰɢɣ ɭ ɫɤɨɬɚ ɜ ɛɥɚɝɨɩɨɥɭɱɧɨɦ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɯɨɡ.ɫɭɛɴɟɤɬɟ (ɪɢɫ.1).
ɍɤɚɡɚɧɧɵɣ ɦɟɬɨɞ ɹɜɥɹɟɬɫɹ ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟɦ ɬɟɫɬɚ «Ȼɭɫɬɟɪ ɷɮɮɟɤɬ»ɢ (ɩɨ Ⱥ.ɏ. ɇɚɣɦɚɧɨɜɭ,
1998). Ⱦɥɹ ɱɟɝɨ ɢɦ ɜɜɨɞɢɥɫɹ ɫɨɱɟɬɚɧɨ ɜ ɬɟɱɟɧɢɟ 4 ɞɧɟɣ ɚɥɥɟɪɝɨɞɟɩɪɟɫɚɧɬ – ɩɪɟɩɚɪɚɬ «Ʉɚɡɇɂȼɂ»,
ɜɤɥɸɱɚɸɳɢɣ ɜɧɭɬɪɢɜɟɧɧɨɟ (ɦɟɞɥɟɧɧɨɟ) ɜɜɟɞɟɧɢɟ ɩɨɞɨɝɪɟɬɨɝɨ ɞɨ 37ɨɋ 20 %-ɧɨɝɨ ɪɚɫɬɜɨɪɚ ɛɨɪɝɥɸɤɨɧɚɬɚ ɤɚɥɶɰɢɹ ɜ ɨɛɴɟɦɟ 100 ɦɥ ɢ ɜɧɭɬɪɢɦɵɲɟɱɧɨɟ (ɨɞɧɨɤɪɚɬɧɨɟ) – ɇɢɬɚɦɢɧɚ (ɤɨɦɩɥɟɤɫɚ ɜɢ227
ɬɚɦɢɧɨɜ Ⱥ, Ⱦ, ȿ, ɋ) ɜ ɞɨɡɟ 5 ɦɥ ɢ ɩɨɞɤɨɠɧɨɟ – 2 ɦɥ 20 % – ɝɨ ɪɚɫɬɜɨɪɚ ɤɨɮɟɢɧɚ. ɉɨ ɢɫɬɟɱɟɧɢɢ 4-ɯ
ɞɧɟɣ ɢɦ ɛɵɥɢ ɩɨɫɬɚɜɥɟɧɵ ɩɚɪɚɥɥɟɥɶɧɨ ɩɚɥɶɩɟɛɪɚɥɶɧɚɹ ɢ ɜɧɭɬɪɢɤɨɠɧɚɹ ɬɭɛɟɪɤɭɥɢɧɨɜɵɟ ɩɪɨɛɵ ɫ
ɨɞɧɨɜɪɟɦɟɧɧɨɣ ɱɢɬɤɨɣ ɪɟɚɤɰɢɣ ɱɟɪɟɡ 72 ɱɚɫɚ. ɇɚ ɨɫɧɨɜɚɧɢɢ ɫɨɩɨɫɬɚɜɥɟɧɢɹ ɩɨɜɬɨɪɧɨɝɨ ɩɨɤɚɡɚɧɢɹ
ɜɧɭɬɪɢɤɨɠɧɨɣ ɪɟɚɤɰɢɣ ɫ ɩɟɪɜɨɧɚɱɚɥɶɧɵɦ ɢ ɞɨɩɨɥɧɢɬɟɥɶɧɨɣ ɨɰɟɧɤɢ ɪɟɡɭɥɶɬɚɬɚ ɩɚɥɶɩɟɛɪɚɥɶɧɨɣ
ɩɪɨɛɵ ɫɭɞɢɥɢ ɨ ɫɩɟɰɢɮɢɱɟɫɤɨɦ ɢɥɢ ɧɟɫɩɟɰɢɮɢɱɟɫɤɨɦ ɯɚɪɚɤɬɟɪɟ ɩɪɨɹɜɥɟɧɢɹ ɬɭɛɟɪɤɭɥɢɧɨɜɨɣ ɚɥɥɟɪɝɢɢ ɭ ɢɡɧɚɱɚɥɶɧɨ ɪɟɚɝɢɪɭɸɳɟɝɨ ɧɚ ɬɭɛɟɪɤɭɥɢɧ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ.
ɉɪɢ ɷɬɨɦ, ɟɫɥɢ ɭ ɡɚɪɚɠɟɧɧɵɯ ɜɨɡɛɭɞɢɬɟɥɹɦɢ ɬɭɛɟɪɤɭɥɟɡɚ ɠɢɜɨɬɧɵɯ ɧɚɛ-ɛɥɸɞɚɥɨɫɶ ɭɜɟɥɢɱɟɧɢɟ
ɪɚɡɦɟɪɚ ɜɧɭɬɪɢɤɨɠɧɨɣ ɪɟɚɤɰɢɢ ɧɚ 2 ɦɦ ɢ ɛɨɥɟɟ ɢ ɩɨ ɩɚɥɶɩɟɛɪɚɥɶɧɨɣ – ɩɨɥɨɠɢɬɟɥɶɧɚɹ ɪɟɚɤɰɢɹ ɜ
«+++» ɢ «++++» ɜ ɜɢɞɟ ɜɵɪɚɠɟɧɧɨɣ ɝɢɩɟɪɟɦɢɢ ɤɨɧɴɸɧɤɬɢɜɵ ɢ ɩɪɢɩɭɯɥɨɫɬɢ ɧɢɠɧɟɝɨ ɜɟɤɚ, ɨɛɢɥɶɧɨ-ɝɧɨɣɧɨɝɨ ɢɥɢ ɫɥɢɡɢɫɬɨ-ɝɧɨɣɧɨɝɨ ɢɫɬɟɱɟɧɢɹ ɢɡ ɭɝɥɚ ɝɥɚɡɚ, ɚ ɭ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɚɬɢɩɢɱɧɵɦɢ
ɦɢɤɨɛɚɤɬɟɪɢɹɦɢ, ɜ ɬ.ɱ. ɜɨɡɛɭɞɢɬɟɥɹɦɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɨɜ ɪɚɡɦɟɪ ɩɨ ȼɌɉ ɨɫɬɚɜɚɥɫɹ ɩɪɟɠɧɢɦ ɢɥɢ
ɭɦɟɧɶɲɚɥɫɹ ɢ ɩɨ ɩɚɥɶɩɟɛɪɚɥɶɧɨɣ ɩɪɨɛɟ ɨɬɦɟɱɚɥɚɫɶ «ɫɨɦɧɢɬɟɥɶɧɚɹ» – ɜ + ɢ ++ ɜ ɜɢɞɟ ɧɟɡɧɚɱɢɬɟɥɶɧɨɣ ɝɢɩɟɪɟɦɢɢ ɤɨɧɴɸɧɤɬɢɜɵ, ɩɪɢɩɭɯɥɨɫɬɢ ɧɢɠɧɟɝɨ ɜɟɤɚ ɢ ɫɤɭɞɧɨɝɨ ɫɥɢɡɢɫɬɨɝɨ ɢɫɬɟɱɟɧɢɹ ɢɡ
ɭɝɥɚ ɝɥɚɡɚ. ɉɪɢ ɨɬɫɭɬɫɬɜɢɢ ɪɟɚɤɰɢɣ ɧɚ ɷɬɢ ɩɪɨɛɵ ɫɱɢɬɚɥɢ ɢɯ ɫɟɧɫɢɛɢɥɢɡɢɪɨɜɚɧɵɦɢ ɫɚɩɪɨɮɢɬɢɪɭɸɳɢɦɢ ɦɢɤɨɛɚɤɬɟɪɢɹɦɢ.
ɇɨɜɢɡɧɚ ɪɚɡɪɚɛɨɬɤɢ ɩɨɞɬɜɟɪɠɞɟɧɚ ɩɨɥɭɱɟɧɢɟɦ 25.12.2012 ɝ. ɂɧɧɨɜɚɰɢɨɧɧɨɝɨ ɩɚɬɟɧɬɚ
Ʉɨɦɢɬɟɬɨɦ ɩɨ ɩɪɚɜɚɦ ɢɧɬɟɥɥɟɤɬɭɚɥɶɧɨɣ ɫɨɛɫɬɜɟɧɧɨɫɬɢ Ɇɘ ɊɄ ʋ 26553 ɧɚ «Cɩɨɫɨɛ ɭɫɤɨɪɟɧɧɨɝɨ
ɤɨɦɩɥɟɤɫɧɨɝɨ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɨ-ɞɢɚɝɧɨɫɬɢɱɟɫɤɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ ɬɭɛɟɪɤɭɥɟɡ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɛɥɚɝɨɩɨɥɭɱɧɨɦ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɯɨɡɹɣɫɬɜɭɸɳɟɦ ɫɭɛɴɟɤɬɟ («Ɍɭɛɟɪɤɭɥɟɡ
ɛɨɣɵɧɲɚ ɠɚԑ-ɞɚɣɵ ɠɚԕɫɵ ɲɚɪɭɚ-ɲɵɥɵԕ ɠԝɪɝɿɡɭɲɿ ɫɭɛɴɟɤɬɿɞɟ ɿɪɿ ԕɚɪɚ ɦɚɥɞɵ ɬɭɛɟɪɤɭɥɟɡɝɟ ɠԥɧɟ
ɦɢɤɨɛɚɤɬɟɪɢɨɡԑɚ ɤɟɲɟɧɞɿ ɬԛɪɞɟ ɫɚɪɚɥɚɩ ɠɟɞɟɥ-ɞɢɚɝɧɨɫɬɢɤɚɥɚɩ ɡɟɪɬɬɟɭ ɬԥɫɿɥɿ»).
Ɋɚɡɪɚɛɨɬɚɧɧɚɹ ɧɚɦɢ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɧɨɜɚɹ ɢ ɫɨɜɟɪɲɟɧɧɚɹ ɫɯɟɦɚ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɬɭɛɟɪɤɭɥɟɡɚ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɚ ɠɢɜɨɬɧɵɯ ɩɨɡɜɨɥɹɟɬ ɫɜɨɟɜɪɟɦɟɧɧɨ ɨɩɪɟɞɟɥɢɬɶ ɫɬɚɬɭɫ ɛɥɚɝɨɩɨɥɭɱɢɹ ɩɨ ɷɬɨɣ ɢɧɮɟɤɰɢɢ ɯɨɡɫɭɛɴɟɤɬɚ ɫ ɪɚɡɧɨɣ ɮɨɪɦɨɣ ɫɨɛɫɬɜɟɧɧɨɫɬɢ, ɩɥɚɧɢɪɨɜɚɬɶ ɢ ɨɫɭɳɟɫɬɜɥɹɬɶ ɤɨɧɬɪɨɥɶ ɛɥɚɝɨɩɨɥɭɱɢɹ, ɚ ɩɪɢ ɜɨɡɧɢɤɧɨɜɟɧɢɢ ɛɨɥɟɡɧɢ ɫɜɨɟɜɪɟɦɟɧɧɨ ɩɨɫɬɚɜɢɬɶ ɞɢɚɝɧɨɡ, ɷɮɮɟɤɬɢɜɧɨ ɢ ɤɚɱɟɫɬɜɟɧɧɨ ɩɪɨɜɨɞɢɬɶ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɟ ɦɟɪɨɩɪɢɹɬɢɹ ɩɨ ɛɵɫɬɪɟɣɲɟɦɭ ɤɭɩɢɪɨɜɚɧɢɸ
ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɨɱɚɝɚ ɦɟɞɥɟɧɧɨ ɬɥɟɸɳɟɣ ɢɧɮɟɤɰɢɢ.
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɝɨ ɜɧɟɞɪɟɧɢɹ ɷɬɨɣ ɧɚɭɱɧɨɣ ɪɚɡɪɚɛɨɬɤɢ ɜ 2011–2013 ɝɝ.ɜ 3-ɯ ɛɥɚɝɨɩɨɥɭɱɧɵɯ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɯɨɡɹɣɫɬɜɭɸɳɢɯ ɫɭɛɴɟɤɬɚɯ (ɌɈɈ «Ȼɚɣ-ɫɟɪɤɟ» ɢ ɋɏɉɄ«ɉɥɟɦɡɚɜɨɞ
Ⱥɥɦɚɬɵ» ɢ ɜ ɌɈɈ «Ɇɟɠɞɭɪɟɱɟɧɫɤ Ⱥɝɪɨ») Ⱥɥɦɚ-ɬɢɧɫɤɨɣ ɨɛɥɚɫɬɢ ɛɵɥ ɭɫɬɚɧɨɜɥɟɧ ɭ 279 ɝɨɥɨɜ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɚɪɚɫɩɟɰɢɮɢɱɟɫɤɢɣ ɯɚɪɚɤɬɟɪ ɩɪɨɹɜɥɟɧɢɹ ɬɭɛɟɪɤɭɥɢɧɨɜɨɣ ɪɟɚɤɰɢɢ, ɨɛɭɫɥɨɜɥɟɧɧɵɣ ɫɟɧɫɢɛɢɥɢɡɚɰɢɟɣ ɨɪɝɚɧɢɡɦɚ ɨɬɞɟɥɶɧɵɦɢ ɜɢɞɚɦɢ ɚɬɢɩɢɱɧɵɯ ɦɢɤɨɛɚɤɬɟɪɢɣ ɧɚ ɮɨɧɟ
ɩɨɪɚɠɟɧɢɹ ɨɪɝɚɧɨɜ ɝɥɢɫɬɧɨɣ ɢɧɜɚɡɢɟɣ. ɗɬɢɦ ɫɚɦɵɦ ɛɵɥ ɩɪɟɞɨɬɜɪɚɳɟɧ ɧɟɨɩɪɚɜɞɚɧɧɵɣ ɭɛɨɣ 258
ɝɨɥɨɜ, ɩɥɟɦɟɧɧɨɝɨ (ɚɥɚɬɚɭɫɤɨɣ ɢ ɝɨɥɶɲɬɢɧɨɮɪɢɡɫɤɨɣ ɩɨɪɨɞ) ɫɤɨɬɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
8.
9.
228
Ȼɚɫɵɛɟɤɨɜ ɋ.ɀ., Ɍɭɪɝɟɧɛɚɟɜ Ʉ.Ⱥ. Ⱦɢɮɮɟɪɟɧɰɢɚɥɶɧɚɹ ɞɢɚɝɧɨɫɬɢɤɚ ɬɭɛɟɪɤɭ-ɥɟɡɚ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɨɜ ɭ
ɠɢɜɨɬɧɵɯ. //ȼɟɫɬɧɢɤ ɫ.-ɯ. ɧɚɭɤɢ Ʉɚɡɚɯɫɬɚɧɚ, ʋ 7. -Ⱥɥɦɚɬɵ, 2002. –ɋ. 25–28.
Ɍɭɡɨɜɚ Ɋ.ȼ. Ɍɭɛɟɪɤɭɥɟɡ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɢ ɩɬɢɰ. –Ɇɢɧɫɤ, ɢɡɞ. «ɍɪɚɞɠɚɣ». –1982. –
ɋ.56.
Ȼɚɫɵɛɟɤɨɜ ɋ.ɀ., Ȼɨɩɢɧɚɧɨɜ Ⱥ.Ʉ., Ɇɚɦɵɬɛɟɤɨɜ Ȼ.ɀ. ɉɪɨɹɜɥɟɧɢɟ ɩɚɪɚɡɢɬɨ-ɰɟɧɨɡɚ ɭ ɪɟɚɝɢɪɭɸɳɟɝɨ ɧɚ
ɬɭɛɟɪɤɭɥɢɧ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɯɨɡɹɣɫɬɜɚɯ Ɍɚɥɝɚɪɫɤɨɝɨ ɪɚɣɨɧɚ Ⱥɥɦɚɬɢɧɫɤɨɣ ɨɛɥɚɫɬɢ //ɋɛ. ɧɚɭɱ.
ɬɪ. ɊȽɉ «Ʉɚɡɇɂȼɂ», ɬ.ɏLIɏ. –Ⱥɥɦɚɬɵ, 2001. –ɋ.58–65.
Ȼɚɫɵɛɟɤɨɜ
ɋ.ɀ.,
Ɇɚɦɵɬɛɟɤɨɜ
Ȼ.ɀ.
ɋɨɜɪɟɦɟɧɧɨɟ
ɫɨɫɬɨɹɧɢɟ
ɩɪɨɛɥɟɦɵ ɧɟɫɩɟɰɢɮɢɱɟɫɤɢɯ ɪɟɚɤɰɢɣ ɧɚ ɬɭɛɟɪɤɭɥɢɧ ɭ ɠɢɜɨɬɧɵɯ ɢ ɢɯ ɞɢɮɮɟɪɟɧɰɢɚɰɢɹ.
//Ɇɚɬɟɪɢɚɥɵ 1-ɝɨ ɦɟɠɞɭɧɚɪɨɞ. ɜɟɬ.ɤɨɧɝɪɟɫɫɚ. –Ⱥɥɦɚɬɵ,2002. –ɋ.37–40.
Ɍɢɲɤɨɜɚ ɇ.ɋ. ɢ ɞɪ. Ɍɭɛɟɪɤɭɥɢɧɨɜɵɟ ɪɟɚɤɰɢɢ ɧɚ ɮɨɧɟ ɧɟɤɨɬɨɪɵɯ ɦɢɤɨɬɢɱɟɫ-ɤɢɯ ɡɚɛɨɥɟɜɚɧɢɢ. // ɋɛ.
ɇɂɂȻɌɀ: Ɇɟɬɨɞɵ ɞɢɚɝɧɨɫɬɢɤɢ ɢ ɩɪɨɮɢɥɚɤɬɢɤɢ ɛɪɭɰɟɥɥɟɡɚ ɢ ɬɭɛɟɪɤɭɥɟɡɚ ɠɢɜɨɬɧɵɯ. Ɉɦɫɤ, , 1988. –
ɋ.140–143.
Chlonik Worm infection afftcts human T. cell response to mycobacteri antigens: Tes Tlias Daniel Wolday
Dawit, Akuffon Hannah, Petros Beyene, Britton. Sven. Scand. //J. Jmmonology. – 2001. –54.
Ʉɟɪɢɦɠɚɧɨɜɚ Ȼ.Ɏ., ɀɭɦɚɲɟɜ Ⱥ.ɋ., Ȼɚɫɵɛɟɤɨɜ ɋ.ɀ. ɢ ɞɪ. Ɋɟɤɨɦɟɧɞɚɰɢɢ «ɋɯɟɦɚ ɩɨɫɬɚɧɨɜɤɢ ɩɟɪɜɢɱɧɨɝɨ ɞɢɚɝɧɨɡɚ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɜ ɪɚɧɟɟ ɛɥɚɝɨɩɨɥɭɱɧɵɯ ɮɟɪɦɚɯ». // ɍɬɜɟɪɠɞɟɧɵ Ƚɍȼ Ɇɋɏ ɊɄ, ɩɪɨɬɨɤɨɥ
ʋ3.-Ⱥɥɦɚɬɵ,1997.–13ɫ.
ɀɭɦɚɲ Ⱥ.ɋ., Ɍɭɪɝɟɧɛɚɟɜ Ʉ.Ⱥ., Ȼɚɫɵɛɟɤɨɜ ɋ.ɀ. ɢ ɞɪ. Ɋɟɤɨɦɟɧɞɚɰɢɢ ɩɨ ɨɬɛɨɪɭ ɦɚɬɟɪɢɚɥɚ ɞɥɹ ɥɚɛɨɪɚɬɨɪɧɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ ɬɭɛɟɪɤɭɥɟɡ ɢ ɦɢɤɨɛɚɤɬɟɪɢɨɡɵ, //Ɋɚɫɫɦɨɬɪɟɧɵ ɢ ɭɬɜɟɪɠɞɟɧɵ ɧɚ ɇɌɋ ɇɉɐ
ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɢ ɜɟɬɟɪɢɧɚɪɢɢ Ɇɋɏ ɊɄ, ɩɪɨɬɨɤɨɥ ʋ13. –Ⱥɫɬɚɧɚ, 2005. –15 ɫ.
ɀɭɦɚɲ Ⱥ.ɋ., Ɍɭɪɝɟɧɛɚɟɜ Ʉ.Ⱥ., Ȼɚɫɵɛɟɤɨɜ ɋ.ɀ. ɢ ɞɪ. Ɋɟɤɨɦɟɧɞɚɰɢɢ ɩɨ ɢɞɟɧ-ɬɢɮɢɤɚɰɢɢ, ɞɢɮɮɟɪɟɧɰɢɚɰɢɢ ɢ ɨɩɪɟɞɟɥɟɧɢɸ ɥɟɤɚɪɫɬɜɟɧɧɨɣ ɭɫɬɨɣɱɢɜɨɫɬɢ ɦɢɤɨɛɚɤɬɟɪɢɣ ɬɭɛɟɪɤɭɥɟɡɚ.//Ɋɚɫɫɦɨɬɪɟɧɵ ɢ ɭɬɜɟɪɠɞɟɧɵ ɇɌɋ ɇɉɐ ɠɢɜɨɬɧɨɜɨɞɜɨɞɫɬɜɚ ɢ ɜɟɬɟɪɢɧɚɪɢɢ Ɇɋɏ ɊɄ, ɩɪɨɬɨɤɨɥ ʋ13.–Ⱥɫɬɚɧɚ. -2005. – 33ɫ.
ɂɁɍɑȿɇɂȿ ȼɂȾɈȼɈȽɈ ɋɈɋɌȺȼȺ ɋȺɊɄɈɐɂɋɌ
ɍ ɆɈɇȽɈɅɖɋɄɂɏ Ɉȼȿɐ
ȻȺɌɐɗɐɗȽ Ƚ., ȻȺɌɋɍɏ Ɂ., ȽȺɇȻɈɅȾ Ⱦ., ȻəɆȻȺȺ Ȼ.,
Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ, ɇɂɂ ɜɟɬɟɪɢɧɚɪɧɵɣ ɦɟɞɢɰɢɧɵ,
ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ. Email: gotsetseg@magicnet.mn
ɋɚɪɤɨɰɢɫɬɵ ɠɢɜɨɬɧɵɯ ɹɜɥɹɸɬɫɹ ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧɧɵɦɢ ɩɪɨɫɬɟɣɲɢɦɢ. Ɇɧɨɝɢɟ ɩɨɡɜɨɧɨɱɧɵɟ ɹɜɥɹɸɬɫɹ ɩɪɨɦɟɠɭɬɨɱɧɵɦɢ ɢɥɢ ɨɤɨɧɱɚɬɟɥɶɧɵɦɢ ɯɨɡɹɟɜɚɦɢ Sarcocystis.
ɉɨ ɞɚɧɧɵɦ (6), (8) ɢ (1) ɫɚɪɤɨɰɢɫɬɵ ɫɧɢɠɚɸɬ ɠɢɜɭɸ ɦɚɫɫɭ, ɜɵɯɨɞ ɦɨɥɨɤɚ, ɲɟɪɫɬɢ ɢ ɪɨɫɬ ɠɢɜɨɬɧɵɯ. Ⱥ ɬɚɤɠɟ ɩɪɢɫɭɬɫɬɜɢɟ ɫɚɪɤɨɰɢɫɬ ɜ ɨɪɝɚɧɢɡɦɟ ɠɢɜɨɬɧɵɯ ɩɪɢɜɨɞɢɬ ɤ ɧɚɪɭɲɟɧɢɸ ɝɢɫɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɪɭɤɬɭɪɵ ɦɢɨɤɚɪɞɚ, ɡɟɪɧɢɫɬɨɣ ɞɢɫɬɪɨɮɢɢ ɦɵɲɟɱɧɵɯ ɜɨɥɨɤɨɧ ɫɟɪɞɰɚ, ɬɹɠɟɥɵɦ ɮɭɧɤɰɢɨɧɚɥɶɧɵɦ ɧɚɪɭɲɟɧɢɟɦ, ɜɵɡɵɜɚɟɬ ɧɚɪɭɲɟɧɢɟ ɨɛɦɟɧɚ ɜɟɳɟɫɬɜ ɜ ɬɤɚɧɹɯ ɢ ɨɪɝɚɧɚɯ, ɱɬɨ ɜ ɫɜɨɸ
ɨɱɟɪɟɞɶ ɜɵɡɵɜɚɟɬ ɤɥɢɧɢɤɨ-ɩɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɡɦɟɧɟɧɢɹ.
ɒɢɪɨɤɨɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɫɚɪɤɨɰɢɫɬɨɡɚ ɫɪɟɞɢ ɠɢɜɨɬɧɵɯ ɨɛɴɹɫɧɹɟɬɫɹ ɩɨɫɬɨɹɧɧɵɦ ɤɨɧɬɚɤɬɨɦ
ɠɢɜɨɬɧɵɯ ɫ ɨɤɨɧɱɚɬɟɥɶɧɵɦɢ ɯɨɡɹɟɜɚɦɢ, ɬɚɤɢɯ ɤɚɤ ɞɨɦɚɲɧɢɟ ɢ ɞɢɤɢɟ ɩɥɨɬɨɹɞɧɵɟ (ɩɟɫɰɵ, ɲɚɤɚɥɵ,
ɜɨɥɤɢ, ɤɨɣɨɬɵ, ɥɢɫɢɰɵ) (2, 3, 4).
ɍɫɬɚɧɨɜɥɟɧɨ 4 ɜɢɞɚ ɫɚɪɤɨɰɢɫɬ: Sarcocystistenella (S.ovicanis), S.gigantea (S.ovifelis), and
S.medusiformis, ɩɚɪɚɡɢɬɢɪɭɸɳɢɯ ɭ ɨɜɟɰ. Ⱦɟɮɢɧɢɬɢɜɧɵɟ ɯɨɡɹɟɜɚɦɢ S. tenella ɢ S.arieticanis ɹɜɥɹɸɬɫɹ ɩɥɨɬɨɹɞɧɵɟ ɢɡ ɫɟɦɟɣɫɬɜɚ Canidae ɢ ɞɥɹ S.giganteaɢ S.medusiformis – Felidae (8)
Ⱥ ɬɚɤɠɟ ɜ əɩɨɧɢɢ ɜɵɹɜɢɥɢ S.mihoensis ɤɚɤ ɩɹɬɵɣ ɜɢɞ Sarcocystis ɭ ɨɜɟɰ ɩɨɪɨɞɵ Corriedale (6).
Ɇɚɬɟɪɢɚɥɵ ɢ ɦɟɬɨɞɵ. ɋɚɪɤɨɰɢɫɬɵ ɛɵɥɢ ɜɵɹɜɥɟɧɵ ɨɛɳɟɩɪɢɧɹɬɵɦɢ ɦɟɬɨɞɚɦɢ ɫ ɩɨɦɨɳɶɸ ɤɨɦɩɪɟɫɫɨɪɢɭɦɚ ɢ ɩɪɟɞɥɨɠɟɧɧɵɦ ɧɚɦɢ ɭɫɤɨɪɟɧɧɵɦ ɦɟɬɨɞɨɦ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ 1ɇ ɪɚɫɬɜɨɪɚ ɯɥɨɪɢɫɬɨɝɨ ɤɚɥɢɣ ɞɥɹ ɤɨɧɬɪɚɫɬɢɪɨɜɚɧɢɹ ɰɢɫɬ.
ɇɚɦɢ ɛɵɥɢ ɢɡɨɥɢɪɨɜɚɧɵ ɦɢɤɪɨɫɚɪɤɨɰɢɫɬɵ ɢɡ ɫɜɟɠɢɯ ɦɵɲɰ ɩɟɪɮɨɪɚɜɚɥɶɧɨɣ ɢɝɥɨɣ ɩɨɞ ɫɬɟɪɟɨɦɢɤɪɨɫɤɨɩɨɦ ɢ ɢɡɭɱɟɧɵ ɫɬɪɭɤɬɭɪɵ ɫɬɟɧɨɤɰɢɫɬ ɜ ɧɚɬɢɜɧɨɦ ɜɢɞɟ.
Ƚɢɫɬɨɫɪɟɡɵ ɛɵɥɢ ɩɪɢɝɨɬɨɜɥɟɧɵ ɢɡ ɫɢɥɶɧɨ ɩɨɪɚɠɟɧɧɵɯ ɫɚɪɤɨɰɢɫɬɚɦɢɦɵɳɰ ɫɟɪɞɰɚ, ɞɢɚɮɪɚɝɦɵ
ɢ ɹɡɵɤɚ. Ɇɵɲɟɱɧɵɟ ɩɪɨɛɵ ɮɢɤɫɢɪɨɜɚɥɢ ɜ 10 %-ɧɨɦ ɡɚɛɭɮɟɪɟɧɧɨɦ ɮɨɪɦɚɥɢɧɟ. ɉɨɫɥɟ ɮɢɤɫɚɰɢɢ
ɦɚɬɟɪɢɚɥ ɨɛɟɡɜɨɠɢɜɚɥɢ ɜ ɫɩɢɪɬɚɯɜɨɫɯɨɞɹɳɟɣ ɤɨɧɰɟɧɬɪɚɰɢɢ, ɩɪɨɩɢɬɵɜɚɥɢ ɩɚɪɚɮɢɧɨɦ ɢ ɩɪɢɝɨɬɨɜɢɥɢ ɫɪɟɡɵ ɫ ɪɚɡɦɟɪɨɦ 5 ɦɤɦ ɧɚ ɫɚɧɧɨɦɦɢɤɪɨɬɨɦɟ, ɩɨɫɥɟ ɱɟɝɨ ɨɤɪɚɲɢɜɚɥɢ ɝɟɦɚɬɨɤɫɢɥɢɧ-ɷɨɡɢɧɨɦ. Ɉɤɪɚɲɟɧɧɵɟ ɦɵɲɟɱɧɵɟ ɫɪɟɡɵ ɢɫɫɥɟɞɨɜɚɥɢ ɫɜɟɬɨɜɵɦ ɦɢɤɪɨɫɤɨɩɨɦ (NIKON Eclipse E400,
əɩɨɧɢɹ).
Ⱦɥɹ ɬɪɚɧɫɦɢɫɫɢɨɧɧɨɣ ɷɥɟɤɬɪɨɧɧɨɣ ɦɢɤɪɨɫɤɨɩɢɢ ɫɢɥɶɧɨɩɨɪɚɠɟɧɧɵɟ ɫ ɦɵɲɰɵ ɮɢɤɫɢɪɨɜɚɥɢ ɜ
4 %-ɧɨɦ ɪɚɫɬɜɨɪɟ ɝɥɭɬɚɪɨɜɨɝɨ ɚɥɶɞɟɝɢɞɚ, ɨɛɟɡɜɨɠɢɜɚɥɢ, ɩɪɨɩɢɬɵɜɚɥɢ ɫɦɨɥɨɣ ɢ ɩɪɢɝɨɬɨɜɢɥɢ ɭɥɶɬɪɚɬɨɧɤɢɟ ɫɪɟɡɵ (90 ɧɦ). ɋɪɟɡɵ ɨɤɪɚɲɢɜɚɥɢ ɪɚɫɬɜɨɪɨɦ ɫɜɢɧɰɚ ɢ ɭɪɚɧɢɥɚ ɚɰɟɬɚɬɚ ɢ ɢɫɫɥɟɞɨɜɚɥɢ
ɬɪɚɧɫɦɢɫɫɢɨɧɧɵɦ ɷɥɟɤɬɪɨɧɧɵɦ ɦɢɤɪɨɫɤɨɩɨɦ (Hitachi H 7000, əɩɨɧɢɹ) ɜ ɞɟɩɚɪɬɚɦɟɧɬɟ ɩɚɬɨɥɨɝɢɢ
ɭɧɢɜɟɫɢɬɟɬɚ Ʉɢɬɚɫɚɬɨ, əɩɨɧɢɹ.
Ɋɟɡɭɥɶɬɚɬɵ ɢ ɨɛɫɭɠɞɟɧɢɟ. ɉɪɢ ɢɡɭɱɟɧɢɢ ɩɪɟɩɚɪɚɬɨɜ ɢɡ ɩɨɩɟɪɟɱɧɨ-ɩɨɥɨɫɚɬɵɯ ɦɵɲɰ ɭ ɦɨɧɝɨɥɶɫɤɢɯ ɨɜɟɰ ɧɚɯɨɞɢɥɢ ɬɨɥɶɤɨ ɰɢɫɬɵ S.tenella. ɋɬɟɧɤɢ ɷɬɢɯ ɰɢɫɬ ɛɵɥɢ ɬɨɥɫɬɵɦɢ ɫ ɪɚɞɢɚɥɶɧɨɣ ɢɫɱɟɪɱɟɧɧɨɫɬɶɸ ɢ ɢɦɟɥɢ ɩɪɹɦɵɟ ɩɚɥɢɫɨɩɨɞɨɛɧɵɟ ɜɵɪɨɫɬɵ (Ɏɨɬɨ 1 ɢ 2).
Ɏɨɬɨ 1
Ɏɨɬɨ 2
Ɍɪɚɧɫɦɢɫɫɢɨɧɧɚɹ ɷɥɟɤɬɪɨɧɧɚɹ ɦɢɤɪɨɝɪɚɮɢɹ S.tenella ɜ ɫɟɪɞɟɱɧɨɣ ɦɵɲɰɟ ɭ ɦɨɧɝɨɥɶɫɤɨɣ ɨɜɰɵ
(ɩɚɥɢɫɨɩɨɞɨɛɧɵɟ ɜɵɪɨɫɬɵ ɢ ɛɪɚɞɢɡɨɢɬ,ɩɨT.Yoshikawa)
(Ɏɨɬɨ1 – ɭɜɟɥɢɱɟɧɢɟ 2000 ɯ 2; Ɏɨɬɨ 2 – ɭɜɟɥɢɱɟɧɢɟ 5000 ɯ 2)
229
ɉɪɢ ɢɫɫɥɟɞɨɜɚɧɢɢ ɧɚɬɢɜɧɵɯ ɰɢɫɬ ɜɵɹɜɢɥɢ 2 ɜɢɞɚ ɫɚɪɤɨɰɢɫɬ: S. tenella ɢ S.arieticanis, ɫɬɟɧɤɚ ɭ ɩɨɫɥɟɞɧɢɯ ɛɵɥɚ ɬɨɧɤɨɣ ɢ ɩɨɤɪɵɬɚ ɜɨɥɨɫɨɩɨɞɨɛɧɵɦɢ ɜɵɪɨɫɬɚɦɢ (Ɏɨɬɨ 3 ɢ 4). ɇɚɦɢ ɯɨɬɟɥɨɫɶ ɛɵ ɩɨɞɱɟɪɤɧɭɬɶ, ɱɬɨ ɬɨɥɶɤɨ ɨɞɢɧ ɫɥɭɱɚɣ, ɬ.ɟ. ɜ ɦɵɲɟɱɧɨɣ ɩɪɨɛɟ ɢɡ ɞɢɚɮɪɚɝɦɵ ɛɵɥ ɜɵɹɜɥɟɧ
S.arieticanis.
ȼɵɜɨɞɵ
Ȼɵɥɨ ɜɵɹɜɥɟɧɨ 2 ɜɢɞɚ ɫɚɪɤɨɰɢɫɬ: S. tenella ɢ S.arieticanis ɭ ɦɨɧɝɨɥɶɫɤɢɯɨɜɟɰ
Ɉɫɧɨɜɧɵɦ ɜɢɞɨɦ ɫɚɪɤɨɰɢɫɬ ɭ ɦɨɧɝɨɥɶɫɤɢɯ ɨɜɟɰ ɹɜɥɹɟɬɫɹ S. tenella.
Ɏɨɬɨ 3
Ɏɨɬɨ 4
Ɏɨɬɨ 3 – S. tenellaɜ ɧɚɬɢɜɧɨɦ ɩɪɟɩɚɪɚɬɟ (ɭɜɟɥɢɱɟɧɢɟ ɯ 400, ɩɨȽ.Ȼɚɬɰɷɰɷɝ)
Ɏɨɬɨ 4 – S.arieticanis ɫ ɜɨɥɨɫɨɩɨɞɨɛɧɵɦɢ ɜɵɪɨɬɚɦɢ ɜ ɦɵɲɰɟ ɞɢɚɮɪɚɝɦɵ (ɭɜɟɥɢɱɟɧɢɟ ɯ800, ɩɨ Ƚ.Ȼɚɬɰɷɰɷɝ)
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
8.
9.
ȻȺɌɐɗɐɗȽ Ƚ. ɂɡɭɱɟɧɢɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢ ɫɟɪɨɞɢɚɝɧɨɫɬɢɤɚ ɬɨɤɫɨɩɥɚɡɦɨɡɚ ɢ ɫɚɪɤɨɫɩɨɪɢɞɢɨɡɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɜ Ɇɨɧɝɨɥɢɢ. Ⱦɢɫɫ.ɧɚ ɫɨɢɫɤɚɧɢɟ ɭɱ.ɫɬɟɩ.ɤɚɧɞ.ɜɟɬɟɪɢɧɚɪɧɵɯ ɧɚɭɤ, ɍɥɚɚɧɛɚɚɬɚɪ, 1993
ȻȺɌɐɗɐɗȽ Ƚ. ɋɚɪɤɨɰɢɫɬɨɡɨɜɟɰ ɜ ɦɨɧɝɨɥɢɢ ɢ ɪɚɡɪɚɛɨɬɤɚ ɧɨɜɵɯ ɦɟɬɨɞɨɜ ɟɝɨ ɢɦɦɭɧɨɞɢɚɝɧɨɫɬɢɤɢ.
Ⱦɢɫɫ.ɧɚ ɫɨɢɫɤɚɧɢɟ ɭɱ.ɫɬɟɩ.ɞɨɤɬɨɪɚ ɜɟɬɟɪɢɧɚɪɧ ɵɯɧɚɭɤ, ɍɥɚɚɧɛɚɚɬɚɪ, 2003
ȼȿɊɒɂɇɂɇ ɂ.ɂ. ɉɟɫɰɵ-ɨɤɨɧɱɚɬɟɥɶɧɵɟ ɯɨɡɹɟɜɚ ɦɢɤɪɨɰɢɫɬ ɨɜɟɰ. ȼ ɤɧɢɝɟ: Ⱦɨɫɬɢɠɟɧɢɹ ɧɚɭɤɢ ɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ. Ɍɟɡɢɫɵ ɞɨɤɥɚɞɨɜ VII ɋɜɟɪɞɥɨɜɫɤɨɣ ɤɨɧɮɟɪɟɧɰɢɢ ɇɌɈ. –ɋɜɟɪɞɥɨɜɫɤ,
1977, ɫ. 12
ȽȺȾȺȿȼ Ⱥ. ɋɚɪɤɨɰɢɫɬɵ ɞɨɦɚɲɧɢɯ ɠɢɜɨɬɧɵɯ ɍɡɛɟɤɢɫɬɚɧɚ. –Ⱥɜɬɨɪɟɮ. Ⱦɢɫ. …ɤɚɧɞ. ɛɢɨɥ. ɧɚɭɤ. Ɍɚɲɤɟɧɬ, 1978, ɫ. 24
ɁȺɋɍɏɂɇ Ⱦ.ɇ. ɋɚɪɤɨɰɢɫɬɨɡ ɠɢɜɨɬɧɵɯ. – ȼɟɬɟɪɢɧɚɪɢɹ, 1972, ʋ1, ɫ.49–55
SAITO Ɇ., SHIBATA Y., KUBO M. and ITAGAKI H.. Sarcocystismihoensisn.sp.from sheep in Japan. J.Vet.
Med.Sci. 59: 103–106, 1997
ɏȺɇ ɇ.Ƚ. ɗɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɣ ɫɚɪɤɨɰɢɫɬɨɡ ɨɜɟɰ. Ⱦɢɫɫ. ɧɚ ɫɨɢɫɤɚɧɢɟ ɭɱ, ɫɬɟɩ. ɤɚɧɞ. ɛɢɨɥ. ɧɚɭɤ. ȺɥɦɚȺɬɚ, 1986
Dubey J.P. Coyote as a final host for Sarcocystis species of goats, sheep, cattle, yak, bison and moose in
Montane. –Am. J. Vet. Res., 1980, v.41, No 8, p. 1227–1229
DUBEY, J.P., C.A. SPEER and R.FAYER. 1989. Sarcocystosis of animals and man. CRC Press, Boca Raton,
Florida.
ȼɅɂəɇɂȿ ɄɅɂɆȺɌɂɑȿɋɄɈȽɈ ɂɁɆȿɇȿɇɂə ɇȺ ɁȾɈɊɈȼɖȿ
ɉȺɋɌȻɂɓɇɕɏ ɀɂȼɈɌɇɕɏ ɂɉɂɓȿȼɍɘ ȻȿɁɈɉȺɋɇɈɋɌɖ
ȻɍəɇɌɈȽɌɈɏ ɑ., ȻəɆȻȺɀȺȼ ɐ., ɀȺȼɁȺɇȾɈɅȽɈɊ ɐ., ȽȺɇȻɈɅȾ ə.,
Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ, ɇɂɂ ɜɟɬɟɪɢɧɚɪɧɵɣ ɦɟɞɢɰɢɧɵ,
ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ, chbuyan@yahoo.com
ABSTRACT
Ʉey words: settled camp of gers, soil,plantation, water, micro element and heavy metal
Purpose:In this research we have determined impact of activities of the settled herders on soil, water
and plantation of degraded pasture land caused by distortion of technology of cattle breeding, content of
some chemicals in blood serum of livestock as well as plantation number and cover.
Conclusions:1. Grazing crop of the settled camp of gers is less by 3-6 species and cover size is less by
8–10 percent compared to the control area.
230
2. It has been determined that content of Cu, Co, Se, Pb in soil and plant of pasture land of the settled
camp of gersin close pasture land, Zn, Feis the least in close and middle pasture lands and the most
in remote pasture land.But copper contained in water is higher by 0.132 ppm than the internationally
accepted highest level, zinc is less by 0.233 ppm and iron, cobalt, selenium and lead is 2–7 times more
than the permissible highest level.
3. Copper, zinc, cobalt and iron contained in the blood serum of the livestock of the settled camp of gers
is less than normal psychological amount and selenium and lead are higher than the permissible amount.
4.Content selenium and lead in food products from settled camp of gers is expected to be high.
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: ɦɢɪɨɜɨɟ ɩɨɬɟɩɥɟɧɢɟ, ɩɚɫɬɛɢɳɧɨɟ ɠɢɜɨɬɧɨɟ, ɝɭɪɬ, ɩɨɱɜɚ, ɪɚɫɬɟɧɢɟ, ɫɵɜɨɪɨɬɤɚ, ɦɢɤɪɨɷɥɟɦɟɧɬɵ, ɬɹɠɺɥɵɟ ɦɟɬɚɥɥɵ
ȼɜɟɞɟɧɢɟ. ɉɚɫɬɛɢɳɧɵɟ ɪɚɫɬɟɧɢɹ ɜ Ɇɨɧɝɨɥɢɢ ɪɚɫɬɭɬ ɜ ɬɟɱɟɧɢɢ 5 ɦɟɫɹɰɟɜ, ɚ ɫ ɞɪɭɝɨɣ ɫɬɨɪɨɧɵ
ɜ ɨɫɧɨɜɧɨɦ ɥɸɞɢ ɡɚɧɢɦɚɸɬɫɹ ɩɚɫɬɛɢɳɧɵɦ ɠɢɜɨɬɧɨɜɨɞɫɬɜɨɦ, ɩɨɷɬɨɦɭ ɩɨ ɤɥɚɫɫɚɮɢɤɚɰɢɢ Sere,
Steinfeld [7], ɩɚɫɬɛɢɳ ɨɬɧɨɫɢɬɫɹ ɤ ɫɭɯɨɣ ɢ ɩɨɞɫɭɯɨɣ ɫɢɫɬɟɦɟ, ɬɟɦ ɫɚɦɵɦ ɧɚ ɷɬɨ ɨɱɟɧɶ ɫɢɥɶɧɨ ɜɥɢɹɸɬ ɮɚɤɬɨɪɵ ɤɥɢɦɚɬɢɱɟɫɤɨɝɨ ɢɡɦɟɧɟɧɢɹ. Ⱥɤɬɭɚɥɶɧɵɦ ɜɨɩɪɨɫɨɦ ɜɥɢɹɧɢɹ ɨɫɧɨɜɧɵɯ ɮɚɤɬɨɪɨɜ ɤɥɢɦɚɬɢɱɟɤɨɝɨ ɢɡɦɟɧɟɧɢɹ ɹɜɥɹɟɬɫɹ ɩɨɞɜɟɪɠɟɧɢɟ ɡɞɨɪɨɜɶɹɥɸɞɟɣ ɱɟɪɟɡ ɩɢɳɟɜɵɦɢ ɩɪɨɞɭɤɬɚɦɢ ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ.
ȼ ɩɨɫɥɟɞɧɵɟ ɝɨɞɵ ɫɪɟɞɧɟɝɨɞɨɜɨɟ ɩɨɬɟɩɥɟɧɢɟ ɜ Ɇɨɧɝɨɥɢɢ ɭɜɟɥɢɱɢɥɫɹ ɧɚ 2.14 ɝɪɚɞɭɫɚ, ɧɨ ɜ
ɡɢɦɧɢɟ ɜɪɟɦɟɧɢ ɟɳɟ ɫɬɚɥɨ ɯɨɥɨɞɧɟɟ. ɉɨ ɭɱɟɬɭ ɩɨɜɟɪɯɧɨɫɬɧɵɯ ɜɨɞɧɵɯ ɪɟɫɭɪɫɨɜ /2003–2007 ɝɝ./
ɜɵɫɨɯɥɢ 852 ɪɟɤ ɢ ɪɭɱɟɟɤ ɢɡ 5128, 2277 ɪɨɞɧɢɤɨɜ ɢ ɦɢɧɟɪɢɚɥɶɧɵɯ ɢɫɬɨɱɧɢɤɨɜ ɢɡ 9306 ɢ 1181 ɨɡɟɪɨɜ ɢ ɩɪɭɞɨɜ ɢɡ 3747.
ɉɨ ɞɚɧɧɵɦ ɢɡɭɱɟɧɢɹ ɢɧɬɟɧɫɢɜɧɨɫɬɶ ɜɥɢɹɸɳɢɯ ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɮɚɤɬɨɪɨɜ ɧɚ ɫɬɟɩɧɭɸ ɢ ɥɟɫɨɫɬɟɩɧɭɸ ɡɨɧɭ ȼɧɭɬɪɟɧɧɨɣ Ɇɨɧɝɨɥɢɢ ɄɇɊ, Ɂɚɛɚɣɤɚɥɶɹ Ɋɨɫɫɢɢ ɢ Ɇɨɧɝɨɥɢɢ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɱɢɫɥɨ
ɝɢɞɪɨɮɢɥɶɧɵɯ ɪɚɫɬɟɧɢɣ ɭɦɟɧɶɲɢɥɫɹ, ɚ ɱɢɫɥɨ ɤɫɟɪɨɮɢɬɧɵɯ ɪɚɫɬɟɧɢɣ ɭɜɟɥɢɱɢɥɫɹ. ɋɥɟɞɨɜɚɬɟɥɶɧɨ,
ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɪɚɫɬɟɧɢɣ ɫɧɢɠɟɧɚ ɧɚ 1.4- 7.0 % [5].
Ɂɚɜɢɫɢɦɨ ɨɬ ɨɫɨɛɟɧɧɨɫɬɟɣ ɨɩɪɟɞɟɥɺɧɧɵɯ ɬɟɪɪɢɬɨɪɢɢ ɢ ɩɚɫɬɛɢɳɧɵɯ ɭɝɨɞɢɣ ɩɨɜɫɟɦɟɫɬɧɨ ɪɟɝɢɫɬɪɢɪɭɸɬɫɹ ɷɧɞɟɦɢɱɟɫɤɢɟ ɛɨɥɟɡɧɢ, ɚ ɬɚɤɠɟ ɬɨɤɫɢɱɟɫɤɢɟ ɛɨɥɟɡɧɢ ɨɬ ɪɚɫɬɢɬɟɥɶɧɵɯ ɹɞɨɜ[3].
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɦɵ ɢɡɭɱɢɥɢ ɫɬɟɩɟɧɶ ɪɚɡɜɚɥɚ ɢ ɪɚɫɬɢɬɟɥɶɧɨɫɬɢ ɩɚɫɬɛɢɳɚ, ɫɨɞɟɪɠɚɧɢɟ ɧɟɤɨɬɨɪɵɯ
ɷɥɟɦɟɧɬɨɜ ɜ ɤɪɨɜɢ ɠɢɜɨɬɧɵɯ ɢ ɪɚɫɬɟɧɢɢ, ɜɨɞɟ ɢ ɩɨɱɜɟ, ɤɨɬɨɪɵɟ ɦɨɝɭɬ ɢɡɦɟɧɢɬɶɫɹ ɩɨɞ ɞɟɣɫɬɜɢɟɦ
ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɮɚɤɬɨɪɨɜ ɜ ɩɟɪɢɨɞ ɩɨɬɟɩɥɟɧɢɹ.
Ɇɟɬɨɞɵ ɢ ɦɟɬɨɞɢɤɚ ɢɫɫɥɟɞɨɜɚɧɢɣ.
Ɉɛɴɟɤɬ ɢɡɭɱɟɧɢɹ: Ȼɵɥ ɜɵɛɪɚɧ ɝɭɪɬ ɩɨɞ ɝɥɚɜɨɣ ɫɤɨɬɨɜɨɞɚ Ȼ.ɗɧɯɛɨɥɞɚ ɫɨɦɨɧɚ ȿɪoo ɋɟɥɟɧɝɢɣɫɤɨɝɨ
ɚɣɦɚɤɚ ɢ ɢɯ ɩɚɫɬɛɢɳɟ ɜ ɪɚɞɢɭɫɚɯ 0,5–2 ɤɦ, 3-5 ɤɦ ɢ 8–10 ɤɦ. ȼ ɷɬɢɯ ɡɨɧɚɯ ɦɵ ɛɪɚɥɢ ɩɪɨɛɵ: 1–3
ɤɝ ɨɬ ɪɚɫɬɟɧɢɣ, 3-5 ɤɝ ɨɬ ɩɨɱɜɵ ɢ 2 ɥ ɨɬ ɜɨɞɵ 3 ɪɚɡɚ ɜ ɢɸɧɟ 2011–2013 ɝɝ.ɂɫɩɨɥɶɡɨɜɚɥɢ ɫɵɜɨɪɨɬɤɢ
138 ɠɢɜɨɬɧɵɯ, ɜ ɬɨɦ ɱɢɫɥɟ 60 ɝɨɥɨɜ ɤɨɡ, 60 ɝɨɥɨɜ ɨɜɟɰ ɢ 18 ɝɨɥɨɜ ɤɨɪɨɜ.ɋɨɞɟɪɠɚɧɢɟ ɯɢɦɢɱɟɫɤɢɯ
ɷɥɟɦɟɧɬɨɜ ɨɩɪɟɞɟɥɢɥɢ ɜ ɩɪɨɛɚɯ ɩɨɱɜɵ /45/, ɪɚɫɬɟɧɢɣ /45/ ɢ ɜɨɞɵ /3/.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ. ȼ ɩɚɫɬɛɢɳɟ, ɜɵɛɪɚɧɧɨɟ ɤ ɢɫɫɥɟɞɨɜɚɧɢɸ, ɩɪɟɨɛɥɚɞɚɸɬ ɝɨɪɧɚɹ ɫɬɟɩɶ,
ɥɭɝɚ, ɞɨɥɢɧɚ ɪɟɤɢ ɢ ɪɚɫɬɢɬɟɥɶɧɨɫɬɶ ɪɚɡɧɨɝɨɪɨɞɚ, ɜ ɬɨɦ ɱɢɫɥɟ ɤɨɜɵɥɶ ɜɨɥɨɫɚɬɢɤ.
ȼ ɭɫɥɨɜɢɹɯ ɝɭɪɬɨɜɨɝɨ ɯɨɡɹɣɫɬɜɚ ɜɢɞɨɜɨɣ ɫɨɫɬɚɜ ɪɚɫɬɟɧɢɣ ɢ ɪɚɫɬɢɬɟɥɶɧɚɹ ɩɨɜɟɪɯɧɨɫɬɶ ɡɚɜɢɫɢɦɨ ɨɬ ɩɚɫɭɳɢɯ ɪɚɫɫɬɨɹɧɢɣ ɫɨɫɬɚɜɥɹɸɬ ɤɚɤ ɫɥɟɞɭɸɳɢɟ: ɜ ɛɥɢɡɤɨɦ ɪɚɫɫɬɨɹɧɢɢ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ-/500
ɦ/ ɧɚ 1 ɤɜɚɞɪɚɬɧɨɦ ɦɟɬɪɟ 3 ɢ 429, ɜ ɫɪɟɞɧɨɦ ɪɚɫɫɬɨɹɧɢɣ /3000 ɦ/- 7 ɢ 47, ɚ ɧɚ ɞɚɥɶɧɟɣɲɟɦ ɪɚɫɫɬɨɹɧɢɢ/5000 ɦ/- 10 ɢ 54 %. Ɍɨɝɞɚ ɞɚɧɧɵɟ ɤɨɧɬɪɨɥɶɧɵɯ/ɡɢɦɨɜɤɚ/ ɭɱɚɫɬɨɤ ɩɪɟɞɫɬɚɜɥɹɸɬ ɩɪɢɦɟɪɧɨ: ɧɚ
500 ɦ – 6 ɢ 51 %, ɧɚ 3000 ɦ – 11 ɢ 57 %, ɚ ɧɚ 5000 ɦ-15 ɢ 62 %.
ȼ ɬɚɛɥɢɰɟ 1 ɩɪɟɞɫɬɚɜɥɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɨɩɪɟɞɟɥɟɧɢɹ ɦɟɞɢ ɢ ɰɢɧɤɚ ɜ ɩɪɨɛɚɯ ɩɚɫɬɛɢɳɧɵɯ ɪɚɫɬɟɧɢɣ, ɜɡɹɬɵɯ ɜɵɛɪɚɧɧɨɣ ɬɨɱɤɢ ɨɤɨɥɚ ɝɭɪɬɚ.
Ɍɚɛɥɢɰɚ 1
Ʉɨɥɢɱɟɫɬɜɨ ɧɟɤɨɬɨɪɵɯ ɯɢɦɢɱɟɫɤɢɯ ɷɥɟɦɟɧɬɨɜ, ɫɨɞɟɪɠɚɳɢɯɫɹ ɜ ɩɚɫɬɛɢɳɧɵɯ ɪɚɫɬɟɧɢɹɯ /ppm/
ɇɚɡɜɚɧɢɟ
ɷɥɟɦɟɧɬɨɜ
Ɇɟɞɶ(Cu)
ɐɢɧɤ(Zn)
ɉɚɫɬɛɢɳɟ ɛɥɢɡɤɨ- ɉɚɫɬɛɢɳɟ ɫɪɟɞɧɨɝɨ ɉɚɫɬɛɢɳɟ ɞɚɥɶɧɨɝɨ
ɝɨ ɪɚɫɫɬɨɹɧɢɹ
ɪɚɫɫɬɨɹɧɢɹ
ɪɚɫɫɬɨɹɧɢɹ
0.386±0.01
0.751±0.012
12.53±1.01
1.242±0.02
1.127±0.02
7.786±0.91
ɉɨ ȼ.ȼ.Ʉɨɜɚɥɶɫɤɨɦɭ, /1970/
3–12 ɦɝ/ɤɝ
20–60 ɦɝ/ɤɝ
ɀɟɥɟɡɨ(Fe)
1.344±0.02
0.684±0.01
5.962±0.62
24-30 ɦɝ/ɤɝ
Ʉɨɛɚɥɶɬ (Co)
0.266±0.01
0.352±0.01
0.454±0.01
0.25–1.0 ɦɝ/ɤɝ
ɋɟɥɟɧ(Se)
0.192±0.01
0.27±0.01
0.286±0.01
0.1–2.0ɦɝ/ɤɝ<
ɋɜɢɧɟɰ (Pb)
0.309±0.01
0.383±0.01
1.193±0.002
90–300 EU Stand 100 MN Stand
ɂɡ ɬɚɛɥɢɰɵ ɜɢɞɧɨ, ɱɬɨ ɫɨɞɟɪɠɚɧɢɟ ɦɟɞɢ ɪɚɜɧɨ ɢ ɦɚɥɨ ɩɨ ɫɪɚɜɧɟɧɢɢ ɞɚɧɧɵɯ [1] ɢɫɫɥɟɞɨɜɚɬɟɥɟɣ,
ɚ ɞɪɭɝɢɟ ɷɥɟɦɟɧɬɵ ɜ ɧɨɪɦɚɥɶɧɨɦ ɤɨɥɢɱɟɫɬɜɟ.
231
ȼ ɬɚɛɥɢɰɟ 2 ɩɪɟɞɫɬɚɜɥɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɨɩɪɟɞɟɥɟɧɢɹ ɦɢɤɪɨɷɥɟɦɟɧɬɨɜ ɢ ɬɹɠɺɥɵɯ ɦɟɬɚɥɥɨɜ ɜ ɩɪɨɛɚɯ ɩɨɱɜɵ. ɂɡ ɬɚɛɥɢɰɵ ɜɢɞɧɨ, ɱɬɨ ɫɨɞɟɪɠɚɧɢɟ ɦɟɞɢ, ɤɨɛɚɥɶɬɚ, ɫɟɥɟɧɚ ɢ ɫɜɢɧɰɚ ɭɜɟɥɢɱɢɜɚɸɬɫɹ ɨɬ
ɛɥɢɡɤɢɯ ɤ ɞɚɥɶɧɟɣɳɟɦɭ ɪɚɫɫɬɨɹɧɢɸ, ɚ ɩɨ ɨɬɧɨɲɟɧɢɸ ɰɢɧɤɚ ɡɚɦɟɬɧɨ ɧɟ ɢɡɦɟɧɟɧɨ, ɜ ɷɬɨɦ ɧɚɛɥɸɞɚɥɢɫɶ, ɱɬɨ ɤɨɥɢɱɟɫɬɜɨ ɠɟɥɟɡɚ ɧɟ ɫɬɚɛɢɥɶɧɨ.
Ɍɚɛɥɢɰɚ 2
ɋɨɞɟɪɠɚɧɢɟ ɧɟɤɨɬɨɪɵɯ ɦɢɤɪɨɷɥɟɦɟɧɬɨɜ ɢ ɬɹɠɺɥɵɯ ɦɟɬɚɥɥɨɜ ɜ ɩɨɱɜɚɯ ɩɚɫɬɛɢɳɚ, ppm
ɇɚɡɜɚɧɢɟ ɷɥɟɦɟɧɬɨɜ
(ppm)
Ɇɟɞɶ(Cu)
ɉɚɫɬɛɢɳɟ ɛɥɢɡɤɨɝɨ
ɪɚɫɫɬɨɹɧɢɹ
0.84±0.01
ɉɚɫɬɛɢɳɟ ɫɪɟɞɧɨɝɨ ɉɚɫɬɛɢɳɟ ɞɚɥɶɧɨɝɨ
ɪɚɫɫɬɨɹɧɢɹ
ɪɚɫɫɬɨɹɧɢɹ
0.906±0.012
1.905±0.001
Ɋɚɡɪɟɲɚɸɳɨɟ ɦɚɤɫɢɦɚɥɶɧɨɟ ɤɨɥɢɱɟɫɬɜɨ, ɦɝ/ɤɝ
24.7–38.0+
ɐɢɧɤ(Zn)
4.416±0.02
3.594±0.002
4.599±0.312
60+
ɀɟɥɟɡɨ(Fe)
1130.685±0.9
332.937±0.9
656.604±0.9
ɧɟ ɧɚɲɥɨɫɶ
Ʉɨɛɚɥɶɬ (Co)
1.581±0.02
2.913±0.01
4.224±0.01
50 MNS
ɋɟɥɟɧ(Se)
0.456±0.01
0.774±0.01
2.679±0.01
ɋɜɢɧɟɰ (Pb)
0.528±0.01
1.224±0.01
2.541±0.01
10 MNS 5850 : 2008
90–300 EU Stand
100 MN Stand
ɇɨɪɦɚ ɜ ɩɨɱɜɚɯ Ɇɨɧɝɨɥɢɢ [2]
+
Ɋɟɡɭɥɶɬɚɬɟ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɤɚɡɵɜɚɸɬ, ɱɬɨ ɫɨɞɟɪɠɚɧɢɟ ɰɢɧɤɚ ɯɨɬɹ ɦɚɥɨ ɱɟɦ ɞɚɧɧɵɯ [1] ɞɪɭɝɢɯ ɚɣɦɚɤɨɜ /Ⱥɪɯɚɧɝɚɣ 54±14, Ȼɚɹɧɯɨɧɝɨɪ 60±12, Ɂɚɜɯɚɧ 63±2 ɦɝ/ɤɝ/, ɧɨ ɧɟɞɨɫɬɢɝɥɨ ɤ ɧɟɞɨɫɬɚɬɤɟ
/<3 ɦɝ/ɤɝ/, ɚ ɤɨɥɢɱɟɫɬɜɨ ɦɟɞɢ, ɤɨɛɚɥɶɬɚ ɢ ɫɟɥɟɧɚ ɜɢɞɧɨ ɧɟ ɞɨɫɬɚɬɨɱɧɨ.
ȼ ɬɚɛɥɢɰɟ 3 ɩɪɟɞɫɬɚɜɥɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɨɩɪɟɞɟɥɟɧɢɹ ɦɢɤɪɨɷɥɟɦɟɧɬɨɜ ɢ ɬɹɠɺɥɵɯ ɦɟɬɚɥɥɨɜ ɜ ɫɵɜɨɪɨɬɤɚɯ ɤɪɨɜɢ.
Ɍɚɛɥɢɰɚ 3
Ʉɨɥɢɱɟɫɬɜɨ ɦɢɤɪɨɷɥɟɦɟɧɬɨɜ ɢ ɬɹɠɺɥɵɯ ɦɟɬɚɥɥɨɜ, ɫɨɞɟɪɠɚɳɢɯɫɹ ɜ ɫɵɜɨɪɨɬɤɚɯ/ppm/
ɇɚɡɜɚɧɢɟ ɷɥɟɦɟɧɬɨɜ
Ʉɨɡɵ
Ɉɜɰɵ
ɋɚɦɟɰ n=30
Ʉɨɪɨɜɵ
n=18
ɇɨɪɦ-ɧɨɟ
ɤɨɥ-ɜɨ
97.9±3.11
88.8±3.25
75.7±3.22
ɯ1000–1300
112.8±4.21
114.8±4.21
81.0±3,32
135.±0.24
222.0±0.45
37.9±0.06
46.9±0.06
42.7±0.06
ԛ800–1400
ԛ130000–
250000
ɯ100–120
30.9±0.05
39.4±0.06
53.2±0.2
ԛ0.07-0.1
61.5±0.08
58.2±0.09
+0.05-0.23
ɋɚɦɤɚ n=30
ɋɚɦɟɰ n=30
Ɇɟɞɶ(Cu)
83.9±2.1
60.1±1.25
ɐɢɧɤ(Zn)
105.6±3.2
82.7±2.35
ɀɟɥɟɡɨ(Fe)
124.4±0.08
169.1±0.6
204.3±0.24
Ʉɨɛɚɥɶɬ(Co)
41.5±0.05
26.1±0.4
ɋɟɥɟɧ(Se)
33.0±0.1
26.7±0.05
ɋɜɢɧɟɰ (Pb)
57.4±2.2
53.7±0.13
53.7±0.09
+
ɋɚɦɤɚ n=30
– V. Rajaganapathy [6], ԛ Ʉɨɪɨɜɵ – Anderson, D. E. [3], ɯɨɜɰɵ – [1]
ɂɡ ɬɚɛɥɢɰɵ ɜɢɞɧɨ, ɱɬɨ ɤɨɥɢɱɟɫɬɜɨ ɦɟɞɢ, ɰɢɧɤɚ, ɠɟɥɟɡɚ ɢ ɤɨɛɚɥɶɬɚ ɧɢɠɟ ɧɨɪɦɵ, ɚ ɤɨɥɢɱɟɫɬɜɨ
ɫɟɥɟɧɚ ɢ ɫɜɢɧɰɚ ɜɵɲɟ ɧɨɪɦɵ ɜ ɫɵɜɨɪɨɬɤɚɯ ɤɪɨɜɢ ɨɜɟɰ, ɤɨɡ ɢ ɤɨɪɨɜ.
ɇɟɞɨɫɬɚɬɤɚ ɦɟɞɢ ɜɵɪɚɠɟɧɚ [1], ɟɫɥɢ ɤɨɥɢɱɟɫɬɜɨ ɟɝɨ ɭɜɟɥɢɱɟɧɨ ɧɚ 2–3 ɪɚɡɚ ɱɟɦ ɧɨɪɦɵ, ɚ ɜ ɧɚɲɟɦ ɫɥɭɱɚɟ ɩɪɟɜɵɲɟɧɨ ɞɚɠɟ ɧɚ 10–16 ɪɚɡɨɜ, ɱɬɨ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɨ ɟɝɨ ɧɟɞɨɫɬɚɬɤɟ ɜ ɫɵɜɨɪɨɬɤɚɯ
ɨɩɵɬɧɵɯ ɠɢɜɨɬɧɵɯ.
Ɇɵ ɛɪɚɥɢ ɩɪɨɛɵ ɜɨɞɵ ɨɬ ɪɟɤɢ ȿɪoo, ɤɨɬɨɪɵɟ ɧɚɛɪɚɥɢ ɜ ɬɨɦ ɦɟɫɬɟ, ɨɬɤɭɞɚ ɠɢɜɨɬɧɵɟ ɩɶɸɬ ɤɚɠɞɵɣ ɞɟɧɶ.
Ɍɚɛɥɢɰɚ 4
ɋɨɞɟɪɠɚɧɢɟ ɧɟɤɨɬɨɪɵɯ ɷɥɟɦɟɧɬɨɜ, ɨɩɪɟɞɟɥɟɧɧɵɯ ɜɨ ɜɨɞɟ ɪɟɤɢ ȿɪoo/ppm/
Ɋɚɡɪɟɳɚɸɳɨɟ ɦɚɤɫɢɦɚɥɶɧɨɟ ɤɨɥɢɱɟɫɬɜɨ, ɦɝ/ɥ
ȼɈɁ [4]
ɋɒȺ
ɇɚɡɜɚɧɢɟ
ɷɥɟɦɟɧɬɨɜ
Ʉɨɥɢɱɟɫɬɜɨ
Ɇɟɞɶ(Cu)
1.132±0.02
1.0
2
1.3
5
Ɇɨɧɝɨɥɢɹ
ɐɢɧɤ(Zn)
0.767±0.001
1.0
5–15
ɀɟɥɟɡɨ(Fe)
1.353±0.02
-
0.3
Ʉɨɛɚɥɶɬ (Co)
0.484±0.001
-
ɋɟɥɟɧ(Se)
0.346±0.001
-
0.01
ɋɜɢɧɟɰ (Pb)
0.728±0.01
-
0.1-0.05ppm
232
ȿɋ
2
0.2
-
ɂɡ ɬɚɛɥɢɰɵ ɜɢɞɧɨ, ɱɬɨ ɤɨɥɢɱɟɫɬɜɨ ɦɟɞɢ ɜ ɜɨɞɟ 1.132 ppm, ɬɨ ɟɫɬɶ ɛɨɥɶɲɟ ɧɚ 0.132 ppm, ɚ ɤɨɥɢɱɟɫɬɜɨ ɰɢɧɤɚ ɦɟɧɶɲɟ ɧɚ 0.233 ppm, ɚ ɬɚɤɠɟ ɤɨɥɢɱɟɫɬɜɨ ɠɟɥɟɡɚ, ɤɨɛɚɥɶɬɚ, ɫɟɥɟɧɚ ɢ ɫɜɢɧɰɚ ɜɵɲɟ ɧɚ
2–7, ɱɟɦ ɪɚɡɪɟɲɚɸɳɟɝɨ ɦɚɤɫɢɦɚɥɶɧɨɝɨ ɤɨɥɢɱɟɫɬɜɚ.
ȼɕȼɈȾɕ:
1. ȼɢɞɨɜɨɣ ɫɨɫɬɚɜ ɩɚɫɬɛɢɳɧɵɯ ɪɚɫɬɟɧɢɣ ɛɵɥ ɧɢɠɟ ɧɚ 3-6 %, ɚ ɪɚɫɬɢɬɟɥɶɧɵɣ ɩɨɤɪɨɜ – ɦɟɧɶɲɟ
ɧɚ 8- 10 % ɩɨ ɫɪɚɜɧɟɧɢɢ ɫ ɤɨɧɬɪɨɥɶɧɵɦ ɩɨɥɟɦ.
2. Ʉɨɥɢɱɟɫɬɜɨ ɦɟɞɢ, ɤɨɛɚɥɶɬɚ, ɫɟɥɟɧɚ ɢ ɫɜɢɧɰɚ ɜ ɩɨɱɜɚɯ ɢ ɪɚɫɬɟɧɢɹɯ ɛɵɥɨ ɦɚɤɫɢɦɚɥɶɧɨ ɧɢɠɟ ɜ
ɛɥɢɡɤɢɯ ɪɚɫɫɬɨɹɧɢɹɯ, ɚ ɰɢɧɤɚ ɢ ɠɟɥɟɡɚ ɜ ɛɥɢɡɤɢɯ ɢ ɫɪɟɞɧɵɯ ɪɚɫɫɬɨɹɧɢɹɯ ɛɵɥɨ ɦɚɤɫɢɦɚɥɶɧɨ ɧɢɠɟ
ɢ ɦɚɤɫɢɦɚɥɶɧɨ ɛɨɥɶɲɟ ɜ ɞɚɥɶɧɵɯ ɪɚɫɫɬɨɹɧɢɹɯ.
3. Ʉɨɥɢɱɟɫɬɜɨ ɦɟɞɢ ɜ ɜɨɞɟ ɛɵɥɨ ɛɨɥɶɲɟ ɧɨɪɦɚɬɢɜɚ, ɚ ɰɢɧɤɚ ɦɟɧɶɲɟ ɧɨɪɦɵ, ɨɫɬɚɥɶɧɵɟ ɷɥɟɦɟɧɬɵ ɛɨɥɶɲɟ ɱɟɦ ɧɚ 2–7.
4. ɋɨɞɟɪɠɚɧɢɟ ɦɟɞɢ, ɰɢɧɤɚ, ɤɨɛɚɥɶɬɚ ɢ ɠɟɥɟɡɚ ɜ ɫɵɜɨɪɨɬɤɚɯ ɤɪɨɜɢ ɠɢɜɨɬɧɵɯ ɧɢɠɟ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ, ɚ ɫɟɥɟɧɚ ɢ ɫɜɢɧɰɚ ɛɨɥɶɲɟ ɟɺ.
5. ɋɥɟɞɨɜɚɬɟɥɶɧɨ, ɤɨɥɢɱɟɫɬɜɨ ɫɟɥɟɧɚ ɢ ɫɜɢɧɰɚ ɜ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɚɯ ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ
ɦɨɠɟɬ ɭɜɟɥɢɱɢɜɚɬɶɫɹ ɜ ɝɭɪɬɚɯ, ɤɨɬɨɪɵɟ ɩɨɫɟɥɹɸɬɫɹɶ ɤɪɭɝɥɵɣ ɝɨɞ ɜ ɨɞɧɨɦ ɦɟɫɬɟ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
ɋɨɞɧɨɦɞɚɪɠɚɚ Ⱥ, ɋɨɞɧɨɦɞɚɪɠɚɚ Ɋ, ɗɪɞɷɧɷɰɷɰɷɝ ɋ., ɗɧɞɟɦɢɱɟɫɤɢɟ ɛɨɥɟɡɧɢ ɠɢɜɨɬɧɵɯ ɜ Ɇɨɧɝɨɥɢɢ, ɍȻ,
2012.
Ʉɚɱɟɫɬɜɨ ɩɨɱɜɵ. Ɇɚɤɫɢɦɚɥɶɧɨɟ ɤɨɥɢɱɟɫɬɜɨ ɜɟɳɟɫɬɜ ɢ ɷɥɟɦɟɧɬɨɜ, ɡɚɝɪɹɡɧɹɸɳɢɯɫɹ ɩɨɱɜɭ. MNS 5850:
2008
Anderson, D. E. and Rings M. (2009) Current Veterinary Therapy: Food Animal Practice St. Louis, MO:
Saunders Elsevier.
ftp://ftp.fao.org/docrep/fao/010/A0701E/A0701E00.pdf
PCC, 2007, Climate change 2007: http://www.ipcc.cs/SPM13apr07.pdf
Rajaganapathy, F. Xavier, D. Sreekumar and P.K. Mandal, 2011. Heavy Metal Contamination in Soil, Water
and Fodder and their Presence in Livestock and Products: A Review. Journal of Environmental Science and
Technology, 4: 234–249.
Steinfeld H. et al., Livestock’s long shadow: FAO, Italy, 2007,pp. 37–54
ɍȾɄ: 619:615.06.284
ɉɊɈȼɈɄȺɐɂə ȽɁɌ ɇȺ ɆɈȾȿɅɂ ɅȺȻɈɊȺɌɈɊɇɕɏ ɄɊɕɋ
ȺȼȿɊɆȿɄɌɂɇɋɈȾȿɊɀȺɓɂɆɂ ɉɊȿɉȺɊȺɌȺɆɂ
ȼɈɊɈɇɐɈȼȺ Ⱥ.Ⱥ., ȽȿɊɍɇɈȼȺ Ʌ.Ʉ.,
ɎȽȻɈɍ ȼɉɈ ɈɦȽȺɍ ɢɦ.ɉ.Ⱥ. ɋɬɨɥɵɩɢɧɚ, ɝ. Ɉɦɫɤ, Ɋɨɫɫɢɹ, e-mail: vovk_1987@mail.ru
ȼɜɟɞɟɧɢɟ. ɋɬɪɟɦɢɬɟɥɶɧɨɟ ɪɚɡɜɢɬɢɟ ɯɢɦɢɱɟɫɤɨɣ ɢ ɮɚɪɦɚɰɟɜɬɢɱɟɫɤɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ ɜ ɫɨɜɪɟɦɟɧɧɵɯ ɭɫɥɨɜɢɹɯ ɜɟɞɟɬ ɤ ɢɧɬɟɧɫɢɜɧɨɣ ɯɢɦɢɡɚɰɢɢ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ. ɉɨɷɬɨɦɭ ɚɤɬɭɚɥɶɧɨɣ ɩɪɨɛɥɟɦɨɣ ɹɜɥɹɟɬɫɹ ɜɨɡɞɟɣɫɬɜɢɟ ɯɢɦɢɱɟɫɤɢɯ ɜɟɳɟɫɬɜ ɧɚ ɨɪɝɚɧɢɡɦ ɱɟɥɨɜɟɤɚ ɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ
ɠɢɜɨɬɧɵɯ ɫɩɨɫɨɛɫɬɜɭɸɳɟɟ ɩɨɜɵɲɟɧɧɨɣ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ [1]. ɉɪɢ ɥɸɛɵɯ ɬɨɤɫɢɱɟɫɤɢɯ ɜɨɡɞɟɣɫɬɜɢɹɯ ɜɟɞɭɳɚɹ ɪɨɥɶ ɨɬɜɨɞɢɬɫɹ ɢɦɦɭɧɧɨɣ ɫɢɫɬɟɦɟ, ɡɚɳɢɳɚɸɳɟɣ ɨɪɝɚɧɢɡɦ ɨɬ ɜɫɟɯ ɚɧɬɢɝɟɧɧɨ ɱɭɠɟɪɨɞɧɵɯ ɜɟɳɟɫɬɜ [2]. Ɂɚɱɚɫɬɭɸ ɷɬɨ ɩɪɢɜɨɞɢɬ ɤ ɩɨɜɵɲɟɧɧɨɣ ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ ɨɪɝɚɧɢɡɦɚ ɢ, ɤɚɤ
ɫɥɟɞɫɬɜɢɟ ɪɚɡɜɢɬɢɸ ɚɥɥɟɪɝɢɱɟɫɤɨɣ ɪɟɚɤɰɢɢ.
ɐɟɥɶ ɢɫɫɥɟɞɨɜɚɧɢɹ – ɧɚ ɦɨɞɟɥɢ ɝɢɩɟɪɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ ɡɚɦɟɞɥɟɧɧɨɝɨ ɬɢɩɚ ɭ ɥɚɛɨɪɚɬɨɪɧɵɯ
ɤɪɵɫ ɨɰɟɧɢɬɶ ɚɥɥɟɪɝɢɡɢɪɭɸɳɢɟ ɫɜɨɣɫɬɜɚ ɚɜɟɪɦɟɤɬɢɧɫɨɞɟɪɠɚɳɢɯ ɩɪɟɩɚɪɚɬɨɜ Ⱥɜɟɪɫɟɤɬɚ-2 ɢ
ɂɜɟɪɫɟɤɬɚ.
Ɉɛɴɟɤɬɵ ɢ ɦɟɬɨɞɵ. ȼ ɷɤɫɩɟɪɢɦɟɧɬɟ ɢɫɩɨɥɶɡɨɜɚɥɢ ɚɜɟɪɦɟɤɬɢɧɫɨɞɟɪɠɚɳɢɟ ɩɪɟɩɚɪɚɬɵ Ⱥɜɟɪɫɟɤɬ2 (1 % ɪɚɫɬɜɨɪ Ⱥɜɟɪɫɟɤɬɢɧɚ ɋ), ɫɟɪɢɹ ʋ81901498, ɮɨɪɦɚ ɜɵɩɭɫɤɚ 0,01ɥ, ɩɪɨɢɡɜɟɞɟɧ ɈɈɈ ɇȻɐ
Ɏɚɪɦɛɢɨɦɟɞ (Ɇɨɫɤɜɚ, Ɋɨɫɫɢɹ) ɢ ɂɜɟɪɫɟɤɬ (1 % ɪɚɫɬɜɨɪ ɂɜɟɪɦɟɤɬɢɧɚ), ɫɟɪɢɹ ʋ13301498, ɮɨɪɦɚ
ɜɵɩɭɫɤɚ 0,01ɥ, ɩɪɨɢɡɜɟɞɟɧ ɈɈɈ Ɏɚɪɦɛɢɨɦɟɞɫɟɪɜɢɫ (Ɇɨɫɤɜɚ, Ɋɨɫɫɢɹ). ɋɨɫɬɨɹɧɢɟ ɤɥɟɬɨɱɧɨɝɨ ɡɜɟɧɚ ɢɦɦɭɧɧɨɝɨ ɨɬɜɟɬɚ ɩɪɢ ɜɜɟɞɟɧɢɢ ɜ ɨɪɝɚɧɢɡɦ ɚɜɟɪɦɟɤɬɢɧɫɨɞɟɪɠɚɳɢɯ ɩɪɟɩɚɪɚɬɨɜ ɨɩɪɟɞɟɥɹɥɢ
ɩɨ ɪɟɚɤɰɢɢ ɝɢɩɟɪɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ ɡɚɦɟɞɥɟɧɧɨɝɨ ɬɢɩɚ (ȽɁɌ) ɭ ɥɚɛɨɪɚɬɨɪɧɵɯ ɤɪɵɫ ɩɨ ɦɟɬɨɞɢɤɟ
Lagrange et al. (1980). Ⱦɥɹ ɷɬɨɝɨ ɠɢɜɨɬɧɵɯ ɪɚɡɞɟɥɢɥɢ ɧɚ ɞɜɟ ɨɩɵɬɧɵɟ ɝɪɭɩɩɵ ɩɨ 5 ɤɪɵɫ ɜ ɤɚɠɞɨɣ.
ɀɢɜɨɬɧɵɯ ɩɟɪɜɨɣ ɝɪɭɩɩɵ ɫɟɧɫɢɛɢɥɢɡɢɪɨɜɚɥɢ ɩɭɬɟɦ ɨɞɧɨɤɪɚɬɧɨɝɨ ɜɜɟɞɟɧɢɹ ɜ ɨɛɥɚɫɬɶ ɩɪɟɞɩɥɸɫɧɵ ɬɚɡɨɜɵɯ ɤɨɧɟɱɧɨɫɬɟɣ ɤɨɧɰɟɧɬɪɢɪɨɜɚɧɧɨɝɨ ɪɚɫɬɜɨɪɚ ɚɥɥɟɪɝɟɧɚ (Ⱥɜɟɪɫɟɤɬɚ-2) ɜ ɞɨɡɟ 2 ɦɝ/ɤɝ.
ɀɢɜɨɬɧɵɦ ɜɬɨɪɨɣ ɝɪɭɩɩɵ ɜ ɨɛɥɚɫɬɶ ɩɪɟɞɩɥɸɫɧɵ ɬɚɡɨɜɨɣ ɤɨɧɟɱɧɨɫɬɢ ɜɜɨɞɢɥɢ ɤɨɧɰɟɧɬɪɢɪɨɜɚɧ233
ɧɵɣ ɪɚɫɬɜɨɪ ɂɜɟɪɫɟɤɬɚ ɜ ɞɨɡɟ 2 ɦɝ/ɤɝ. ɑɟɪɟɡ 7 ɫɭɬɨɤ ɨɫɭɳɟɫɬɜɥɹɥɢ ɪɚɡɪɟɲɚɸɳɟɟ ɜɜɟɞɟɧɢɟ ɚɥɥɟɪɝɟɧɨɜ ɜ ɬɨɦ ɠɟ ɨɛɴɟɦɟ ɜ ɨɛɥɚɫɬɶ ɩɪɟɞɩɥɸɫɧɵ ɥɟɜɵɯ ɬɚɡɨɜɵɯ ɤɨɧɟɱɧɨɫɬɟɣ ɤɪɵɫ. Ʉɨɧɬɪɨɥɟɦ ɫɥɭɠɢɥɚ ɨɛɥɚɫɬɶ ɩɪɟɞɩɥɸɫɧɵ ɩɪɚɜɨɣ ɤɨɧɟɱɧɨɫɬɢ ɠɢɜɨɬɧɵɯ, ɤɭɞɚ ɨɫɭɳɟɫɬɜɥɹɥɨɫɶ ɜɜɟɞɟɧɢɟ 0,05 ɦɥ
0,9 %-ɧɨɝɨ ɪɚɫɬɜɨɪɚ NaCl. ɍɱɟɬ ɪɟɚɤɰɢɢ ɩɪɨɜɨɞɢɥɢ ɱɟɪɟɡ 24 ɱɚɫɚ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɪɚɡɪɟɲɚɸɳɢɯ
ɞɨɡ, ɦɢɤɪɨɦɟɬɪɨɦ ɨɩɪɟɞɟɥɹɹ ɨɛɴɟɦ ɫɬɨɩ.
ȼɫɟ ɦɚɧɢɩɭɥɹɰɢɢ ɨɫɭɳɟɫɬɜɥɹɥɢ ɫ ɫɨɛɥɸɞɟɧɢɟɦ ɦɟɠɞɭɧɚɪɨɞɧɵɯ ɪɟɤɨɦɟɧɞɚɰɢɣ ȿɜɪɨɩɟɣɫɤɨɣ
ɤɨɧɜɟɧɰɢɢ ɩɨ ɡɚɳɢɬɟ ɩɨɡɜɨɧɨɱɧɵɯ ɠɢɜɨɬɧɵɯ, ɢɫɩɨɥɶɡɭɟɦɵɯ ɩɪɢ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɹɯ (1997ɝ).
Ɋɟɡɭɥɶɬɚɬɵ ɩɨɞɜɟɪɝɚɥɢ ɫɬɚɬɢɫɬɢɱɟɫɤɨɣ ɨɛɪɚɛɨɬɤɟ, ɞɨɫɬɨɜɟɪɧɨɫɬɶ ɪɚɡɥɢɱɢɣ ɫɪɟɞɧɢɯ ɨɰɟɧɢɜɚɥɢ
ɩɨ ɧɟɩɚɪɚɦɟɬɪɢɱɟɫɤɨɦɭ ɤɪɢɬɟɪɢɸ ȼɢɥɤɨɤɫɨɧɚ-Ɇɚɧɧɚ-ɍɢɬɧɢ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ. ɉɪɢ ɫɪɚɜɧɟɧɢɢ ɞɚɧɧɵɯ, ɩɨɥɭɱɟɧɧɵɯ ɜ ɪɟɡɭɥɶɬɚɬɟ ɷɤɫɩɟɪɢɦɟɧɬɚ,
ɛɵɥɨ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɤɥɟɬɨɱɧɨɟ ɡɜɟɧɨ ɢɦɦɭɧɢɬɟɬɚ ɧɚɯɨɞɢɬɫɹ ɜ ɝɢɩɟɪɚɤɬɢɜɧɨɦ ɫɨɫɬɨɹɧɢɢ ɢ ɡɚɩɭɫɤɚɟɬɫɹ ɩɟɪɜɵɦ ɜɜɟɞɟɧɢɟɦ ɨɛɨɢɯ ɚɜɟɪɦɟɤɬɢɧɫɨɞɟɪɠɚɳɢɯ ɩɪɟɩɚɪɚɬɨɜ (ɫɟɧɫɢɛɢɥɢɡɚɰɢɟɣ), ɱɬɨ
ɩɪɢɜɨɞɢɬ ɜ ɩɨɫɥɟɞɭɸɳɟɦ ɤ ɪɚɡɜɢɬɢɸ ɜɨɫɩɚɥɢɬɟɥɶɧɨɣ ɪɟɚɤɰɢɢ ɩɨɫɥɟ ɩɨɜɬɨɪɧɨɣ ɢɧɴɟɤɰɢɢ. Ⱦɨ
ɜɜɟɞɟɧɢɹ ɪɚɡɪɟɲɚɸɳɢɯ ɞɨɡ ɩɪɟɩɚɪɚɬɨɜ ɭ ɤɪɵɫ ɧɟ ɪɟɝɢɫɬɪɢɪɨɜɚɥɢ ɧɢɤɚɤɢɯ ɩɪɢɡɧɚɤɨɜ ɦɟɫɬɧɨɝɨ
ɜɨɫɩɚɥɟɧɢɹ.
ɋɩɭɫɬɹ 24 ɱɚɫɚ ɫ ɦɨɦɟɧɬɚ ɜɜɟɞɟɧɢɹ ɪɚɡɪɟɲɚɸɳɢɯ ɞɨɡ, ɫɟɧɫɢɛɢɥɢɡɢɪɨɜɚɧɧɵɣ ɨɪɝɚɧɢɡɦ ɤɪɵɫ
ɨɬɜɟɱɚɥ ɚɥɥɟɪɝɢɱɟɫɤɨɣ ɪɟɚɤɰɢɟɣ ɧɚ Ⱥɜɟɪɫɟɤɬ-2 ɢ ɂɜɟɪɫɟɤɬ. ɍ ɜɫɟɯ ɠɢɜɨɬɧɵɯ ɜ ɨɛɥɚɫɬɢ ɩɪɟɞɩɥɸɫɧɵ ɥɟɜɨɣ ɤɨɧɟɱɧɨɫɬɢ ɪɟɝɢɫɬɪɢɪɨɜɚɥɢ ɩɪɢɡɧɚɤɢ ɪɚɡɜɢɬɢɹ ɜɨɫɩɚɥɢɬɟɥɶɧɨɣ ɪɟɚɤɰɢɢ: ɤɪɚɫɧɨɬɭ, ɩɪɢɩɭɯɥɨɫɬɶ, ɩɨɜɵɲɟɧɢɟ ɦɟɫɬɧɨɣ ɬɟɦɩɢɪɚɬɭɪɵ. ȼɫɥɟɞɫɬɜɢɟ ɨɬɟɤɚ ɫɬɨɩɚ ɭ ɤɪɵɫ ɢɡ ɝɪɭɩɩɵ Ⱥɜɟɪɫɟɤɬ-2
ɭɜɟɥɢɱɢɥɚɫɶ ɜ ɨɛɴɟɦɟ ɧɚ 31 % ɢ ɫɨɫɬɚɜɢɥɚ 1,15±0,06 ɫɦ3 ɩɪɨɬɢɜ 0,88±0,04 ɫɦ3 (Ɋ”0,01) ɜ ɤɨɧɬɪɨɥɟ,
ɭ ɠɢɜɨɬɧɵɯ ɝɪɭɩɩɵ ɂɜɟɪɫɟɤɬɚ ɪɟɝɢɫɬɪɢɪɨɜɚɥɢ ɭɜɟɥɢɱɟɧɢɟ ɫɬɨɩɵ ɜ ɨɛɴɟɦɟ ɧɚ 80 % ɩɪɢ ɞɨɫɬɢɠɟɧɢɢ ɨɛɴɟɦɚ 1,57±0,07 ɫɦ3 ɩɪɨɬɢɜ 0,87±0,04 ɫɦ3(Ɋ”0,01) ɜ ɤɨɧɬɪɨɥɟ.
ȼɵɜɨɞ. Ⱥɜɟɪɦɟɤɬɢɧɫɨɞɟɪɠɚɳɢɟ ɩɪɟɩɚɪɚɬɵ Ⱥɜɟɪɫɟɤɬ-2 ɢ ɂɜɟɪɫɟɤɬ ɨɛɥɚɞɚɸɬ ɫɟɧɫɢɛɢɥɢɡɢɪɭɸɳɢɦ ɞɟɣɫɬɜɢɟɦ ɢ ɜɵɡɵɜɚɸɬ ɪɚɡɜɢɬɢɟ ɝɢɩɟɪɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ ɡɚɦɟɞɥɟɧɧɨɝɨ ɬɢɩɚ, ɱɬɨ ɧɟɨɛɯɨɞɢɦɨ
ɭɱɢɬɵɜɚɬɶ ɩɪɢ ɢɯ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɜ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɭɫɥɨɜɢɹɯ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
ɀɦɢɧɶɤɨ ɉ.Ƚ. ɂɦɦɭɧɧɚɹ ɫɢɫɬɟɦɚ ɤɚɤ ɦɢɲɟɧɶ ɬɨɤɫɢɱɟɫɤɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ ɯɢɦɢɱɟɫɤɢɯ ɜɟɳɟɫɬɜ /
ɉ.Ƚ. ɀɦɢɧɶɤɨ // Ⱥɤɬɭɚɥɶɧɵɟ ɩɪɨɛɥɟɦɵ ɬɪɚɧɫɩɨɪɬɧɨɣ ɦɟɞɢɰɢɧɵ. – 2011. – ʋ1 (23). – ɋ.17–30.
Ƚɚɥɚɤɬɢɨɧɨɜ ȼ.Ƚ. Ɇɟɯɚɧɢɡɦɵ ɢɦɦɭɧɢɬɟɬɚ ɜ ɝɪɚɮɢɱɟɫɤɨɣ ɮɨɪɦɟ / ȼ.Ƚ. Ƚɚɥɚɤɬɢɨɧɨɜ. – Ɇ.: Ɇɟɞɢɰɢɧɚ,
2000. – 288ɫ.
ɍȾɄ 619:615.371:576.851.42:636.22/.28.
ɊȿɁɍɅɖɌȺɌɕ ɉɊɈɂɁȼɈȾɋɌȼȿɇɇɈȽɈ ɉɊɂɆȿɇȿɇɂə
ɀɂȼɈɃ ȼȺɄɐɂɇɕ ɂɁ ɂɇȺȽȽɅɘɌɂɇɈȽȿɇɇɈȽɈ ɒɌȺɆɆȺ
ȻɊɍɐȿɅɅ ɇȺ ɇȿȻɅȺȽɈɉɈɅɍɑɇɈɆ ɉɈȽɈɅɈȼɖȿ
ɄɊɍɉɇɈȽɈ ɊɈȽȺɌɈȽɈ ɋɄɈɌȺ
ȽɈɊȾɂȿɇɄɈ Ʌ.ɇ., ȽɍɋɖɄɈȼȺ Ɍ.ȼ., ȽȺɃȾɍɐɄȺə Ƚ.Ɇ., ȼɈɅɄɈȼȺ Ɍ.ɂ.,
Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɛɸɞɠɟɬɧɨɟ ɧɚɭɱɧɨɟ ɭɱɪɟɠɞɟɧɢɟ
«ȼɫɟɪɨɫɫɢɣɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɛɪɭɰɟɥɥɟɡɚ ɢ ɬɭɛɟɪɤɭɥɟɡɚ
ɠɢɜɨɬɧɵɯ» (ɎȽȻɇɍ ȼɇɂɂȻɌɀ), ɝ. Ɉɦɫɤ, Ɋɨɫɫɢɹ, vniibtg@rambler.ru
Ɋɟɡɸɦɟ. ɍɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɢɫɩɵɬɭɟɦɚɹ ɠɢɜɚɹ ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɚɹ ɜɚɤɰɢɧɚ ɨɛɥɚɞɚɟɬ ɧɢɡɤɨɣ
ɫɬɟɩɟɧɶɸ ɢɦɦɭɧɨɝɟɧɧɨɫɬɢ (ɞɨ 60 %). ɉɪɢɦɟɧɟɧɢɟ ɷɬɨɣ ɜɚɤɰɢɧɵ ɧɚ ɧɟɛɥɚɝɨɩɨɥɭɱɧɨɦ ɩɨɝɨɥɨɜɶɟ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɧɟ ɫɩɨɫɨɛɫɬɜɨɜɚɥɨ ɤɭɩɢɪɨɜɚɧɢɸ ɢɧɮɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ ɜ ɨɱɚɝɟ ɢ ɧɟ
ɩɨɡɜɨɥɢɥɨ ɩɪɟɞɨɬɜɪɚɬɢɬɶ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɢɧɮɟɤɰɢɢ ɫɪɟɞɢ ɜɨɫɩɪɢɢɦɱɢɜɵɯ ɠɢɜɨɬɧɵɯ.
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: ɤɪɭɩɧɵɣ ɪɨɝɚɬɵɣ ɫɤɨɬ, ɛɪɭɰɟɥɥɟɡ, ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɚɹ ɜɚɤɰɢɧɚ, ɢɦɦɭɧɢɬɟɬ,
ɫɟɪɨɥɨɝɢɱɟɫɤɢɟ ɪɟɚɤɰɢɢ.
Ɉɞɧɢɦ ɢɡ ɧɚɢɛɨɥɟɟ ɜɚɠɧɵɯ ɜɨɩɪɨɫɨɜ ɨɛɟɫɩɟɱɟɧɢɹ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɧɚɫɟɥɟɧɢɹ
ɹɜɥɹɟɬɫɹ ɪɚɡɜɢɬɢɟ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ, ɜ ɱɚɫɬɧɨɫɬɢ, ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ [1]. Ɋɟɧɬɚɛɟɥɶɧɨɫɬɶ
ɨɬɪɚɫɥɢ ɡɚɜɢɫɢɬ ɨɬ ɦɧɨɝɨɱɢɫɥɟɧɧɵɯ ɮɚɤɬɨɪɨɜ ɢ ɩɪɟɠɞɟ ɜɫɟɝɨ ɨɬ ɫɨɡɞɚɧɢɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɛɥɚɝɨɩɨɥɭɱɢɹ. ɋɪɟɞɢ ɢɧɮɟɤɰɢɨɧɧɨɣ ɩɚɬɨɥɨɝɢɢ ɨɫɨɛɨɟ ɦɟɫɬɨ ɩɪɢɧɚɞɥɟɠɢɬ ɛɪɭɰɟɥɥɟɡɭ [2].
ȼ ɩɨɫɥɟɞɧɢɟ ɞɟɫɹɬɢɥɟɬɢɹ (1990–2015 ɝɝ.) ɜ ɫɜɹɡɢ ɫ ɢɡɦɟɧɟɧɢɹɦɢ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɨɬɧɨɲɟɧɢɣ,
ɪɟɫɬɪɭɤɬɭɪɢɡɚɰɢɟɣ ɚɝɪɚɪɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ, ɪɚɡɭɤɪɭɩɧɟɧɢɟɦ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ ɢ ɩɪɟ234
ɨɛɪɚɡɨɜɚɧɢɟɦ ɢɯ ɜ ɦɟɥɤɢɟ ɤɪɟɫɬɶɹɧɫɤɢɟ ɢ ɥɢɱɧɵɟ ɮɟɪɦɟɪɫɤɢɟ ɯɨɡɹɣɫɬɜɚ ɨɫɥɨɠɧɢɥɚɫɶ ɪɚɛɨɬɚ ɩɨ
ɨɫɭɳɟɫɬɜɥɟɧɢɸ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɤɨɧɬɪɨɥɹ, ɩɪɨɜɟɞɟɧɢɸ ɦɚɫɫɨɜɵɯ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɢ ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɯ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ [3].
Ɂɚɤɭɩ ɠɢɜɨɬɧɵɯ, ɛɟɫɤɨɧɬɪɨɥɶɧɵɟ ɢɯ ɩɟɪɟɦɟɳɟɧɢɹ ɢ ɩɟɪɟɝɪɭɩɩɢɪɨɜɤɢ, ɨɬɫɭɬɫɬɜɢɟ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɢ ɪɹɞ ɞɪɭɝɢɯ ɮɚɤɬɨɪɨɜ ɫɥɭɠɚɬ ɩɪɢɱɢɧɨɣ ɡɚɧɨɫɚ ɜɨɡɛɭɞɢɬɟɥɹ ɛɪɭɰɟɥɥɟɡɚ ɧɚ ɛɥɚɝɨɩɨɥɭɱɧɵɟ
ɬɟɪɪɢɬɨɪɢɢ ɢ ɲɢɪɨɤɨɝɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢɧɮɟɤɰɢɢ ɫɪɟɞɢ ɜɨɫɩɪɢɢɦɱɢɜɨɝɨ ɩɨɝɨɥɨɜɶɹ [4].
Ɇɧɨɝɨɥɟɬɧɹɹ ɩɪɚɤɬɢɤɚ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɫɬɟɩɟɧɶ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢɧɮɟɤɰɢɢ ɜ ɩɟɪɜɵɟ 3-6 ɦɟɫɹɰɟɜ ɞɨɫɬɢɝɚɟɬ ɛɨɥɟɟ 30 % ɢ ɛɨɥɟɟ [5]. Ʉɭɩɢɪɨɜɚɬɶ ɨɱɚɝ ɛɪɭɰɟɥɥɟɡɚ ɢ ɩɪɨɮɢɥɚɤɬɢɪɨɜɚɬɶ ɟɝɨ ɞɚɥɶɧɟɣɲɟɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɧɟ ɩɪɟɞɫɬɚɜɥɹɟɬɫɹ ɜɨɡɦɨɠɧɵɦ ɛɟɡ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɫɪɟɞɫɬɜ ɫɩɟɰɢɮɢɱɟɫɤɨɣ ɩɪɨɮɢɥɚɤɬɢɤɢ. Ⱦɥɹ ɢɦɦɭɧɢɡɚɰɢɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɟɡɚ ɩɪɟɞɥɨɠɟɧɨ ɢ
ɚɩɪɨɛɢɪɨɜɚɧɨ ɧɟɫɤɨɥɶɤɨ ɜɚɤɰɢɧ ɢɡ ɪɚɡɥɢɱɧɵɯ ɲɬɚɦɦɨɜ, ɫɨɫɬɨɹɳɢɯ ɢɡ ɛɪɭɰɟɥɥ ɜ S- ɢɥɢ S-R-ɮɨɪɦɟ [6,7,8].
ɇɚɪɹɞɭ ɫ ɡɚɦɟɱɚɬɟɥɶɧɵɦɢ ɢɦɦɭɧɨɝɟɧɧɵɦɢ ɤɚɱɟɫɬɜɚɦɢ ɷɬɢ ɜɚɤɰɢɧɵ ɢɦɟɸɬ ɪɹɞ ɧɟɞɨɫɬɚɬɤɨɜ:
ɪɟɚɤɬɨɝɟɧɧɨɫɬɶ, ɞɥɢɬɟɥɶɧɚɹ ɫɟɪɨɩɨɡɢɬɢɜɧɨɫɬɶ ɢ ɞɪ. ɋ ɰɟɥɶɸ ɩɪɟɞɨɬɜɪɚɳɟɧɢɹ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɵɯ
ɨɫɥɨɠɧɟɧɢɣ ɭɱɟɧɵɦɢ ɪɚɡɧɵɯ ɫɬɪɚɧ ɪɚɡɪɚɛɨɬɚɧɵ ɢ ɩɪɟɞɥɨɠɟɧɵ ɞɥɹ ɲɢɪɨɤɨɝɨ ɩɪɢɦɟɧɟɧɢɹ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɵɟ ɜɚɤɰɢɧɵ ɢɡ ɞɢɫɫɨɰɢɢɪɨɜɚɧɧɵɯ ɲɬɚɦɦɨɜ ɛɪɭɰɟɥɥ (R-), ɱɚɫɬɢɱɧɨ ɢɥɢ ɩɨɥɧɨɫɬɶɸ
ɭɬɪɚɬɢɜɲɢɯ ɩɨɜɟɪɯɧɨɫɬɧɵɟ ɫɥɨɢ ɤɥɟɬɨɱɧɨɣ ɫɬɟɧɤɢ, ɤɨɬɨɪɵɟ ɜ ɨɪɝɚɧɢɡɦɟ ɠɢɜɨɬɧɵɯ ɜɵɡɵɜɚɸɬ
ɫɢɧɬɟɡ ɫɩɟɰɢɮɢɱɟɫɤɢɯ ɝɨɦɨɥɨɝɢɱɧɵɯ ɢɦɦɭɧɨɝɥɨɛɭɥɢɧɨɜ, ɧɟ ɢɦɟɸɳɢɯ ɪɨɞɫɬɜɚ ɫ ɷɩɢɡɨɨɬɢɱɟɫɤɢɦɢ ɜɢɪɭɥɟɧɬɧɵɦɢ (S-) ɲɬɚɦɦɚɦɢ. ɗɬɨ ɩɨɡɜɨɥɹɟɬ ɫɧɢɡɢɬɶ ɪɟɚɤɬɨɝɟɧɧɨɫɬɶ ɠɢɜɨɣ ɜɚɤɰɢɧɵ ɢ ɢɫɤɥɸɱɢɬɶ ɫɟɪɨɩɨɡɢɬɢɜɧɨɫɬɶ, ɜɵɹɜɥɹɟɦɭɸ ɫɬɚɧɞɚɪɬɧɵɦɢ ɦɟɬɨɞɚɦɢ ɞɢɚɝɧɨɫɬɢɤɢ ɛɪɭɰɟɥɥɟɡɚ.
ȼɚɤɰɢɧɵ ɢɡ ɞɢɫɫɨɰɢɢɪɨɜɚɧɧɵɯ ɲɬɚɦɦɨɜ ɛɪɭɰɟɥɥ (R-) ɩɨɥɭɱɢɥɢ ɧɚɡɜɚɧɢɟ ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɵɯ
ɢ ɪɟɤɨɦɟɧɞɨɜɚɧɵ ɞɥɹ ɲɢɪɨɤɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɝɨ ɩɪɢɦɟɧɟɧɢɹ.
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɰɟɥɶɸ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɹɜɢɥɨɫɶ ɩɪɨɜɟɞɟɧɢɟ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ
ɩɪɨɛ ɫɵɜɨɪɨɬɨɤ ɤɪɨɜɢ ɨɬ ɧɟɛɥɚɝɨɩɨɥɭɱɧɨɝɨ ɩɨ ɛɪɭɰɟɥɥɟɡɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɪɚɧɧɢɟ ɫɪɨɤɢ
ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɜɚɤɰɢɧɨɣ ɜ R-ɮɨɪɦɟ ɢ ɨɰɟɧɤɚ ɟɟ ɩɪɨɬɢɜɨɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ.
Ɇɚɬɟɪɢɚɥɵ ɢ ɦɟɬɨɞɵ
ɂɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɜɨɞɢɥɢ ɧɚ ɩɨɝɨɥɨɜɶɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɫɢɦɦɟɧɬɚɥɶɫɤɨɣ ɩɨɪɨɞɵ, ɫɨɞɟɪɠɚɳɟɝɨɫɹ ɧɚ ɩɪɢɜɹɡɢ, ɩɪɢɧɚɞɥɟɠɚɳɟɝɨ ɨɞɧɨɦɭ ɢɡ ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ.
Ⱦɨ ɩɪɨɜɟɞɟɧɢɹ ɪɚɛɨɬɵ ɦɨɥɨɱɧɨ-ɬɨɜɚɪɧɚɹ ɮɟɪɦɚ ɢɦɟɥɚ ɷɩɢɡɨɨɬɢɱɟɫɤɢɣ ɫɬɚɬɭɫ ɧɟɛɥɚɝɨɩɨɥɭɱɧɨɣ
ɩɨ ɛɪɭɰɟɥɥɟɡɭ ɫɨ ɫɬɟɩɟɧɶɸ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢɧɮɟɤɰɢɢ 20 % ɫɪɟɞɢ ɜɫɟɯ ɩɨɥɨɜɨɡɪɚɫɬɧɵɯ ɝɪɭɩɩ.
ȼ ɧɨɹɛɪɟ 2014 ɝɨɞɚ ɠɢɜɨɬɧɵɯ ɢɦɦɭɧɢɡɢɪɨɜɚɥɢ ɠɢɜɨɣ ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɨɣ ɢɡ ɛɪɭɰɟɥɥ
ɜ R-ɮɨɪɦɟ ɜ ɞɨɡɟ, ɪɟɤɨɦɟɧɞɨɜɚɧɧɨɣ ɇɚɫɬɚɜɥɟɧɢɟɦ ɩɨ ɟɟ ɩɪɢɦɟɧɟɧɢɸ. ɑɟɪɟɡ 30 ɞɧɟɣ ɩɪɨɛɵ ɫɵɜɨɪɨɬɤɢ ɤɪɨɜɢ ɨɬ ɠɢɜɨɬɧɵɯ ɢɫɫɥɟɞɨɜɚɥɢ ɜ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɪɟɚɤɰɢɹɯ ɫɨ ɫɬɚɧɞɚɪɬɧɵɦ ɟɞɢɧɵɦ (S-)
ɛɪɭɰɟɥɥɟɡɧɵɦ ɚɧɬɢɝɟɧɨɦ ɞɥɹ ɊȺ ɢ ɊɋɄ ɢ ɫ ɚɧɬɢɝɟɧɨɦ (R-), ɢɡɝɨɬɨɜɥɟɧɧɵɦ ɜ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ
ɭɫɥɨɜɢɹɯ ɢɡ ɛɪɭɰɟɥɥ ɜ R-ɮɨɪɦɟ, ɝɨɦɨɥɨɝɢɱɧɵɯ ɜɚɤɰɢɧɧɨɦɭ ɲɬɚɦɦɭ; ɜ ɪɨɡ-ɛɟɧɝɚɥ ɩɪɨɛɟ ɢ ɜ ɪɟɚɤɰɢɢ ɢɦɦɭɧɨɞɢɮɮɭɡɢɢ (ɊɂȾ) ɫ Ɉ-ɉɋ ɚɧɬɢɝɟɧɨɦ. ɇɚ ɨɫɧɨɜɚɧɢɢ ɪɟɡɭɥɶɬɚɬɨɜ ɥɚɛɨɪɚɬɨɪɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɠɢɜɨɬɧɵɯ ɭɞɚɥɹɥɢ ɢɡ ɫɬɚɞɚ, ɚ ɨɫɬɚɥɶɧɨɟ ɩɨɝɨɥɨɜɶɟ ɩɟɪɟɢɫɫɥɟɞɨɜɚɥɢ.
Ɋɟɡɭɥɶɬɚɬɵ
ȼ ɪɟɡɭɥɶɬɚɬɟ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɨɛ ɫɵɜɨɪɨɬɤɢ ɤɪɨɜɢ ɨɬ ɬɟɥɨɤ ɫɥɭɱɧɨɝɨ ɜɨɡɪɚɫɬɚ,
ɧɟɬɟɥɟɣ, ɫɭɯɨɫɬɨɣɧɵɯ, ɧɨɜɨɬɟɥɶɧɵɯ ɢ ɥɚɤɬɢɪɭɸɳɢɯ ɤɨɪɨɜ ɱɟɪɟɡ 30 ɫɭɬɨɤ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɨɣ ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɨɣ ɜɵɹɜɥɟɧɨ 104 ɛɨɥɶɧɵɯ ɛɪɭɰɟɥɥɟɡɨɦ ɠɢɜɨɬɧɵɯ
(22,5 %). ɉɪɢɱɟɦ ɭ ɩɨɥɨɜɢɧɵ ɢɡ ɧɢɯ (59 %) ɜ ɫɵɜɨɪɨɬɤɟ ɤɪɨɜɢ ɬɚɤɠɟ ɛɵɥɢ ɜɵɹɜɥɟɧɵ ɢɦɦɭɧɨɝɥɨɛɭɥɢɧɵ, ɝɨɦɨɥɨɝɢɱɧɵɟ R-ɚɧɬɢɝɟɧɚɦ ɜɚɤɰɢɧɧɨɝɨ ɲɬɚɦɦɚ, ɧɨ ɢɯ ɚɤɬɢɜɧɨɫɬɶ ɛɵɥɚ ɧɚ 2–3 ɪɚɡɜɟɞɟɧɢɹ ɦɟɧɶɲɟ, ɱɟɦ ɜ ɩɚɪɚɥɥɟɥɶɧɵɯ ɪɟɚɤɰɢɹɯ ɫɨ ɫɬɚɧɞɚɪɬɧɵɦɢ (S-) ɞɢɚɝɧɨɫɬɢɤɭɦɚɦɢ.
ɉɪɢ ɢɧɬɟɪɩɪɟɬɚɰɢɢ ɪɟɡɭɥɶɬɚɬɨɜ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɨɬɦɟɱɟɧɨ, ɱɬɨ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ
ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɺɡɧɨɣ ɜɚɤɰɢɧɵ ɢɡ R-ɲɬɚɦɦɚ ɜ ɬɟɱɟɧɢɟ 30 ɫɭɬɨɤ ɜ ɨɪɝɚɧɢɡɦɟ ɠɢɜɨɬɧɵɯ ɩɪɨɢɫɯɨɞɢɥ ɢɦɦɭɧɧɵɣ ɨɬɜɟɬ ɧɚ ɝɭɦɚɧɢɬɚɪɧɨɦ ɭɪɨɜɧɟ. Ɉɞɧɚɤɨ ɨɧ ɧɟ ɫɦɨɝ ɜ ɞɨɥɠɧɨɣ ɫɬɟɩɟɧɢ ɨɛɟɫɩɟɱɢɬɶ
ɡɚɳɢɬɭ ɠɢɜɨɬɧɵɯ ɨɬ ɢɧɮɟɤɰɢɢ, ɨ ɱɺɦ ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɜɵɫɨɤɢɟ ɬɢɬɪɵ S-ɛɪɭɰɟɥɥɺɡɧɵɯ ɚɧɬɢɬɟɥ, ɚ
ɨɫɨɛɟɧɧɨ ɩɨɥɨɠɢɬɟɥɶɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɪɟɚɤɰɢɢ ɢɦɦɭɧɨɞɢɮɮɭɡɢɢ ɫ Ɉ-ɉɋ ɚɧɬɢɝɟɧɨɦ, ɤɨɬɨɪɚɹ ɨɛɥɚɞɚɟɬ ɜɵɫɨɤɨɣ ɫɩɟɰɢɮɢɱɧɨɫɬɶɸ.
ɍ ɨɬɞɟɥɶɧɵɯ ɠɢɜɨɬɧɵɯ (29 ɝɨɥɨɜ ɢɥɢ 6,3 %) ɜ ɫɵɜɨɪɨɬɤɟ ɤɪɨɜɢ ɜɵɹɜɥɹɥɢ ɢɦɦɭɧɨɝɥɨɛɭɥɢɧɵ ɤ
ɜɚɤɰɢɧɧɨɦɭ (R-) ɲɬɚɦɦɭ ɛɪɭɰɟɥɥ ɢ ɤ ɛɪɭɰɟɥɥɚɦ ɜ S-ɮɨɪɦɟ. ɉɪɢɱɺɦ ɞɢɚɝɧɨɫɬɢɱɟɫɤɚɹ ɚɤɬɢɜɧɨɫɬɶ
R-ɚɧɬɢɬɟɥ ɛɵɥɚ ɜɵɲɟ, ɱɟɦ ɚɧɬɢɬɟɥ ɤ S-ɮɨɪɦɚɦ ɛɪɭɰɟɥɥ.
Ⱦɚɧɧɵɟ ɩɨɤɚɡɚɬɟɥɢ ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɨ ɬɨɦ, ɱɬɨ ɭ ɷɬɢɯ ɠɢɜɨɬɧɵɯ ɜ ɬɟɱɟɧɢɟ ɦɟɫɹɰɚ ɮɨɪɦɢɪɨɜɚɥɫɹ ɢɦɦɭɧɢɬɟɬ, ɧɨ ɟɝɨ ɧɚɩɪɹɠɺɧɧɨɫɬɶ
ɛɵɥɚ ɧɟɞɨɫɬɚɬɨɱɧɨɣ ɞɥɹ ɩɪɟɞɨɬɜɪɚɳɟɧɢɹ ɪɚɡɜɢɬɢɹ
ɢɧɮɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ, ɩɪɢ ɤɨɧɬɚɤɬɟ ɫ ɜɨɡɛɭɞɢɬɟɥɟɦ ɛɪɭɰɟɥɥɺɡɚ. ɍ 100 ɠɢɜɨɬɧɵɯ (22 %), ɩɪɢɜɢɬɵɯ ɢɧɚɝɝɸɬɢɧɨɝɟɧɧɨɣ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɺɡɧɨɣ ɜɚɤɰɢɧɨɣ, ɨɬɦɟɱɚɥɢ ɧɚɥɢɱɢɟ ɜ ɫɵɜɨɪɨɬɤɟ ɤɪɨɜɢ
ɬɨɥɶɤɨ ɢɦɦɭɧɨɝɥɨɛɭɥɢɧɨɜ ɝɨɦɨɥɨɝɢɱɧɵɯ ɜɚɤɰɢɧɧɨɦɭ (R-) ɲɬɚɦɦɭ, ɚ ɨɫɬɚɥɶɧɵɟ (43 %) ɠɢɜɨɬɧɵɟ
ɛɵɥɢ ɢɧɬɚɤɬɧɵɦɢ.
235
ɀɢɜɨɬɧɵɯ, ɩɨɥɨɠɢɬɟɥɶɧɨ ɢ ɫɨɦɧɢɬɟɥɶɧɨ ɪɟɚɝɢɪɭɸɳɢɯ ɩɪɢ ɢɫɫɥɟɞɨɜɚɧɢɢ ɧɚ ɛɪɭɰɟɥɥɺɡ, ɢɡɨɥɢɪɨɜɚɥɢ ɢɡ ɫɬɚɞɚ, ɚ ɡɚ ɨɫɬɚɥɶɧɵɦ ɩɨɝɨɥɨɜɶɟɦ ɩɪɨɞɨɥɠɢɥɢ ɧɚɛɥɸɞɟɧɢɟ.
ɇɚ ɨɫɧɨɜɚɧɢɢ ɪɟɡɭɥɶɬɚɬɨɜ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɧɚ ɮɨɧɟ ɩɪɢɦɟɧɟɧɢɹ
ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɵ ɧɟ ɭɞɚɥɨɫɶ ɤɭɩɢɪɨɜɚɬɶ ɨɱɚɝ ɛɪɭɰɟɥɥɺɡɚ, ɢ ɜ ɬɟɱɟɧɢɟ ɦɟɫɹɰɚ ɢɧɮɟɤɰɢɹ ɩɪɨɞɨɥɠɚɥɚ ɪɚɫɩɪɨɫɬɪɚɧɹɬɶɫɹ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɢɫɫɥɟɞɨɜɚɧɢɹ, ɩɪɨɜɟɞɟɧɧɵɟ ɜ ɪɚɧɧɢɟ ɫɪɨɤɢ (30 ɫɭɬɨɤ) ɩɨɫɥɟ ɩɪɢɦɟɧɟɧɢɹ ɠɢɜɨɣ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɺɡɧɨɣ ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɵ ɧɚ ɧɟɛɥɚɝɨɩɨɥɭɱɧɨɦ ɩɨɝɨɥɨɜɶɟ ɤɪɭɩɧɨɝɨ
ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɨ ɧɢɡɤɨɣ ɫɬɟɩɟɧɢ ɟɺ ɢɦɦɭɧɨɝɟɧɧɨɫɬɢ (ɞɨ 60 %) ɢ ɨ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɪɚɡɪɚɛɨɬɤɢ ɢ ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɦɟɬɨɞɨɜ ɢ ɫɪɟɞɫɬɜ ɫɩɟɰɢɮɢɱɟɫɤɨɣ ɩɪɨɮɢɥɚɤɬɢɤɢ ɛɪɭɰɟɥɥɺɡɚ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
8.
ɒɟɜɯɭɠɟɜ Ⱥ.Ɏ. ɢ ɞɪ. ɀɢɜɨɬɧɨɜɨɞɫɬɜɨ Ɋɨɫɫɢɢ ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɩɪɨɝɪɚɦɦɨɣ ɪɚɡɜɢɬɢɹ
ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɧɚ 2013–2020 ɝɨɞɵ. – ɋɬɚɜɪɨɩɨɥɶ, 2013. 428 ɫ.
Ƚɨɪɞɢɟɧɤɨ Ʌ.ɇ., Ɉɤɨɥɟɥɨɜ ȼ.ɂ., Ⱥɪɚɤɟɥɹɧ ɉ.Ʉ. ɗɮɮɟɤɬɢɜɧɨɫɬɶ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɜ
Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ //ɂɧɮɟɤɰɢɨɧɧɚɹ ɩɚɬɨɥɨɝɢɹ ɠɢɜɨɬɧɵɯ: Ɇɚɬɟɪɢɚɥɵ ɦɟɠɞɭɧɚɪ. ɧɚɭɱɧ.-ɩɪɚɤɬɢɱ.
ɤɨɧɮ., ɩɨɫɜɹɳɟɧɧɨɣ 90-ɥɟɬɢɸ ɋɢɛɇɂȼɂ-ȼɇɂɂȻɌɀ.- Ɉɦɫɤ, 2011. ɋ. 31–36
Ƚɨɪɞɢɟɧɤɨ Ʌ.ɇ. ɋɨɜɪɟɦɟɧɧɵɟ ɩɪɨɛɥɟɦɵ ɛɪɭɰɟɥɥɟɡɚ ɠɢɜɨɬɧɵɯ ɜ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ// ɋɨɜɪɟɦɟɧɧɵɟ ɬɟɧɞɟɧɰɢɢ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ: Ɇɚɬɟɪɢɚɥɵ ɦɟɠɞɭɧɚɪ. ɧɚɭɱɧ. ɤɨɧɮ. 10–11 ɨɤɬɹɛɪɹ 2013 ɝ.- Ɍ. I.
ɋ. 38–39
Ⱦɠɭɩɢɧɚ ɋ.ɂ. Ʉɨɧɬɪɨɥɶ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1986. – 164 ɫ.
Ƚɨɪɞɢɟɧɤɨ Ʌ.ɇ. ɂɧɬɟɧɫɢɜɧɨɫɬɶ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɛɪɭɰɟɥɥɟɡɚ ɫɪɟɞɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɦɹɫɧɨɣ
ɩɨɪɨɞɵ ɩɪɢ ɜɵɝɭɥɶɧɨɦ ɫɨɞɟɪɠɚɧɢɢ //ȼɟɬɟɪɢɧɚɪɢɹ. 2014. ʋ11. ɋ. 17–19
Ⱥɥɶɛɟɪɬɹɧ Ɇ.ɉ. ɋɬɚɛɢɥɶɧɨɫɬɶ ɫɜɨɣɫɬɜ ɜɚɤɰɢɧɧɨɝɨ ɲɬɚɦɦɚ B.abortus 104-M ɩɪɢ ɩɚɫɫɢɪɨɜɚɧɢɢ ɱɟɪɟɡ
ɨɪɝɚɧɢɡɦ ɧɟɬɟɥɟɣ (ɩɨ ɞɚɧɧɵɦ ɩɚɬɨ-ɦɨɪɮɨɥɨɝɢɢ)// Ȼɸɥɥ. ȼɇɂɂɗȼ. 1987. ȼɵɩ. 64. ɋ.71–73
Ⱥɩɚɥɶɤɢɧ ȼ.Ⱥ., ɂɜɚɧɨɜ Ⱥ.ȼ., ɘɫɭɩɨɜ Ɋ.ɏ. Ɋɚɡɪɚɛɨɬɤɚ ɧɨɜɨɝɨ ɩɨɤɨɥɟɧɢɹ ɢɧɚɤɬɢɜɢɪɨɜɚɧɧɨɣ ɜɚɤɰɢɧɵ ɞɥɹ
ɢɦɦɭɧɢɡɚɰɢɢ ɧɨɜɨɪɨɠɞɟɧɧɵɯ ɬɟɥɹɬ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɟɡɚ // ȼɟɬɟɪɢɧɚɪɧɵɣ ɜɪɚɱ. – 2005. ʋ 3. ɋ.8–11
ɂɜɚɧɨɜ Ⱥ.ȼ., ɋɚɥɦɚɤɨɜ Ʉ.Ɇ., Ɏɨɦɢɧ Ⱥ.Ɇ., ɉɥɨɬɧɢɤɨɜɚ ɗ.Ɇ., ɋɚɥɦɚɤɨɜɚ Ⱥ.ȼ ɂɦɦɭɧɨɛɢɨɥɨɝɢɱɟɫɤɢɟ
ɫɜɨɣɫɬɜɚ ɜɚɤɰɢɧɧɵɯ ɲɬɚɦɦɨɜ B.abortus //ȼɟɬɟɪɢɧɚɪɢɹ. 2009. ʋ 3. ɋ.25–27
ɍȾɄ 619:616.981:42
ɋɈȼɊȿɆȿɇɇɕȿ ɉɊɈȻɅȿɆɕ ɋɉȿɐɂɎɂɑȿɋɄɈɃ
ɉɊɈɎɂɅȺɄɌɂɄɂ ȻɊɍɐȿɅɅȿɁȺ ɀɂȼɈɌɇɕɏ
ȾɂɆɈȼ ɋ.Ʉ., ȾɂɆɈȼȺ Ⱥ.ɋ., ȼɈɊɈȻɖȿȼ ȼ.ɂ.,
Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɧɚɭɱɧɨɟ ɭɱɪɟɠɞɟɧɢɟ «ɂɧɫɬɢɬɭɬ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɣ
ɜɟɬɟɪɢɧɚɪɢɢ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɝɨ ȼɨɫɬɨɤɚ» (ɝ. ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ),
e-mail: skdimov@yandex.ru
ȺɊȺɄȿɅəɇ ɉ.Ʉ.,
Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɧɚɭɱɧɨɟ ɭɱɪɟɠɞɟɧɢɟ «ȼɫɟɪɨɫɫɢɣɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɛɪɭɰɟɥɥɟɡɚ ɢ ɬɭɛɟɪɤɭɥɟɡɚ ɠɢɜɨɬɧɵɯ» (ɝ. Ɉɦɫɤ, Ɋɨɫɫɢɹ)
ɗɩɢɡɨɨɬɢɱɟɫɤɚɹ ɫɢɬɭɚɰɢɹ ɩɨ ɛɪɭɰɟɥɥɟɡɭ ɜ ɦɢɪɟ ɩɪɨɞɨɥɠɚɟɬ ɨɫɬɚɜɚɬɶɫɹ ɞɨɫɬɚɬɨɱɧɨ ɫɥɨɠɧɨɣ. ȼ
Ɋɨɫɫɢɢ ɢ ɜ ɪɹɞɟ ɞɪɭɝɢɯ ɫɬɪɚɧ (Ʉɚɡɚɯɫɬɚɧ, Ɇɨɧɝɨɥɢɹ ɢ ɞɪ.) ɷɬɚ ɛɨɥɟɡɧɶ ɨɫɨɛɟɧɧɨ ɚɤɬɭɚɥɶɧɚ.
ȼɟɞɭɳɚɹ ɪɨɥɶ ɜɚɤɰɢɧ ɜ ɩɪɨɮɢɥɚɤɬɢɤɟ ɢ ɥɢɤɜɢɞɚɰɢɢ ɛɪɭɰɟɥɥɟɡɚ ɭ ɤɪɭɩɧɨɝɨ ɢ ɦɟɥɤɨɝɨ ɪɨɝɚɬɨɝɨ
ɫɤɨɬɚ ɛɵɥɚ ɞɨɤɚɡɚɧɚ ɞɚɜɧɨ. ȼ Ɋɨɫɫɢɢ ɢ ɪɹɞɟ ɫɬɪɚɧ ɛɵɜɲɟɝɨ ɋɋɋɊ ɫɭɳɟɫɬɜɨɜɚɥɚ ɢ ɛɵɥɚ ɫ ɩɨɥɨɠɢɬɟɥɶɧɵɦɢ ɪɟɡɭɥɶɬɚɬɚɦɢ ɩɪɚɤɬɢɱɟɫɤɢ ɪɟɚɥɢɡɨɜɚɧɚ ɜ ɦɧɨɝɨɱɢɫɥɟɧɧɵɯ ɡɨɧɚɯ ɩɪɢɭɪɨɱɟɧɧɨɫɬɢ
ɛɨɥɟɡɧɢ ɤɨɧɰɟɩɰɢɹ ɤɨɧɬɪɨɥɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ ɛɪɭɰɟɥɥɟɡɚ, ɨɫɧɨɜɚɧɧɚɹ ɧɚ ɨɛɟɫɩɟɱɟɧɢɢ
ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɛɥɚɝɨɩɨɥɭɱɢɹ ɜ ɩɨɩɭɥɹɰɢɹɯ ɠɢɜɨɬɧɵɯ ɡɚ ɫɱɟɬ ɜɵɫɨɤɨɝɨ ɭɪɨɜɧɹ ɢɦɦɭɧɢɬɟɬɚ, ɩɪɟɩɹɬɫɬɜɭɸɳɟɝɨ ɮɨɪɦɢɪɨɜɚɧɢɸ ɷɩɢɡɨɨɬɢɱɟɫɤɢ ɨɩɚɫɧɵɯ ɜɚɪɢɚɧɬɨɜ ɜɨɡɛɭɞɢɬɟɥɹ. ɇɚ ɮɨɧɟ ɫɧɢɠɟɧɢɹ
ɭɪɨɜɧɹ ɢɦɦɭɧɢɬɟɬɚ ɢɥɢ ɟɝɨ ɩɨɥɧɨɝɨ ɨɬɫɭɬɫɬɜɢɹ ɭɫɥɨɜɢɹ ɞɥɹ ɜɨɡɧɢɤɧɨɜɟɧɢɹ ɨɫɬɪɵɯ ɜɫɩɵɲɟɤ ɢɧɮɟɤɰɢɢ ɩɨ ɷɧɞɨɝɟɧɧɨɦɭ ɢɥɢ ɷɤɡɨɝɟɧɧɨɦɭ ɬɢɩɭ ɩɪɨɹɜɥɹɥɢɫɶ ɜ ɩɨɥɧɨɣ ɦɟɪɟ. Ʉɨɝɞɚ ɠɟ ɭɪɨɜɟɧɶ ɢɦɦɭɧɢɬɟɬɚ ɫɬɚɧɨɜɢɥɫɹ ɫɬɚɛɢɥɶɧɨ ɜɵɫɨɤɢɦ, ɬɚɤɢɟ ɭɫɥɨɜɢɹ ɩɟɪɟɫɬɚɜɚɥɢ ɛɵɬɶ ɜɨɡɦɨɠɧɵɦɢ.
ȼ ɛɨɥɶɲɢɧɫɬɜɟ ɪɟɝɢɨɧɨɜ ɋɢɛɢɪɢ ɧɟɭɤɨɫɧɢɬɟɥɶɧɨɟ ɩɪɚɤɬɢɱɟɫɤɨɟ ɜɵɩɨɥɧɟɧɢɟ ɜ ɬɟɱɟɧɢɟ ɞɥɢɬɟɥɶɧɨɝɨ ɩɟɪɢɨɞɚ ɨɫɧɨɜɧɵɯ ɩɨɥɨɠɟɧɢɣ ɭɤɚɡɚɧɧɨɣ ɜɵɲɟ ɤɨɧɰɟɩɰɢɢ ɩɪɢɜɟɥɨ ɤ ɢɯ ɷɩɢɡɨɨɬɢɱɟɫɤɨɦɭ
ɛɥɚɝɨɩɨɥɭɱɢɸ ɩɨ ɛɪɭɰɟɥɥɟɡɭ. ȼ ɷɬɨɣ ɫɜɹɡɢ ɫɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɝɚɪɚɧɬɢɢ ɫɬɨɣɤɨɝɨ ɛɥɚɝɨɩɨɥɭɱɢɹ
ɨɛɟɫɩɟɱɢɜɚɥɚ ɥɢɤɜɢɞɚɰɢɹ ɜɫɟɝɨ ɫɤɨɦɩɪɨɦɟɬɢɪɨɜɚɧɧɨɝɨ ɩɨɝɨɥɨɜɶɹ (ɜɤɥɸɱɚɹ ɩɪɢɩɥɨɞ, ɩɨɥɭɱɟɧɧɵɣ
ɨɬ ɠɢɜɨɬɧɵɯ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɫɬɚɞ, ɤɚɤ ɝɥɚɜɧɵɣ ɢɫɬɨɱɧɢɤ ɪɟɰɢɞɢɜɚ ɛɨɥɟɡɧɢ) ɡɚ ɫɱɟɬ ɟɝɨ ɩɥɚɧɨ236
ɦɟɪɧɨɝɨ ɜɵɬɟɫɧɟɧɢɹ ɧɨɜɵɦ ɛɥɚɝɨɩɨɥɭɱɧɵɦ ɢɦɦɭɧɧɵɦ ɩɨɝɨɥɨɜɶɟɦ.
Ɉɛɳɟɢɡɜɟɫɬɧɵɦ ɢɞɟɚɥɶɧɵɦ ɦɟɬɨɞɨɦ ɨɡɞɨɪɨɜɥɟɧɢɹ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɩɨ ɛɪɭɰɟɥɥɟɡɭ ɩɭɧɤɬɨɜ
ɹɜɥɹɟɬɫɹ ɨɩɟɪɚɬɢɜɧɚɹ ɫɞɚɱɚ ɧɚ ɭɛɨɣ ɜɫɟɝɨ ɫɤɨɦɩɪɨɦɟɬɢɪɨɜɚɧɧɨɝɨ ɩɨɝɨɥɨɜɶɹ ɜ ɫɨɱɟɬɚɧɢɢ ɫ ɪɟɚɥɢɡɚɰɢɟɣ ɤɨɦɩɥɟɤɫɚ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɯ ɦɟɪ, ɧɚɩɪɚɜɥɟɧɧɵɯ ɧɚ ɧɟɣɬɪɚɥɢɡɚɰɢɸ ɜɨɡɛɭɞɢɬɟɥɹ
ɜɨ ɜɧɟɲɧɟɣ ɫɪɟɞɟ. ɇɨ ɨɧ ɧɟ ɫɬɚɥ ɩɨɩɭɥɹɪɧɵɦ ɜ ɪɹɞɟ ɫɬɪɚɧ, ɜ ɬɨɦ ɱɢɫɥɟ ɜ Ɋɨɫɫɢɢ, Ʉɚɡɚɯɫɬɚɧɟ ɢ
Ɇɨɧɝɨɥɢɢ, ɩɪɟɠɞɟ ɜɫɟɝɨ ɩɨ ɫɨɰɢɚɥɶɧɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɦ ɩɪɢɱɢɧɚɦ. ȼ ɷɬɨɣ ɫɜɹɡɢ ɟɞɢɧɫɬɜɟɧɧɨ ɞɟɣɫɬɜɟɧɧɵɦ ɨɫɬɚɥɫɹ ɦɟɬɨɞ, ɨɫɧɨɜɚɧɧɵɣ ɧɚ ɜɵɹɜɥɟɧɢɢ ɢɫɬɨɱɧɢɤɨɜ ɜɨɡɛɭɞɢɬɟɥɟɣ ɢɧɮɟɤɰɢɢ ɪɚɰɢɨɧɚɥɶɧɵɦɢ ɦɟɬɨɞɚɦɢ ɞɢɚɝɧɨɫɬɢɤɢ ɧɚ ɮɨɧɟ ɨɛɟɫɩɟɱɟɧɢɹ ɩɟɪɦɚɧɟɧɬɧɨɝɨ ɝɪɭɩɩɨɜɨɝɨ ɢɦɦɭɧɢɬɟɬɚ ɫ
ɩɨɦɨɳɶɸ ɜɚɤɰɢɧ (ɬɚɤɠɟ ɩɨ ɪɚɰɢɨɧɚɥɶɧɵɦ ɫɯɟɦɚɦ), ɜ ɫɨɱɟɬɚɧɢɢ ɫ ɤɨɦɩɥɟɤɫɨɦ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɯ ɦɟɪ.
Ɂɚɳɢɬɚ ɭɝɪɨɠɚɟɦɵɯ ɯɨɡɹɣɫɬɜ ɨɬ ɡɚɧɨɫɚ ɜɨɡɛɭɞɢɬɟɥɹ ɢɧɮɟɤɰɢɢ ɬɨɥɶɤɨ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɦɢ ɦɟɪɚɦɢ ɨɤɚɡɚɥɚɫɶ ɜ ɫɨɜɪɟɦɟɧɧɵɯ ɭɫɥɨɜɢɹɯ ɬɚɤɠɟ ɧɟɧɚɞɟɠɧɨɣ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɫɩɟɰɢɮɢɱɟɫɤɚɹ ɩɪɨɮɢɥɚɤɬɢɤɚ ɛɪɭɰɟɥɥɟɡɚ ɠɢɜɨɬɧɵɯ ɨɫɬɚɥɚɫɶ ɜɟɫɶɦɚ ɚɤɬɭɚɥɶɧɨɣ. Ȼɨɥɟɟ ɬɨɝɨ, ɷɬɚ ɚɤɬɭɚɥɶɧɨɫɬɶ ɜ ɪɹɞɟ ɪɟɝɢɨɧɨɜ ɪɟɡɤɨ ɜɨɡɪɨɫɥɚ.
Ɉɞɧɚɤɨ, ɩɪɚɤɬɢɤɚ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɧɚ ɪɹɞɟ ɬɟɪɪɢɬɨɪɢɣ ɤɚɤ Ɋɨɫɫɢɢ, ɬɚɤ ɢ Ʉɚɡɚɯɫɬɚɧɚ ɢ Ɇɨɧɝɨɥɢɢ
ɫɮɨɪɦɢɪɨɜɚɥɢɫɶ ɫɬɚɰɢɨɧɚɪɧɨ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɟ ɩɨ ɛɪɭɰɟɥɥɟɡɭ ɡɨɧɵ, ɝɞɟ ɭ ɠɢɜɨɬɧɵɯ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɨɝɨ ɢɦɦɭɧɢɬɟɬɚ ɧɟɬ ɜɨɨɛɳɟ, ɥɢɛɨ ɟɝɨ ɜɵɫɨɤɢɣ ɭɪɨɜɟɧɶ ɫɬɚɛɢɥɶɧɨ ɧɟ ɩɨɞɞɟɪɠɢɜɚɟɬɫɹ. ȼ
Ɋɨɫɫɢɢ ɷɬɨ ɪɹɞ ɪɟɝɢɨɧɨɜ ɋɟɜɟɪɨ-Ʉɚɜɤɚɡɫɤɨɝɨ ɢ ɘɠɧɨɝɨ ɮɟɞɟɪɚɥɶɧɵɯ ɨɤɪɭɝɨɜ, ɚ ɬɚɤɠɟ ɧɟɤɨɬɨɪɵɟ
ɬɟɪɪɢɬɨɪɢɢ ɋɢɛɢɪɢ (Ɋɟɫɩɭɛɥɢɤɚ Ɍɵɜɚ, Ɂɚɛɚɣɤɚɥɶɟ), ɝɞɟ ɩɪɟɜɚɥɢɪɭɟɬ ɩɚɫɬɛɢɳɧɨɟ ɫɨɞɟɪɠɚɧɢɟ ɠɢɜɨɬɧɵɯ. Ʉɪɨɦɟ ɬɨɝɨ ɫɭɳɟɫɬɜɭɟɬ ɪɹɞ ɬɟɪɪɢɬɨɪɢɣ, ɝɞɟ ɫɨɫɪɟɞɨɬɨɱɟɧɨ ɦɧɨɝɨ ɧɟɢɦɦɭɧɧɨɝɨ ɫɤɨɬɚ ɢ
ɪɟɚɥɶɧɨ ɫɭɳɟɫɬɜɭɟɬ ɛɨɥɶɲɚɹ ɭɝɪɨɡɚ ɡɚɧɨɫɚ ɜɨɡɛɭɞɢɬɟɥɟɣ ɢɡ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɡɨɧ.
ȼ Ɋɨɫɫɢɢ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɨɮɢɰɢɚɥɶɧɨ ɪɟɝɥɚɦɟɧɬɢɪɨɜɚɧɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɭ ɫ.-ɯ. ɠɢɜɨɬɧɵɯ
ɠɢɜɵɯ ɜɚɤɰɢɧ ɢɡ ɚɝɝɥɸɬɢɧɨɝɟɧɧɵɯ ɲɬɚɦɦɨɜ B. abortus 19 ɢ B. melitensis Rev-1, ɚ ɬɚɤɠɟ ɫɥɚɛɨɚɝɝɥɸɬɢɧɨɝɟɧɧɵɯ ɲɬɚɦɦɨɜ B. abortus 82 ɢ 75/79-Ⱥȼ.
ȼ ɷɬɨɣ ɫɜɹɡɢ ɫɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɠɢɜɵɟ ɚɝɝɥɸɬɢɧɨɝɟɧɧɵɟ ɜɚɤɰɢɧɵ ɩɪɢɡɧɚɧɵ ɜ ɦɢɪɟ ɤɚɤ
ɫɚɦɵɟ ɢɦɦɭɧɨɝɟɧɧɵɟ. Ɉɧɢ ɫɩɨɫɨɛɧɵ ɮɨɪɦɢɪɨɜɚɬɶ ɤɚɤ ɧɚɞɟɠɧɵɣ ɝɪɭɧɞɢɦɦɭɧɢɬɟɬ, ɬɚɤ ɢ ɨɛɟɫɩɟɱɢɜɚɬɶ ɩɟɪɦɚɧɟɧɬɧɵɣ ɢɦɦɭɧɢɬɟɬ ɡɚ ɫɱɟɬ ɪɟɢɦɦɭɧɢɡɚɰɢɣ ɠɢɜɨɬɧɵɯ ɜ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɢ ɭɝɪɨɠɚɟɦɵɯ ɯɨɡɹɣɫɬɜɚɯ. Ɉɞɧɚɤɨ ɢɯ ɩɪɢɦɟɧɟɧɢɟ ɩɨɞɤɨɠɧɵɦ ɦɟɬɨɞɨɦ ɜ ɪɟɤɨɦɟɧɞɨɜɚɧɧɵɯ ɞɨɡɚɯ ɜɨɡɦɨɠɧɨ
ɥɢɲɶ ɞɥɹ ɩɟɪɜɢɱɧɨɣ ɢɦɦɭɧɢɡɚɰɢɢ ɦɨɥɨɞɧɹɤɚ. ɉɪɢ ɷɬɨɦ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɵɟ ɪɟɚɤɰɢɢ ɭɝɚɫɚɸɬ ɩɨɥɧɨɫɬɶɸ ɥɢɲɶ ɜ ɬɟɱɟɧɢɟ ɝɨɞɚ, ɢ ɬɨɥɶɤɨ ɬɨɝɞɚ ɦɨɠɧɨ ɨɫɭɳɟɫɬɜɥɹɬɶ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɭɸ ɞɢɚɝɧɨɫɬɢɤɭ
ɛɪɭɰɟɥɥɟɡɚ, ɨɫɬɪɨ ɧɟɨɛɯɨɞɢɦɭɸ ɜ ɩɪɨɬɢɜɨɷɩɢɡɨɨɬɢɱɟɫɤɨɦ ɨɬɧɨɲɟɧɢɢ. Ⱦɚɥɶɧɟɣɲɢɟ ɪɟɢɦɦɭɧɢɡɚɰɢɢ ɠɢɜɨɬɧɵɯ ɠɢɜɵɦɢ ɚɝɝɥɸɬɢɧɨɝɟɧɧɵɦɢ ɜɚɤɰɢɧɚɦɢ ɩɨɞɤɨɠɧɵɦ ɦɟɬɨɞɨɦ ɜ ɷɬɨɦ ɨɬɧɨɲɟɧɢɢ
ɚɛɫɨɥɸɬɧɨ ɧɟɬɟɯɧɨɥɨɝɢɱɧɵ.
ɗɮɮɟɤɬɢɜɧɵɦ ɨɤɚɡɚɥɫɹ ɤɨɧɴɸɧɤɬɢɜɚɥɶɧɵɣ ɦɟɬɨɞ ɢɦɦɭɧɢɡɚɰɢɢ ɠɢɜɨɬɧɵɯ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɟɡɚ.
Ɍɚɤ, ɡɚ ɫɱɟɬ ɟɠɟɝɨɞɧɨɣ ɤɨɧɴɸɧɤɬɢɜɚɥɶɧɨɣ ɢɦɦɭɧɢɡɚɰɢɢ ɦɟɥɤɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɠɢɜɨɣ ɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬɚɦɦɚ 19 (ɞɨɡɚ 4 ɦɥɪɞ ɦ.ɤ.) ɢ ɛɟɫɩɪɟɩɹɬɫɬɜɟɧɧɨɣ ɪɚɧɧɟɣ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɨɣ
ɞɢɚɝɧɨɫɬɢɤɢ (ɫ ɩɨɦɨɳɶɸ ɊɂȾ ɫ Ɉ-ɉɋ ɚɧɬɢɝɟɧɨɦ ɭɠɟ ɱɟɪɟɡ 1 ɦɟɫɹɰ, ɊȺ ɢ ɊɋɄ – ɱɟɪɟɡ 3-4 ɦɟɫɹɰɚ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ (ɪɟɢɦɦɭɧɢɡɚɰɢɢ)) ɜ ɰɟɥɹɯ ɫɜɨɟɜɪɟɦɟɧɧɨɝɨ ɜɵɹɜɥɟɧɢɹ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ
ɠɢɜɨɬɧɵɯ ɢ ɩɨɫɥɟɞɭɸɳɟɝɨ ɤɨɧɬɪɨɥɹ ɛɥɚɝɨɩɨɥɭɱɢɹ ɭɞɚɥɨɫɶ ɨɫɭɳɟɫɬɜɢɬɶ ɛɵɫɬɪɨɟ ɤɭɩɢɪɨɜɚɧɢɟ
ɷɩɢɡɨɨɬɢɱɟɫɤɢɯ ɨɱɚɝɨɜ ɛɪɭɰɟɥɥɟɡɚ ɜ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɡɨɧɚɯ ɢ ɧɟɞɨɩɭɳɟɧɢɟ ɢɯ ɜɨɡɧɢɤɧɨɜɟɧɢɹ
ɜ ɭɝɪɨɠɚɟɦɵɯ ɡɨɧɚɯ ɜ ɭɫɥɨɜɢɹɯ Ɋɟɫɩɭɛɥɢɤ Ɍɵɜɚ ɢ ɏɚɤɚɫɢɹ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɪɚɫɫɦɚɬɪɢɜɚɟɬɫɹ ɜɨɩɪɨɫ ɨ ɲɢɪɨɤɨɦ ɜɧɟɞɪɟɧɢɢ ɤɨɧɴɸɧɤɬɢɜɚɥɶɧɨɣ ɢɦɦɭɧɢɡɚɰɢɢ ɦɟɥɤɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɨɬɢɜ
ɛɪɭɰɟɥɥɟɡɚ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬɚɦɦɚ 19 ɜ ɦɚɫɲɬɚɛɚɯ ɫɬɪɚɧɵ. ɍ ɞɪɭɝɨɣ ɠɢɜɨɣ ɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɵ – ɢɡ ɲɬɚɦɦɚ B. melitensis Rev-1 ɫɭɳɟɫɬɜɭɸɬ ɧɟɤɨɬɨɪɵɟ ɢɡɞɟɪɠɤɢ, ɫɜɹɡɚɧɧɵɟ ɫ ɟɟ ɜɵɫɨɤɨɣ
ɨɫɬɚɬɨɱɧɨɣ ɜɢɪɭɥɟɧɬɧɨɫɬɶɸ: ɚɛɨɪɬɨɝɟɧɧɨɫɬɶ, ɩɨɬɟɧɰɢɚɥɶɧɚɹ ɷɩɢɞɟɦɢɱɟɫɤɚɹ ɨɩɚɫɧɨɫɬɶ. Ʉɪɨɦɟ
ɬɨɝɨ, ɜ ɞɚɥɶɧɟɣɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɹɯ ɛɵɥɚ ɞɨɤɚɡɚɧɚ ɜɨɡɦɨɠɧɨɫɬɶ ɨɛɴɟɤɬɢɜɧɨɣ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɨɣ
ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɨɣ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɨɰɟɧɤɢ ɫɬɚɞ ɦɟɥɤɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɢɧɮɢɰɢɪɨɜɚɧɧɨɝɨ ɛɪɭɰɟɥɥɚɦɢ ɜɢɞɚ melitensis, ɬɨɥɶɤɨ ɜ ɫɥɭɱɚɟ ɢɦɦɭɧɢɡɚɰɢɢ ɠɢɜɨɬɧɵɯ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬɚɦɦɚ B. ɚbortus, ɡɚ
ɫɱɟɬ ɧɨɜɨɝɨ ɦɟɬɨɞɚ ɞɢɚɝɧɨɫɬɢɤɢ ɛɪɭɰɟɥɥɟɡɚ ɦɟɥɤɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɨɫɧɨɜɚɧɧɨɝɨ ɧɚ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɊɂȾ ɫ Ɉ-ɉɋ ɚɧɬɢɝɟɧɨɦ, ɢɡɝɨɬɨɜɥɟɧɧɵɦ ɢɡ B. melitensis.
ɍ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɠɢɜɨɣ ɜɵɫɨɤɨ ɢɦɦɭɧɨɝɟɧɧɨɣ ɚɝɝɥɸɬɢɧɨɝɟɧɧɨɣ ɜɚɤɰɢɧɵ ɢɡ ɲɬɚɦɦɚ B. abortus 19 ɜ ɞɨɡɟ 80 ɦɥɪɞ ɦ.ɤ. ɩɨɞɤɨɠɧɨ ɩɪɢɡɧɚɧɨ ɬɟɯɧɨɥɨɝɢɱɧɵɦ ɞɥɹ ɩɟɪɜɢɱɧɨɣ ɢɦɦɭɧɢɡɚɰɢɢ ɦɨɥɨɞɧɹɤɚ ɜ 2–4 ɦɟɫɹɱɧɨɦ ɜɨɡɪɚɫɬɟ ɜ ɫɥɨɠɧɵɯ ɷɩɢɡɨɨɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɹɯ.
Ⱦɚɥɶɧɟɣɲɢɟ ɪɟɢɦɦɭɧɢɡɚɰɢɢ ɠɢɜɨɬɧɵɯ ɧɚ ɷɬɨɦ ɮɨɧɟ ɰɟɥɟɫɨɨɛɪɚɡɧɵ ɭ ɬɟɥɨɤ ɡɚ 2 ɦɟɫ. ɞɨ ɨɫɟɦɟɧɟɧɢɹ, ɚ ɞɚɥɟɟ ɭ ɤɨɪɨɜ – ɫ ɢɧɬɟɪɜɚɥɨɦ 1–2 ɝɨɞɚ ɠɢɜɨɣ ɜɚɤɰɢɧɨɣ ɢɡ ɫɥɚɛɨɚɝɝɥɸɬɢɧɨɝɟɧɧɨɝɨ ɲɬɚɦɦɚ
B. abortus 82. ɍɱɢɬɵɜɚɹ, ɱɬɨ ɭɤɚɡɚɧɧɚɹ ɜɚɤɰɢɧɚ ɨɛɥɚɞɚɟɬ ɚɛɨɪɬɨɝɟɧɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɟɟ ɦɨɠɧɨ
ɩɪɢɦɟɧɹɬɶ ɧɚ ɜɡɪɨɫɥɵɯ ɛɟɪɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɬɨɥɶɤɨ ɫ ɧɚɥɢɱɢɟɦ ɩɪɟɞɜɚɪɢɬɟɥɶɧɨ ɫɨɡɞɚɧɧɨɝɨ
ɢɦɦɭɧɧɨɝɨ ɮɨɧɚ. ȼ ɷɬɢɯ ɰɟɥɹɯ ɩɪɢɟɦɥɟɦɨɣ ɨɤɚɡɚɥɚɫɶ ɠɢɜɚɹ ɜɚɤɰɢɧɚ ɢɡ ɫɥɚɛɨɚɝɝɥɸɬɢɧɨɝɟɧɧɨɝɨ
ɲɬɚɦɦɚ B. abortus 75/79-Ⱥȼ. ȼ ɭɝɪɨɠɚɟɦɵɯ ɡɨɧɚɯ ɜɨɡɦɨɠɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɜɚɤɰɢɧɭ ɢɡ ɲɬɚɦɦɚ 82
237
ɤɚɤ ɞɥɹ ɩɟɪɜɢɱɧɨɣ ɢɦɦɭɧɢɡɚɰɢɢ ɦɨɥɨɞɧɹɤɚ, ɬɚɤ ɢ ɩɨɫɥɟɞɭɸɳɟɣ ɪɟɢɦɦɭɧɢɡɚɰɢɟɣ ɜɡɪɨɫɥɨɝɨ ɩɨɝɨɥɨɜɶɹ ɫ ɩɟɪɜɢɱɧɵɦ ɢɦɦɭɧɧɵɦ ɮɨɧɨɦ.
ȼ ɭɫɥɨɜɢɹɯ ɊɎ ɭɤɚɡɚɧɧɵɟ ɫɯɟɦɵ ɪɟɢɦɦɭɧɢɡɚɰɢɢ ɧɚɲɥɢ ɲɢɪɨɤɨɟ ɩɪɢɦɟɧɟɧɢɟ ɫ ɜɵɫɨɤɢɦ ɩɪɨɬɢɜɨɷɩɢɡɨɨɬɢɱɟɫɤɢɦ, ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɦ ɢ ɷɤɨɧɨɦɢɱɟɫɤɢɦ ɷɮɮɟɤɬɨɦ.
ȼ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ ɜ ɭɫɥɨɜɢɹɯ ɭɝɪɨɠɚɟɦɵɯ ɢ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɮɟɪɦ ɤɨɪɩɨɪɚɰɢɢ «ȼɨɫɬɨɤɆɨɥɨɤɨ» (ȼɨɫɬɨɱɧɨ-Ʉɚɡɚɯɫɬɚɧɫɤɚɹ ɨɛɥɚɫɬɶ) ɜ 2012–2014 ɝɨɞɚɯ ɜɧɟɞɪɟɧɚ ɫɢɫɬɟɦɚ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɧɚ ɨɫɧɨɜɟ ɨɛɟɫɩɟɱɟɧɢɹ ɜ ɫɬɚɞɚɯ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɟɪɦɚɧɟɧɬɧɨɝɨ ɢɦɦɭɧɢɬɟɬɚ ɫ ɩɨɦɨɳɶɸ ɠɢɜɵɯ ɜɚɤɰɢɧ ɢɡ ɲɬɚɦɦɨɜ 19, 82 ɢ 75/79-Ⱥȼ ɢ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɫ ɪɚɰɢɨɧɚɥɶɧɵɦ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɢɯ ɩɪɨɜɨɰɢɪɭɸɳɢɯ ɫɜɨɣɫɬɜ. ɗɬɨ ɩɨɡɜɨɥɢɥɨ ɜ ɬɟɱɟɧɢɟ ɞɜɭɯ
ɥɟɬ ɛɨɥɟɟ ɱɟɦ ɜ ɬɪɢ ɪɚɡɚ ɫɨɤɪɚɬɢɬɶ ɱɢɫɥɨ ɜɵɹɜɥɹɟɦɵɯ ɷɩɢɡɨɨɬɢɱɟɫɤɢ ɨɩɚɫɧɵɯ ɠɢɜɨɬɧɵɯ, ɞɨɜɟɞɹ
ɢɯ ɞɨ ɟɞɢɧɢɱɧɵɯ ɫɥɭɱɚɟɜ ɜ ɨɬɞɟɥɶɧɵɯ ɝɭɪɬɚɯ. Ɋɟɡɭɥɶɬɚɬɵ ɞɢɮɮɟɪɟɧɰɢɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɫɵɜɨɪɨɬɨɤ ɤɪɨɜɢ ɠɢɜɨɬɧɵɯ ɫ ɊȺ ɢ ɊɋɄ ɜ ɧɢɡɤɢɯ ɬɢɬɪɚɯ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɊɂȾ ɫ Ɉ-ɉɋ ɚɧɬɢɝɟɧɨɦ ɢ
ɊɋɄ ɫ R-ɚɧɬɢɝɟɧɨɦ ɩɨɤɚɡɵɜɚɸɬ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɵɣ ɯɚɪɚɤɬɟɪ ɬɚɤɢɯ ɪɟɚɤɰɢɣ. ȼ ɷɬɨɣ ɫɜɹɡɢ ɫɥɟɞɭɟɬ
ɨɫɨɛɨ ɩɨɞɱɟɪɤɧɭɬɶ, ɱɬɨ ɩɪɢɧɹɬɚɹ ɜ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ ɫɯɟɦɚ ɞɢɚɝɧɨɫɬɢɤɢ ɛɪɭɰɟɥɥɟɡɚ ɤɪɭɩɧɨɝɨ
ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɧɚ ɨɫɧɨɜɟ ɊȻɉ (Ɋɨɡ ɛɟɧɝɚɥ ɩɪɨɛɵ), ɢɡ-ɡɚ ɟɟ ɜɵɫɨɤɨɣ ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ, ɜ ɭɫɥɨɜɢɹɯ
ɜɚɤɰɢɧɚɰɢɢ ɢ ɪɟɜɚɤɰɢɧɚɰɢɢ ɧɟɩɪɢɟɦɥɟɦɚ, ɱɬɨ ɩɨɞɬɜɟɪɠɞɚɟɬɫɹ ɦɢɪɨɜɨɣ ɢ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɩɪɚɤɬɢɤɨɣ. Ɍɚɤ, ɩɪɢ ɤɨɦɩɥɟɤɫɧɨɦ ɢɫɫɥɟɞɨɜɚɧɢɢ ɧɚ ɛɪɭɰɟɥɥɟɡ 90 ɩɪɨɛ ɫɵɜɨɪɨɬɨɤ ɤɪɨɜɢ ɦɧɨɝɨɤɪɚɬɧɨ ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɯ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɟɡɚ ɠɢɜɨɬɧɵɯ ɢɡ ɨɡɞɨɪɚɜɥɢɜɚɟɦɵɯ ɫɬɚɞ ɬɨɥɶɤɨ ɜ 5 ɩɪɨɛɚɯ ɨɬɦɟɱɟɧɚ
ɩɨɥɨɠɢɬɟɥɶɧɚɹ ɊɋɄ ɫ S-ɚɧɬɢɝɟɧɨɦ ɜ ɪɚɡɜɟɞɟɧɢɢ 1:20 ɢ ɜɵɲɟ. ɗɬɢɯ ɠɢɜɨɬɧɵɯ ɩɨɞɜɟɪɝɥɢ ɭɛɨɸ, ɤɚɤ
ɩɪɟɞɫɬɚɜɥɹɸɳɢɯ ɷɩɢɡɨɨɬɢɱɟɫɤɭɸ ɨɩɚɫɧɨɫɬɶ.
ɉɪɢ ɷɬɨɦ ɊɂȾ ɫ Ɉ-ɉɋ ɚɧɬɢɝɟɧɨɦ ɛɵɥɚ ɨɬɪɢɰɚɬɟɥɶɧɨɣ ɜɨ ɜɫɟɯ 90 ɩɪɨɛɚɯ, ɜɵɫɨɤɢɯ ɬɢɬɪɨɜ ɊȺ ɧɟ
ɜɵɹɜɥɟɧɨ. ɊɋɄ ɫ R-ɚɧɬɢɝɟɧɨɦ ɛɵɥɚ ɭ ɛɨɥɶɲɢɧɫɬɜɚ ɢɫɫɥɟɞɨɜɚɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɢ ɷɬɨɦ ɟɟ ɬɢɬɪɵ,
ɤɚɤ ɩɪɚɜɢɥɨ, ɩɪɟɜɵɲɚɥɢ ɬɚɤɨɜɵɟ ɜ ɊɋɄ ɫ S-ɚɧɬɢɝɟɧɨɦ.
ȼ ɫɨɜɪɟɦɟɧɧɵɯ ɭɫɥɨɜɢɹɯ ɤɚɤ Ɋɨɫɫɢɢ, ɬɚɤ ɢ ɞɪɭɝɢɯ ɫɬɪɚɧ (Ʉɚɡɚɯɫɬɚɧ, Ɇɨɧɝɨɥɢɹ ɢ ɞɪ.) ɲɢɪɨɤɨɟ
ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɫɯɟɦ ɫɩɟɰɢɮɢɱɟɫɤɨɣ ɩɪɨɮɢɥɚɤɬɢɤɢ ɛɪɭɰɟɥɥɟɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɪɚɡɪɚɛɨɬɚɧɧɵɯ ɞɥɹ ɯɨɡɹɣɫɬɜ ɫ ɢɡɨɥɢɪɨɜɚɧɧɵɦ ɫɨɞɟɪɠɚɧɢɟɦ ɪɚɡɥɢɱɧɵɯ ɩɨɥɨɜɨɡɪɚɫɬɧɵɯ ɝɪɭɩɩ ɫ ɪɚɡɧɵɦ
ɢɦɦɭɧɧɵɦ ɢ ɷɩɢɡɨɨɬɢɱɟɫɤɢɦ ɮɨɧɨɦ, ɫɬɚɥɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢ ɫɥɨɠɧɵɦ, ɚ ɜɨ ɦɧɨɝɢɯ ɫɥɭɱɚɹɯ – ɧɟɜɨɡɦɨɠɧɵɦ. Ɋɟɫɬɪɭɤɬɭɪɢɡɚɰɢɹ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɩɪɢɜɟɥɚ, ɜ ɱɚɫɬɧɨɫɬɢ, ɤ ɦɧɨɝɨɱɢɫɥɟɧɧɵɦ ɦɟɥɤɢɦ
ɯɨɡɹɣɫɬɜɚɦ (ɥɢɱɧɵɦ, ɩɨɞɫɨɛɧɵɦ, ɤɪɟɫɬɶɹɧɫɤɨ-ɮɟɪɦɟɪɫɤɢɦ ɢ ɬ.ɩ.). ȼ ɧɢɯ ɜɫɟ ɩɨɥɨɜɨɡɪɚɫɬɧɵɟ ɝɪɭɩɩɵ ɠɢɜɨɬɧɵɯ ɫɬɚɥɢ ɫɨɞɟɪɠɚɬɶɫɹ ɜɦɟɫɬɟ, ɚ ɮɨɪɦɢɪɨɜɚɧɢɟ ɢ ɩɟɪɟɮɨɪɦɢɪɨɜɚɧɢɟ ɩɨɝɨɥɨɜɶɹ ɩɪɨɢɫɯɨɞɢɥɨ ɢ ɩɪɨɢɫɯɨɞɢɬ ɛɟɡ ɞɨɥɠɧɨɝɨ ɭɱɟɬɚ ɢɯ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɩɨ ɛɪɭɰɟɥɥɟɡɭ. ȼ ɢɬɨɝɟ
ɨɫɧɨɜɧɨɟ ɩɨɝɨɥɨɜɶɟ ɠɢɜɨɬɧɵɯ ɨɤɚɡɚɥɨɫɶ ɧɟɢɦɦɭɧɧɵɦ.
ɂɧɵɦɢ ɫɥɨɜɚɦɢ, ɫɩɟɰɢɮɢɱɟɫɤɚɹ ɩɪɨɮɢɥɚɤɬɢɤɚ ɛɪɭɰɟɥɥɟɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɭɫɥɨɜɢɹɯ
ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɢ ɭɝɪɨɠɚɟɦɵɯ ɯɨɡɹɣɫɬɜɚɯ ɬɚɤɨɝɨ ɬɢɩɚ ɨɫɬɪɨ ɧɟɨɛɯɨɞɢɦɚ, ɟɫɥɢ ɧɟ ɛɭɞɟɬ ɜɨɡɦɨɠɧɨɫɬɢ ɢɫɩɨɥɶɡɨɜɚɬɶ ɪɚɞɢɤɚɥɶɧɵɣ ɦɟɬɨɞ ɛɨɪɶɛɵ – ɥɢɤɜɢɞɚɰɢɸ ɜɫɟɝɨ ɫɤɨɦɩɪɨɦɟɬɢɪɨɜɚɧɧɨɝɨ ɩɨ
ɛɪɭɰɟɥɥɟɡɭ ɩɨɝɨɥɨɜɶɹ.
Ⱦɥɹ ɷɬɨɝɨ ɧɟɨɛɯɨɞɢɦɵ ɧɨɜɵɟ ɫɯɟɦɵ ɜɚɤɰɢɧɚɰɢɢ. ɉɨɩɵɬɤɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɞɥɹ ɷɬɢɯ ɰɟɥɟɣ
ɢɧɚɝɝɥɸɬɢɧɨɝɟɧɧɵɯ ɜɚɤɰɢɧ, ɧɟ ɩɪɟɩɹɬɫɬɜɭɸɳɢɯ ɞɚɥɶɧɟɣɲɟɣ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɨɣ ɞɢɚɝɧɨɫɬɢɤɟ,
ɨɤɚɡɚɥɢɫɶ ɩɪɚɤɬɢɱɟɫɤɢ ɛɟɡɭɫɩɟɲɧɵɦɢ, ɬɚɤ ɤɚɤ ɜɚɤɰɢɧɵ ɬɚɤɨɝɨ ɬɢɩɚ ɨɛɥɚɞɚɸɬ ɧɢɡɤɨɣ ɢɦɦɭɧɨɝɟɧɧɨɫɬɶɸ ɢ ɞɥɹ ɩɟɪɜɢɱɧɨɣ ɢɦɦɭɧɢɡɚɰɢɢ ɪɚɧɟɟ ɧɟ ɢɦɦɭɧɢɡɢɪɨɜɚɧɧɨɝɨ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɟɡɚ ɫɤɨɬɚ ɧɟ
ɩɪɢɟɦɥɟɦɵ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɧɟɬ ɢ ɩɪɚɤɬɢɱɟɫɤɢ ɩɪɢɟɦɥɟɦɨɣ ɞɥɹ ɬɚɤɢɯ ɫɢɬɭɚɰɢɣ ɢɧɚɤɬɢɜɢɪɨɜɚɧɧɨɣ ɜɚɤɰɢɧɵ. ɉɨɢɫɤ ɧɨɜɵɯ ɜɚɤɰɢɧ ɢɥɢ ɨɩɬɢɦɚɥɶɧɵɯ ɫɯɟɦ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɢɡɜɟɫɬɧɵɯ ɜɚɤɰɢɧ
ɩɪɨɞɨɥɠɚɟɬɫɹ.
ɍȾɄ 619:616.98:578.828.11:[636:612.014.4]
ɎȺɄɌɈɊɕ ɊɂɋɄȺ ɊȺɁȼɂɌɂə ɅȿɃɄɈɁȺ
ɄɊɍɉɇɈȽɈ ɊɈȽȺɌɈȽɈ ɋɄɈɌȺ
1
ȾɈɇɑȿɇɄɈ Ⱥ.ɋ., 2 ɅɈȽɂɇɈȼ ɋ.ɂ., 3 ɌȺȻȺɄȺȿȼ ȼ.ȼ., 4 ȼɕɋɈɑɂɇ Ⱥ.ȼ.
1
ɎȽȻɍ ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ
2
ɇɨɜɨɫɢɛɢɪɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɚɝɪɚɪɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ
3
ɍɩɪɚɜɥɟɧɢɟ ɜɟɬɟɪɢɧɚɪɢɢ Ɍɨɦɫɤɨɣ ɨɛɥɚɫɬɢ
4
ɍɩɪɚɜɥɟɧɢɟ ɜɟɬɟɪɢɧɚɪɢɢ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ. E-mail: logsi-nsk@yandex.ru
Ɏɚɤɬɨɪɵ ɪɢɫɤɚ ɹɜɥɹɸɬɫɹ ɧɟɨɬɴɟɦɥɟɦɨɣ ɫɨɫɬɚɜɥɹɸɳɟɣ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ ɢ ɩɪɢɜɨɞɹɬ ɤ
ɭɜɟɥɢɱɟɧɢɸ ɪɢɫɤɚ ɜɨɡɧɢɤɧɨɜɟɧɢɹ ɡɚɛɨɥɟɜɚɧɢɹ. ɇɚɱɢɧɚɹ ɫ ɮɭɧɞɚɦɟɧɬɚɥɶɧɵɯ ɪɚɛɨɬ ȼ.ɉ. ɒɢɲɤɨɜɚ
238
[1] ɦɧɨɝɢɟ ɢɫɫɥɟɞɨɜɚɬɟɥɢ ɫɜɹɡɵɜɚɥɢ ɪɢɫɤ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɫ ɝɟɧɟɬɢɱɟɫɤɢɦɢ ɮɚɤɬɨɪɚɦɢ [2, 3], ɬɟɯɧɨɝɟɧɧɵɦ ɡɚɝɪɹɡɧɟɧɢɟɦ ɫɪɟɞɵ [4, 5], ɩɨɱɜɟɧɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɦɢ ɭɫɥɨɜɢɹɦɢ [6, 7] ɢ ɞɪɭɝɢɦɢ ɩɪɢɱɢɧɚɦɢ. Ɉɞɧɚɤɨ ɛɨɥɶɲɢɧɫɬɜɨ ɚɜɬɨɪɨɜ ɨɝɪɚɧɢɱɢɜɚɥɢɫɶ ɢɡɭɱɟɧɢɟɦ
ɨɬɞɟɥɶɧɵɯ ɮɚɤɬɨɪɨɜ ɪɢɫɤɚ, ɚ ɩɨɥɭɱɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɧɟ ɩɨɡɜɨɥɹɥɢ ɤɨɥɢɱɟɫɬɜɟɧɧɨ ɨɰɟɧɢɬɶ ɫɨɜɨɤɭɩɧɵɣ ɪɢɫɤ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. Ⱦɥɹ ɨɰɟɧɤɢ ɜɨɡɞɟɣɫɬɜɢɹ ɮɚɤɬɨɪɨɜ ɪɢɫɤɚ
ɧɚ ɩɨɩɭɥɹɰɢɨɧɧɨɦ ɭɪɨɜɧɟ ɩɪɢɦɟɧɹɸɬ ɢɫɫɥɟɞɨɜɚɧɢɹ ɫɨɜɨɤɭɩɧɨɝɨ ɪɢɫɤɚ ɢɥɢ ɷɤɨɥɨɝɢɱɟɫɤɢɣ ɦɟɬɨɞ
ɢɫɫɥɟɞɨɜɚɧɢɹ [8, 9].
ɐɟɥɶ ɢɫɫɥɟɞɨɜɚɧɢɣ – ɩɪɨɜɟɫɬɢ ɷɤɨɥɨɝɨ-ɷɩɢɡɨɨɬɨɥɨɝɢɱɟɫɤɢɣ ɚɧɚɥɢɡ ɢ ɫɢɫɬɟɦɚɬɢɡɚɰɢɸ ɮɚɤɬɨɪɨɜ ɪɢɫɤɚ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɧɚɭɱɧɨ ɨɛɨɫɧɨɜɚɬɶ ɩɪɚɤɬɢɱɟɫɤɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɨɤɚɡɚɬɟɥɟɣ ɪɢɫɤɚ ɞɥɹ ɤɨɧɬɪɨɥɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ.
Ɉɛɴɟɤɬɚɦɢ ɢɫɫɥɟɞɨɜɚɧɢɣ ɹɜɥɹɥɢɫɶ ɷɩɢɡɨɨɬɢɱɟɫɤɢɣ ɢ ɢɧɮɟɤɰɢɨɧɧɵɣ ɩɪɨɰɟɫɫɵ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. ɗɩɢɡɨɨɬɢɱɟɫɤɚɹ ɨɛɫɬɚɧɨɜɤɚ ɩɨ ɷɬɨɣ ɛɨɥɟɡɧɢ ɢɡɭɱɟɧɚ ɩɨ ɞɚɧɧɵɦ ɜɟɬɟɪɢɧɚɪɧɨɣ
ɨɬɱɟɬɧɨɫɬɢ ɡɚ 12 ɥɟɬ (1990–2001 ɝɝ.) ɭɩɪɚɜɥɟɧɢɣ ɜɟɬɟɪɢɧɚɪɢɢ Ɍɨɦɫɤɨɣ ɨɛɥɚɫɬɢ ɢ Ʉɪɚɫɧɨɹɪɫɤɨɝɨ
ɤɪɚɹ ɢ ɞɚɧɧɵɦ ɫɨɛɫɬɜɟɧɧɵɯ ɷɤɫɩɟɞɢɰɢɨɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ.
Ⱦɥɹ ɨɰɟɧɤɢ ɨɬɧɨɫɢɬɟɥɶɧɨɝɨ ɪɢɫɤɚ ɢɫɩɨɥɶɡɨɜɚɥɢ ɦɟɬɨɞɵ, ɨɩɢɫɚɧɧɵɟ Ɋ. Ɏɥɟɬɱɟɪɨɦ ɢ ɞɪ. [9],
Ⱥ. Ⱥɥɶɛɨɦɨɦ, ɋ. ɇɨɪɟɥɥɨɦ [10]. Ɉɬɧɨɫɢɬɟɥɶɧɵɣ ɪɢɫɤ (relative risk, RR) – ɷɬɨ ɨɬɧɨɲɟɧɢɟ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ ɜ ɩɨɩɭɥɹɰɢɹɯ, ɩɨɞɜɟɪɝɚɜɲɢɯɫɹ ɢ ɧɟ ɩɨɞɜɟɪɝɚɜɲɢɯɫɹ ɜɨɡɞɟɣɫɬɜɢɸ ɮɚɤɬɨɪɚ ɪɢɫɤɚ. Ɍɚɤ ɤɚɤ
ɫɨɜɨɤɭɩɧɵɣ ɪɢɫɤ ɨɰɟɧɢɜɚɥɢ ɧɚ ɩɨɩɭɥɹɰɢɨɧɧɨɦ ɭɪɨɜɧɟ, ɞɥɹ RR ɞɨɩɨɥɧɢɬɟɥɶɧɨ ɩɪɢɜɟɞɟɧ ɭɪɨɜɟɧɶ
ɡɧɚɱɢɦɨɫɬɢ ɪɚɡɥɢɱɢɣ ɦɟɠɞɭ ɡɚɛɨɥɟɜɚɟɦɨɫɬɶɸ ɜ ɷɬɢɯ ɩɨɩɭɥɹɰɢɹɯ ɠɢɜɨɬɧɵɯ (Ɋ).
ɇɚɦɢ ɪɚɡɪɚɛɨɬɚɧɚ ɤɨɧɰɟɩɬɭɚɥɶɧɚɹ ɫɢɫɬɟɦɚ ɮɚɤɬɨɪɨɜ ɫɨɜɨɤɭɩɧɨɝɨ ɪɢɫɤɚ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɩɪɟɞɫɬɚɜɥɹɸɳɚɹ ɫɨɛɨɣ ɬɟɨɪɟɬɢɱɟɫɤɨɟ ɨɛɨɛɳɟɧɢɟ ɢ ɫɢɧɬɟɡ ɪɟɡɭɥɶɬɚɬɨɜ
ɫɨɛɫɬɜɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢ ɞɪɭɝɢɯ ɚɜɬɨɪɨɜ. Ⱦɚɧɧɚɹ ɫɢɫɬɟɦɚ ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬ ɩɪɚɤɬɢɱɟɫɤɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɨɤɚɡɚɬɟɥɟɣ ɪɢɫɤɚ ɞɥɹ ɤɨɧɬɪɨɥɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ. ɉɪɟɞɥɨɠɟɧɧɚɹ ɤɨɧɰɟɩɬɭɚɥɶɧɚɹ ɫɢɫɬɟɦɚ ɨɫɧɨɜɚɧɚ ɧɚ ɩɨɞɪɚɡɞɟɥɟɧɢɢ ɮɚɤɬɨɪɨɜ ɪɢɫɤɚ ɧɚ ɷɧɞɨɝɟɧɧɵɟ, ɫɜɹɡɚɧɧɵɟ ɫ ɨɫɨɛɟɧɧɨɫɬɹɦɢ ɨɪɝɚɧɢɡɦɚ ɠɢɜɨɬɧɵɯ, ɢ ɷɤɡɨɝɟɧɧɵɟ, ɨɛɭɫɥɨɜɥɟɧɧɵɟ ɜɧɟɲɧɢɦɢ ɜɨɡɞɟɣɫɬɜɢɹɦɢ.
ɗɧɞɨɝɟɧɧɵɟ ɮɚɤɬɨɪɵ ɪɢɫɤɚ ɜɤɥɸɱɚɸɬ ɩɨɪɨɞɧɨɫɬɶ, ɧɚɫɥɟɞɫɬɜɟɧɧɭɸ ɩɪɟɞɪɚɫɩɨɥɨɠɟɧɧɨɫɬɶ ɢ
ɜɨɡɪɚɫɬ ɜɨɫɩɪɢɢɦɱɢɜɵɯ ɠɢɜɨɬɧɵɯ. ɇɚɦɢ ɩɨɤɚɡɚɧɨ, ɱɬɨ ɪɚɡɜɟɞɟɧɢɟ ɱɟɪɧɨ-ɩɟɫɬɪɨɣ ɩɨɪɨɞɵ ɨɛɭɫɥɨɜɥɢɜɚɟɬ ɨɬɧɨɫɢɬɟɥɶɧɵɣ ɫɨɜɨɤɭɩɧɵɣ ɪɢɫɤ ɪɚɡɜɢɬɢɹ ɛɨɥɟɡɧɢ (RR) ɜ ɩɪɟɞɟɥɚɯ 14,6–62,6; Ɋ < 0,001,
ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɞɨɥɢ ɱɟɪɧɨ-ɩɟɫɬɪɨɝɨ ɫɤɨɬɚ ɜ ɩɨɩɭɥɹɰɢɢ ɢ ɞɚɜɧɨɫɬɢ ɟɝɨ ɡɚɜɨɡɚ.
Ʉɪɨɦɟ ɦɟɠɩɨɪɨɞɧɵɯ ɫɭɳɟɫɬɜɭɸɬ ɜɧɭɬɪɢɩɨɪɨɞɧɵɟ ɪɚɡɥɢɱɢɹ ɩɨ ɭɫɬɨɣɱɢɜɨɫɬɢ ɤ ɥɟɣɤɨɡɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. ȼ ɞɚɧɧɨɦ ɫɥɭɱɚɟ ɪɨɥɶ ɮɚɤɬɨɪɚ ɪɢɫɤɚ ɜɵɩɨɥɧɹɟɬ ɧɚɫɥɟɞɫɬɜɟɧɧɚɹ ɩɪɟɞɪɚɫɩɨɥɨɠɟɧɧɨɫɬɶ, ɩɟɪɟɞɚɧɧɚɹ ɨɬ ɪɨɞɢɬɟɥɟɣ (ɫɟɦɟɣɧɚɹ ɢ ɥɢɧɟɣɧɚɹ ɩɪɢɧɚɞɥɟɠɧɨɫɬɶ).
ȼɨɡɪɚɫɬ ɠɢɜɨɬɧɵɯ ɬɚɤɠɟ ɨɬɧɨɫɢɬɫɹ ɤ ɮɚɤɬɨɪɚɦ ɪɢɫɤɚ. Ʉɚɤ ɧɚɢɛɨɥɶɲɚɹ ɡɚɛɨɥɟɜɚɟɦɨɫɬɶ, ɬɚɤ ɢ
ɢɧɮɢɰɢɪɨɜɚɧɧɨɫɬɶ ɨɬɦɟɱɚɸɬɫɹ ɭ ɠɢɜɨɬɧɵɯ ɫɬɚɪɲɟɝɨ ɜɨɡɪɚɫɬɚ. Ʉɪɨɦɟ ɬɨɝɨ, ɜɵɫɤɚɡɚɧɨ ɩɪɟɞɩɨɥɨɠɟɧɢɟ [11], ɱɬɨ ɪɢɫɤ ɪɚɡɜɢɬɢɹ ɤɥɢɧɢɱɟɫɤɨɣ ɮɨɪɦɵ ɛɨɥɟɡɧɢ ɜɵɲɟ ɭ ɠɢɜɨɬɧɵɯ, ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɜ
ɛɨɥɟɟ ɪɚɧɧɟɦ ɜɨɡɪɚɫɬɟ.
ɉɨɤɚɡɚɬɟɥɢ ɪɢɫɤɚ ɩɨ ɷɧɞɨɝɟɧɧɵɦ ɮɚɤɬɨɪɚɦ ɭɱɢɬɵɜɚɸɬ ɩɪɢ ɩɥɚɧɢɪɨɜɚɧɢɢ ɢ ɜɧɟɞɪɟɧɢɢ ɡɨɨɬɟɯɧɢɱɟɫɤɢɯ ɦɟɪɨɩɪɢɹɬɢɣ, ɧɚɩɪɚɜɥɟɧɧɵɯ ɧɚ ɩɨɥɭɱɟɧɢɟ ɡɞɨɪɨɜɨɝɨ ɦɨɥɨɞɧɹɤɚ, ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɞɥɹ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ ɭɫɬɨɣɱɢɜɵɯ ɤ ɥɟɣɤɨɡɭ ɪɨɞɢɬɟɥɶɫɤɢɯ ɩɚɪ, ɚ ɬɚɤɠɟ ɫɜɨɟɜɪɟɦɟɧɧɭɸ ɜɵɛɪɚɤɨɜɤɭ ɫɬɚɪɵɯ
ɠɢɜɨɬɧɵɯ.
Ƚɪɭɩɩɚ ɷɤɡɨɝɟɧɧɵɯ ɮɚɤɬɨɪɨɜ ɛɨɥɟɟ ɨɛɲɢɪɧɚ ɢ ɞɨɩɨɥɧɢɬɟɥɶɧɨ ɩɨɞɪɚɡɞɟɥɹɟɬɫɹ ɧɚ ɷɤɨɥɨɝɢɱɟɫɤɢɟ, ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɢ ɛɢɨɥɨɝɢɱɟɫɤɢɟ.
ɗɤɨɥɨɝɢɱɟɫɤɢɟ ɮɚɤɬɨɪɵ ɪɢɫɤɚ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɫɜɹɡɚɧɵ ɫ ɛɢɨɝɟɨɯɢɦɢɱɟɫɤɢɦɢ ɭɫɥɨɜɢɹɦɢ ɫɪɟɞɵ ɢ ɟɟ ɬɟɯɧɨɝɟɧɧɵɦ ɡɚɝɪɹɡɧɟɧɢɟɦ (ɩɨɜɵɲɟɧɧɨɟ ɫɨɞɟɪɠɚɧɢɟ ɜ ɩɨɱɜɚɯ
ɢ ɜɨɞɚɯ ɪɚɞɢɨɧɭɤɥɢɞɨɜ, ɧɟɮɬɟɩɪɨɞɭɤɬɨɜ, ɩɟɫɬɢɰɢɞɨɜ, ɚɡɨɬɧɵɯ ɢ ɦɢɧɟɪɚɥɶɧɵɯ ɭɞɨɛɪɟɧɢɣ, ɫɜɢɧɰɚ,
ɯɪɨɦɚ, ɚ ɬɚɤɠɟ ɞɪɭɝɢɯ ɤɚɧɰɟɪɨɝɟɧɨɜ).
ɍɱɟɬ ɩɨɤɚɡɚɬɟɥɟɣ ɷɤɨɥɨɝɢɱɟɫɤɨɝɨ ɪɢɫɤɚ ɰɟɥɟɫɨɨɛɪɚɡɟɧ ɞɥɹ ɩɪɨɝɧɨɡɚ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ
ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ.
Ʉ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɮɚɤɬɨɪɚɦ ɪɢɫɤɚ ɨɬɧɨɫɹɬɫɹ ɬɟɯɧɨɥɨɝɢɹ ɫɨɞɟɪɠɚɧɢɹ ɠɢɜɨɬɧɵɯ ɢ ɦɚɧɢɩɭɥɹɰɢɢ ɫ ɧɢɦɢ ɩɪɢ ɜɟɬɟɪɢɧɚɪɧɨ-ɡɨɨɬɟɯɧɢɱɟɫɤɢɯ ɨɛɪɚɛɨɬɤɚɯ (ɹɬɪɨɝɟɧɧɵɣ ɮɚɤɬɨɪ). ɍɪɨɜɟɧɶ ɩɟɪɟɡɚɪɚɠɚɧɢɹ ɠɢɜɨɬɧɵɯ ɜɢɪɭɫɨɦ ɥɟɣɤɨɡɚ ɜɨ ɦɧɨɝɨɦ ɨɩɪɟɞɟɥɹɟɬɫɹ ɧɚɥɢɱɢɟɦ ɥɟɬɧɢɯ ɥɚɝɟɪɟɣ, ɫɨɜɦɟɫɬɧɵɯ
ɜɵɩɚɫɨɜ, ɝɪɭɩɩɨɜɵɯ ɩɨɢɥɨɤ, ɫɨɜɦɟɫɬɧɵɯ ɨɬɟɥɨɜ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɡɞɨɪɨɜɵɯ ɤɨɪɨɜ, ɜɜɨɞɨɦ ɝɪɭɩɩ
ɩɟɪɜɨɬɟɥɨɤ, ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɫɛɨɪɧɨɝɨ ɦɨɥɨɤɚ ɞɥɹ ɜɵɩɨɣɤɢ ɬɟɥɹɬɚɦ ɜ ɩɨɫɥɟɦɨɥɨɡɢɜɧɵɣ ɩɟɪɢɨɞ.
Ɉɬɦɟɱɟɧɨ ɧɟɝɚɬɢɜɧɨɟ ɜɥɢɹɧɢɟ ɛɟɫɩɪɢɜɹɡɧɨɝɨ ɫɨɞɟɪɠɚɧɢɹ ɤɨɪɨɜ ɧɚ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɩɪɢ ɥɟɣɤɨɡɟ. əɬɪɨɝɟɧɧɵɟ ɮɚɤɬɨɪɵ ɫɜɹɡɚɧɵ ɫ ɧɚɪɭɲɟɧɢɹɦɢ ɩɪɚɜɢɥ ɚɫɟɩɬɢɤɢ
ɩɪɢ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɯ ɨɛɪɚɛɨɬɤɚɯ (ɧɟɫɬɟɪɢɥɶɧɵɟ ɢɝɥɵ ɞɥɹ ɜɡɹɬɢɹ ɤɪɨɜɢ ɢ ɢɧɴɟɤɰɢɣ, ɯɢɪɭɪɝɢɱɟɫɤɢɟ ɢɧɫɬɪɭɦɟɧɬɵ, ɧɨɫɨɜɵɟ ɳɢɩɰɵ ɢɥɢ ɪɭɤɢ ɮɢɤɫɚɬɨɪɚ ɠɢɜɨɬɧɵɯ, ɧɟɨɛɪɚɛɨɬɚɧɧɵɟ ɪɭɤɢ
ɝɢɧɟɤɨɥɨɝɚ, ɞɨɢɥɶɧɵɣ ɚɩɩɚɪɚɬ).
ɉɨɤɚɡɚɬɟɥɢ ɪɢɫɤɚ ɩɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɮɚɤɬɨɪɚɦ ɢɫɩɨɥɶɡɭɸɬɫɹ ɤɚɤ ɜ ɦɟɪɨɩɪɢɹɬɢɹɯ, ɧɚɩɪɚɜɥɟɧɧɵɯ ɧɚ ɭɩɪɚɜɥɟɧɢɟ ɷɩɢɡɨɨɬɢɱɟɫɤɢɦ ɩɪɨɰɟɫɫɨɦ, ɬɚɤ ɢ ɞɥɹ ɩɪɨɝɧɨɡɚ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɢ.
239
ɗɤɡɨɝɟɧɧɵɦɢ ɛɢɨɥɨɝɢɱɟɫɤɢɦɢ ɮɚɤɬɨɪɚɦɢ ɪɢɫɤɚ ɹɜɥɹɸɬɫɹ ɪɚɡɥɢɱɧɵɟ ɛɚɤɬɟɪɢɚɥɶɧɨ-ɜɢɪɭɫɧɨɩɚɪɚɡɢɬɚɪɧɵɟ ɚɫɫɨɰɢɨɡɵ ɭ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɜɢɪɭɫɨɦ ɥɟɣɤɨɡɚ ɠɢɜɨɬɧɵɯ, ɫɩɨɫɨɛɧɵɟ ɩɪɨɜɨɰɢɪɨɜɚɬɶ ɤɥɢɧɢɤɨ-ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɟ ɩɪɨɹɜɥɟɧɢɟ ɛɨɥɟɡɧɢ.
ɇɚɲɢɦɢ ɢɫɫɥɟɞɨɜɚɧɢɹɦɢ ɩɨɤɚɡɚɧ ɜɨɡɦɨɠɧɵɣ ɛɢɨɥɨɝɢɱɟɫɤɢɣ ɪɢɫɤ ɪɚɡɜɢɬɢɹ ɢɧɮɟɤɰɢɨɧɧɨɝɨ
ɩɪɨɰɟɫɫɚ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɨɞ ɜɥɢɹɧɢɟɦ ɚɫɫɨɰɢɢɪɨɜɚɧɧɨɝɨ ɬɟɱɟɧɢɹ ɫ ɚɧɚɩɥɚɡɦɨɡɨɦ. Ɉɫɧɨɜɚɧɢɟɦ ɷɬɨɦɭ ɩɨɫɥɭɠɢɥɢ ɞɚɧɧɵɟ ɨ ɩɨɜɵɲɟɧɧɨɣ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ ɤɨɪɨɜ ɥɟɣɤɨɡɨɦ ɜ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɩɨ ɚɧɚɩɥɚɡɦɨɡɭ ɪɚɣɨɧɚɯ (RR = 2,8, Ɋ < 0,001) ɢ ɯɚɪɚɤɬɟɪɧɵɟ ɧɟɝɚɬɢɜɧɵɟ ɢɡɦɟɧɟɧɢɹ
ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɯ, ɰɢɬɨɝɟɧɟɬɢɱɟɫɤɢɯ ɢ ɢɦɦɭɧɨɥɨɝɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɭ ɠɢɜɨɬɧɵɯ ɩɪɢ ɥɟɣɤɨɡɟ
ɧɚ ɮɨɧɟ ɚɧɚɩɥɚɡɦɨɡɚ.
Ʉ ɛɢɨɥɨɝɢɱɟɫɤɢɦ ɮɚɤɬɨɪɚɦ, ɫɨɝɥɚɫɧɨ ɢɫɫɥɟɞɨɜɚɧɢɹɦ ɞɪɭɝɢɯ ɚɜɬɨɪɨɜ, ɩɨɫɜɹɳɟɧɧɵɦ ɩɚɬɨɝɟɧɟɬɢɱɟɫɤɨɦɭ ɜɥɢɹɧɢɸ ɫɨɩɭɬɫɬɜɭɸɳɢɯ ɛɨɥɟɡɧɟɣ ɧɚ ɬɟɱɟɧɢɟ ɥɟɣɤɨɡɚ, ɦɨɠɧɨ ɨɬɧɟɫɬɢ ɚɫɫɨɰɢɢɪɨɜɚɧɧɨɟ ɬɟɱɟɧɢɟ ɫ ɬɭɛɟɪɤɭɥɟɡɨɦ [12, 13], ɛɪɭɰɟɥɥɟɡɨɦ [14] ɢ ɜɢɪɭɫɧɨɣ ɞɢɚɪɟɟɣ – ɛɨɥɟɡɧɶɸ ɫɥɢɡɢɫɬɵɯ
[15]. ɉɟɪɟɱɢɫɥɟɧɧɵɟ ɢɧɮɟɤɰɢɢ ɜɵɡɵɜɚɸɬ ɢɦɦɭɧɨɞɟɩɪɟɫɫɢɜɧɨɟ ɫɨɫɬɨɹɧɢɟ ɭ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɜɢɪɭɫɨɦ ɥɟɣɤɨɡɚ ɠɢɜɨɬɧɵɯ.
ɇɚɥɢɱɢɟ ɫɨɩɭɬɫɬɜɭɸɳɢɯ ɢɧɮɟɤɰɢɨɧɧɵɯ ɢ ɢɧɜɚɡɢɨɧɧɵɯ ɛɨɥɟɡɧɟɣ ɭɱɢɬɵɜɚɸɬ ɩɪɢ ɩɪɨɜɟɞɟɧɢɢ
ɨɡɞɨɪɨɜɢɬɟɥɶɧɨ-ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɜɟɬɟɪɢɧɚɪɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ, ɥɚɛɨɪɚɬɨɪɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɥɟɣɤɨɡɚ (ɜɥɢɹɧɢɟ ɧɚ ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɶ ɢ ɫɩɟɰɢɮɢɱɧɨɫɬɶ ɬɟɫɬɨɜ) ɢ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɜ ɩɪɨɝɧɨɡɟ ɪɚɡɜɢɬɢɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɩɨɤɚɡɚɬɟɥɢ ɪɢɫɤɚ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɦɨɝɭɬ ɛɵɬɶ ɢɫɩɨɥɶɡɨɜɚɧɵ ɞɥɹ ɤɨɧɬɪɨɥɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ, ɜɤɥɸɱɚɸɳɟɝɨ ɦɨɧɢɬɨɪɢɧɝ ɟɝɨ ɩɪɨɹɜɥɟɧɢɹ
(ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɟ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɢ ɢ ɞɢɚɝɧɨɫɬɢɤɚ ɛɨɥɟɡɧɢ) ɢ ɭɩɪɚɜɥɟɧɢɟ ɩɪɨɰɟɫɫɨɦ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
240
ɒɢɲɤɨɜ ȼ.ɉ. Ʌɟɣɤɨɡɵ ɠɢɜɨɬɧɵɯ / ȼ.ɉ. ɒɢɲɤɨɜ // Ɉɧɤɨɥɨɝɢɹ. – 1977. – Ɍ. 9. – ɋ. 6–46.
ɇɚɯɦɚɧɫɨɧ ȼ.Ɇ. Ƚɟɧɟɬɢɱɟɫɤɢɣ ɚɫɩɟɤɬ ɥɟɣɤɨɡɨɜ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ / ȼ.Ɇ. ɇɚɯɦɚɧɫɨɧ, Ʌ.Ƚ. Ȼɭɪɛɚ,
ȿ.Ⱥ. Ⱦɭɧ. – Ɇ., 1975. – 92 ɫ.
Issacson J.A. Effects of long-term infection with bovine immunodeficiency virus and/or bovine leukemia
virus on antibody and lymphocyte proliferative responses in cattle / J.A. Issacson, K.P. Flaming, J.A. Roth //
Veter. Immunol. Immunopathol. – 1998. – Vol. 64, ʋ3. – P. 249–266.
ɋɦɢɪɧɨɜ ɉ.ɇ. ɗɤɨɥɨɝɢɱɟɫɤɢɟ ɩɪɨɛɥɟɦɵ ɜɟɬɟɪɢɧɚɪɧɨɣ ɦɟɞɢɰɢɧɵ ɋɢɛɢɪɢ ɢ ɍɪɚɥɚ ɧɚ ɪɭɛɟɠɟ ɜɟɤɨɜ /
ɉ.ɇ. ɋɦɢɪɧɨɜ, ɂ.Ɇ. Ⱦɨɧɧɢɤ // ɉɪɨɞɨɥɶɫɬɜɟɧɧɚɹ ɛɟɡɨɩɚɫɧɨɫɬɶ – XXI ɜɟɤ: ɷɤɨɥɨɝɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɟ ɚɫɩɟɤɬɵ: ɋɛ ɧɚɭɱ. ɬɪ. – ȿɤɚɬɟɪɢɧɛɭɪɝ: ɍɪȽɋɏȺ, 2000. – ɋ. 58–70.
Ɍɚɬɚɪɱɭɤ Ⱥ.Ɍ. ɗɮɮɟɤɬɢɜɧɨɫɬɶ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɩɪɨɬɢɜɨɥɟɣɤɨɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɜ ɫɥɨɠɧɵɯ ɷɤɨɥɨɝɢɱɟɫɤɢɯ ɭɫɥɨɜɢɹɯ ɍɪɚɥɚ / Ⱥ.Ɍ. Ɍɚɬɚɪɱɭɤ, ɂ.Ɇ. Ⱦɨɧɧɢɤ, ȼ.Ⱥ. Ʉɪɚɫɧɨɩɟɪɨɜ // ɉɪɨɛɥɟɦɵ ɚɞɚɩɬɚɰɢɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ: Ɇɚɬɟɪɢɚɥɵ ɧɚɭɱ.-ɩɪɚɤɬ. ɤɨɧɮ., ɩɨɫɜɹɳ. 65-ɥɟɬɢɸ ɂɪɤɭɬɫɤɨɣ ɇɂȼɋ (ɂɪɤɭɬɫɤ, 22–23 ɨɤɬɹɛɪɹ 1997 ɝ.). – ɂɪɤɭɬɫɤ, 1997. – ɋ. 34–36.
Ⱥɛɚɤɢɧ ɋ.ɋ. ɋɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟ ɩɪɨɮɢɥɚɤɬɢɤɢ ɢ ɦɟɪ ɛɨɪɶɛɵ ɫ ɥɟɣɤɨɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɯɨɡɹɣɫɬɜɚɯ ɋɬɚɜɪɨɩɨɥɶɫɤɨɝɨ ɤɪɚɹ: Ⱥɜɬɨɪɟɮ. ɞɢɫ. … ɤɚɧɞ. ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ / ɋ.ɋ. Ⱥɛɚɤɢɧ. – Ɇ., 2004. – 24 ɫ.
ɏɪɚɦɰɨɜ ȼ.ȼ. Ɏɚɤɬɨɪɵ, ɤɨɪɪɟɥɢɪɭɸɳɢɟ ɫɨ ɫɬɟɩɟɧɶɸ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ
ɫɤɨɬɚ, ɢ ɜɵɹɜɥɟɧɢɟ ɠɢɜɨɬɧɵɯ ɝɪɭɩɩɵ ɪɢɫɤɚ: Ⱦɢɫ. … ɤɚɧɞ. ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1987 /
ȼ.ȼ. ɏɪɚɦɰɨɜ. – 192 ɫ.
Ɇɚɤɚɪɨɜ ȼ.ȼ. ɗɩɢɡɨɨɬɨɥɨɝɢɱɟɫɤɢɟ ɚɧɚɥɢɬɢɱɟɫɤɢɟ ɦɟɬɨɞɵ ɢɡɭɱɟɧɢɹ ɨɫɧɨɜɧɨɣ ɩɚɬɨɥɨɝɢɢ ɩɪɨɞɭɤɬɢɜɧɵɯ ɠɢɜɨɬɧɵɯ / ȼ.ȼ. Ɇɚɤɚɪɨɜ, ȼ.ɇ. Ⱥɮɨɧɢɧ, Ⱥ.Ƚ. ɒɚɯɨɜ, Ⱥ.ɂ. Ⱥɧɭɮɪɢɟɜ // ȼɟɫɬɧɢɤ ɊȺɋɏɇ. – 2005. –
ʋ 1. – ɋ. 58–62.
Ɏɥɟɬɱɟɪ Ɋ. Ʉɥɢɧɢɱɟɫɤɚɹ ɷɩɢɞɟɦɢɨɥɨɝɢɹ. Ɉɫɧɨɜɵ ɞɨɤɚɡɚɬɟɥɶɧɨɣ ɦɟɞɢɰɢɧɵ / Ɋ. Ɏɥɟɬɱɟɪ, ɋ. Ɏɥɟɬɱɟɪ,
ɗ. ȼɚɝɧɟɪ / ɉɟɪ. ɫ ɚɧɝɥ. – Ɇ.: Ɇɟɞɢɚ ɋɮɟɪɚ, 1998. – 352 ɫ.
Ⱥɥɶɛɨɦ Ⱥ. ȼɜɟɞɟɧɢɟ ɜ ɫɨɜɪɟɦɟɧɧɭɸ ɷɩɢɞɟɦɢɨɥɨɝɢɸ / Ⱥ. Ⱥɥɶɛɨɦ, ɋ. ɇɨɪɟɥɥ / ɉɟɪ. ɫ ɚɧɝɥ. ɂ. Ȼɨɧɹ. –
Ɍɚɥɥɢɧɧ, 1996. – 122 ɫ.
ɋɦɢɪɧɨɜ ɘ.ɉ. Ɋɚɡɜɢɬɢɟ ɥɟɣɤɨɡɧɨɝɨ ɩɪɨɰɟɫɫɚ ɭ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ ɤɨɪɨɜ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɢɯ
ɜɨɡɪɚɫɬɚ / ɘ.ɉ. ɋɦɢɪɧɨɜ // ȼɟɬɟɪɢɧɚɪɢɹ. – 1999. – ʋ12. – ɋ. 15–17.
Ɇɚɝɟɪ ɋ.ɇ. ɏɚɪɚɤɬɟɪɢɫɬɢɤɚ ɢɦɦɭɧɧɨɝɨ ɨɬɜɟɬɚ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɢ ɨɜɟɰ, ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨ
ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ, M. bovis, M. stegmatis ɢ ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɯ Ȼɐɀ ɜ ɪɚɡɥɢɱɧɵɯ ɫɨɱɟɬɚɧɢɹɯ:
Ⱥɜɬɨɪɟɮ. ɞɢɫ. … ɤɚɧɞ. ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ / ɋ.ɇ. Ɇɚɝɟɪ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1992. – 23 ɫ.
ɋɦɢɪɧɨɜ ɉ.ɇ. Ⱦɢɧɚɦɢɤɚ ɢɦɦɭɧɧɨɝɨ ɨɬɜɟɬɚ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɢ ɚɫɫɨɰɢɢɪɨɜɚɧɧɨɣ ɥɟɣɤɨɡɧɨɬɭɛɟɪɤɭɥɟɡɧɨɣ ɢɧɮɟɤɰɢɢ / ɉ.ɇ. ɋɦɢɪɧɨɜ, Ⱥ.ɋ. Ⱦɨɧɱɟɧɤɨ, ɋ.ɇ. Ɇɚɝɟɪ ɢ ɞɪ. // ɗɩɢɡɨɨɬɢɱɟɫɤɢɣ ɢ ɢɧɮɟɤɰɢɨɧɧɵɣ ɩɪɨɰɟɫɫɵ: (Ɍɟɨɪɟɬɢɱɟɫɤɢɟ ɢ ɩɪɚɤɬɢɱɟɫɤɢɟ ɚɫɩɟɤɬɵ). – ɇɨɜɨɫɢɛɢɪɫɤ, 1992. – ɋ. 121–125.
Ɋɚɡɭɦɨɜɫɤɚɹ ȼ.ȼ. ɗɩɢɡɨɨɬɨɥɨɝɢɹ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ Ⱥɥɬɚɣɫɤɨɦ ɤɪɚɟ / ȼ.ȼ. Ɋɚɡɭɦɨɜɫɤɚɹ,
ȼ.Ⱥ. Ⱥɩɚɥɶɤɢɧ, Ɍ.ȼ. Ȼɨɤɨɜɚ, ɋ.ɂ. ɋɭɛɛɨɬɢɧ // Ⱥɫɫɨɰɢɚɬɢɜɧɵɟ ɢɧɮɟɤɰɢɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɢ ɧɨɜɵɟ ɩɨɞɯɨɞɵ ɤ ɢɯ ɥɢɤɜɢɞɚɰɢɢ ɢ ɩɪɨɮɢɥɚɤɬɢɤɟ (Ȼɚɪɧɚɭɥ, 30–31 ɢɸɥɹ 1997 ɝ.): Ɍɟɡ. ɞɨɤɥ. ɧɚɭɱ.
ɤɨɧɮ., ɩɨɫɜɹɳ. 50-ɥɟɬɢɸ Ⱥɥɬɚɣɫɤɨɣ ɇɂȼɋ. – Ȼɚɪɧɚɭɥ, 1997. – ɋ. 30–31.
Roberts D.H. Response of cattle persistently infected with bovine virus diarrhoea virus to bovine leukosis
virus / D.H. Roberts, M.H. Lucas, G. Wibberley, D. Westcott // Vet. Rec. – 1988. – ʋ3. – Ɋ. 293–296.
ɍȾɄ 333ɋ.619.616.982.2.636.22/28
ɗɄɈɇɈɆɂɑȿɋɄɈȿ ɁɇȺɑȿɇɂȿ ɌɍȻȿɊɄɍɅȿɁȺ ɄɊɍɉɇɈȽɈ
ɊɈȽȺɌɈȽɈ ɋɄɈɌȺ ȼ ɊɈɋɋɂɂ
ȾɈɇɑȿɇɄɈ Ⱥ.ɋ., ɋɆɈɅəɇɂɇɈȼ ɘ.ɂ., ȾɈɇɑȿɇɄɈ ɇ.Ⱥ.,
ɎȽȻɍ «ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ», ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɣɫɤɚɹ Ɏɟɞɟɪɚɰɢɹ,
http:/sorashn.ru
ɉɨ ɨɛɴɟɦɚɦ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɭɪɨɧɚ, ɤɨɬɨɪɵɣ ɜ ɞɟɫɹɬɤɢ ɪɚɡ ɦɨɠɟɬ ɩɪɟɜɵɫɢɬɶ ɭɳɟɪɛ ɨɬ ɫɬɢɯɢɣɧɵɯ ɛɟɞɫɬɜɢɣ (ɡɟɦɥɹɬɪɟɫɟɧɢɹ, ɧɚɜɨɞɧɟɧɢɹ, ɭɪɚɝɚɧɵ ɢ ɬ. ɞ.) ɢ ɤɚɬɚɫɬɪɨɮ ɬɟɯɧɨɝɟɧɧɨɝɨ ɯɚɪɚɤɬɟɪɚ,
ɨɬɞɟɥɶɧɵɟ ɢɧɮɟɤɰɢɨɧɧɵɟ ɡɚɛɨɥɟɜɚɧɢɹ ɫɥɟɞɭɟɬ ɨɬɧɨɫɢɬɶ ɤ ɛɢɨɥɨɝɢɱɟɫɤɢɦ ɤɚɬɚɫɬɪɨɮɚɦ ɝɥɨɛɚɥɶɧɨɝɨ ɦɚɫɲɬɚɛɚ. ɋ ɩɨɥɧɵɦ ɨɫɧɨɜɚɧɢɟɦ ɤ ɬɚɤɨɣ ɤɚɬɚɫɬɪɨɮɟ, ɩɪɢɱɟɦ ɩɪɨɹɜɥɹɸɳɟɣɫɹ ɜɨ ɜɪɟɦɟɧɢ
ɩɨɜɫɟɦɟɫɬɧɨ ɢ ɞɥɢɬɟɥɶɧɨ, ɦɨɠɧɨ ɨɬɧɟɫɬɢ ɢ ɬɭɛɟɪɤɭɥɟɡ, – ɤɚɤ ɠɢɜɨɬɧɵɯ, ɬɚɤ ɢ ɱɟɥɨɜɟɤɚ.
ɂɫɩɨɥɶɡɭɹ ɩɨɤɚɡɚɬɟɥɢ ɞɢɧɚɦɢɤɢ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ (ɞɚɧɧɵɟ ɞɟɩɚɪɬɚɦɟɧɬɚ ɜɟɬɟɪɢɧɚɪɢɢ
Ɇɢɧɢɫɬɟɪɫɬɜɚ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɢ ɩɪɨɞɨɜɨɥɶɫɬɜɢɹ ɊɎ), ɫ ɭɱɟɬɨɦ ɪɚɡɪɚɛɨɬɚɧɧɵɯ ɤɨɷɮɮɢɰɢɟɧɬɨɜ ɪɚɫɫɱɢɬɚɥɢ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ, ɩɪɢɱɢɧɹɟɦɵɣ ɬɭɛɟɪɤɭɥɟɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ
Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ ɡɚ 1961–2003 ɝɨɞɵ, ɬɨ ɟɫɬɶ ɡɚ 43 ɝɨɞɚ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɫɭɦɦɵ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɭɳɟɪɛɚ ɜ ɨɬɞɟɥɶɧɵɟ ɝɨɞɵ ɩɪɹɦɨ
ɩɪɨɩɨɪɰɢɨɧɚɥɶɧɨ ɡɚɜɢɫɟɥɢ ɨɬ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ, ɜ ɱɚɫɬɧɨɫɬɢ ɨɬ ɤɨɥɢɱɟɫɬɜɚ ɜɵɹɜɥɟɧɧɨɝɨ
ɛɨɥɶɧɨɝɨ ɬɭɛɟɪɤɭɥɟɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. ɇɚɢɛɨɥɶɲɢɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ ɨɬ ɬɭɛɟɪɤɭɥɟɡɚ ɜ ɫɬɪɚɧɟ ɧɚɛɥɸɞɚɥɫɹ ɜ 1963–1989 ɝɨɞɵ ɫ ɤɨɥɟɛɚɧɢɹɦɢ ɨɬ 1,5 ɞɨ 3,5 ɦɥɪɞ ɪɭɛɥɟɣ ɜ ɨɬɞɟɥɶɧɵɟ
ɝɨɞɵ.
ɋ 1990 ɝɨɞɚ ɩɪɨɫɥɟɠɢɜɚɟɬɫɹ ɭɫɬɨɣɱɢɜɚɹ ɪɚɜɧɨɦɟɪɧɚɹ ɬɟɧɞɟɧɰɢɹ ɫɧɢɠɟɧɢɹ ɨɛɴɟɦɨɜ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɭɳɟɪɛɚ, ɤɨɬɨɪɵɣ ɫɨɫɬɚɜɢɥ ɜ 2002 ɝɨɞɭ 99, 2 ɦɥɧ ɪɭɛɥɟɣ. Ɉɞɧɚɤɨ ɫ 2003 ɝɨɞɚ ɷɩɢɡɨɨɬɢɱɟɫɤɚɹ ɨɛɫɬɚɧɨɜɤɚ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɫɬɚɥɚ ɨɫɥɨɠɧɹɬɶɫɹ, ɭɜɟɥɢɱɢɥɨɫɶ ɤɨɥɢɱɟɫɬɜɨ ɡɚɛɨɥɟɜɲɢɯ ɠɢɜɨɬɧɵɯ, ɱɬɨ ɩɪɟɞɨɩɪɟɞɟɥɢɥɨ ɢ ɧɚɦɟɬɢɜɲɭɸɫɹ ɬɟɧɞɟɧɰɢɸ ɤ ɭɜɟɥɢɱɟɧɢɸ ɪɚɡɦɟɪɨɜ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ
ɭɳɟɪɛɚ.
Ɂɚ ɜɟɫɶ ɩɟɪɢɨɞ ɚɧɚɥɢɡɚ (43 ɝɨɞɚ) ɫɭɦɦɚɪɧɵɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ, ɩɪɢɱɢɧɟɧɧɵɣ ɬɭɛɟɪɤɭɥɟɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɷɤɨɧɨɦɢɤɟ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ Ɋɨɫɫɢɢ, ɩɪɟɜɵɫɢɥ 84,9 ɦɥɪɞ ɪɭɛɥɟɣ.
ȼ ɪɚɡɪɟɡɟ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɬɟɪɪɢɬɨɪɢɣ ɊɎ, ɢɫɯɨɞɹ ɢɡ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɢ ɫ ɭɱɟɬɨɦ ɟɟ ɞɢɧɚɦɢɤɢ, ɧɚɢɛɨɥɶɲɢɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ, ɩɪɢɱɢɧɟɧɧɵɣ ɬɭɛɟɪɤɭɥɟɡɨɦ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɧɚɛɥɸɞɚɥɫɹ ɜ ɉɨɜɨɥɠɫɤɨɦ (7,9 ɦɥɪɞ ɪɭɛ.), ɋɟɜɟɪɨ-Ʉɚɜɤɚɡɫɤɨɦ (6,7 ɦɥɪɞ
ɪɭɛ.) ɢ Ɂɚɩɚɞɧɨ-ɋɢɛɢɪɫɤɨɦ (3,7 ɦɥɪɞ ɪɭɛ.) ɷɤɨɧɨɦɢɱɟɫɤɨɦ ɪɚɣɨɧɚɯ ɫɬɪɚɧɵ.
ɇɚ ɷɬɢ ɬɪɢ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɪɚɣɨɧɚ (ɢɡ 11 ɩɨ Ɋɨɫɫɢɢ) ɩɪɢɯɨɞɢɬɫɹ ɛɨɥɟɟ 75 % ɜɫɟɝɨ ɨɛɴɟɦɚ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɭɳɟɪɛɚ, ɩɪɢɱɢɧɟɧɧɨɝɨ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ ɡɚ ɜɡɹɬɵɣ ɞɥɹ ɚɧɚɥɢɡɚ ɩɟɪɢɨɞ.
ȼ ɉɨɜɨɥɠɫɤɨɦ ɷɤɨɧɨɦɢɱɟɫɤɨɦ ɪɚɣɨɧɟ ɫɚɦɵɦɢ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɦɢ ɡɚ ɩɟɪɢɨɞ ɚɧɚɥɢɡɚ ɤɚɤ ɩɨ
ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ, ɬɚɤ ɢ ɤɨɥɢɱɟɫɬɜɭ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵɯ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɩɭɧɤɬɨɜ ɹɜɥɹɸɬɫɹ ɋɚɪɚɬɨɜɫɤɚɹ
ɢ ȼɨɥɝɨɝɪɚɞɫɤɚɹ ɨɛɥɚɫɬɢ, ɫɭɦɦɚ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɭɳɟɪɛɚ ɜ ɤɨɬɨɪɵɯ ɫɨɫɬɚɜɢɥɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 1,4
ɢ 3,1 ɦɥɪɞ ɪɭɛɥɟɣ; ɋɟɜɟɪɨɤɚɜɤɚɡɫɤɨɦ – Ɋɨɫɬɨɜɫɤɚɹ ɨɛɥɚɫɬɶ (2,8 ɦɥɪɞ ɪɭɛɥɟɣ), ɋɬɚɜɪɨɩɨɥɶɫɤɢɣ
(1,3 ɦɥɪɞ ɪɭɛɥɟɣ) ɢ Ʉɪɚɫɧɨɞɚɪɫɤɢɣ (1,1 ɦɥɪɞ ɪɭɛɥɟɣ) ɤɪɚɹ; Ɂɚɩɚɞɧɨ-ɋɢɛɢɪɫɤɨɦ – Ɉɦɫɤɚɹ (1,4 ɦɥɪɞ
ɪɭɛɥɟɣ), ɇɨɜɨɫɢɛɢɪɫɤɚɹ (1,3 ɦɥɪɞ ɪɭɛɥɟɣ) ɢ Ɍɸɦɟɧɫɤɚɹ (847,7 ɦɥɧ ɪɭɛɥɟɣ) ɨɛɥɚɫɬɢ.
ɇɚɢɛɨɥɟɟ ɛɥɚɝɨɩɪɢɹɬɧɚɹ ɷɩɢɡɨɨɬɢɱɟɫɤɚɹ ɫɢɬɭɚɰɢɹ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɟɞɨɩɪɟɞɟɥɢɥɚ ɢ ɧɚɢɦɟɧɶɲɢɟ ɷɤɨɧɨɦɢɱɟɫɤɢɟ ɩɨɬɟɪɢ ɜ ɋɟɜɟɪɨ-Ɂɚɩɚɞɧɨɦ ɢ ɋɟɜɟɪɧɨɦ ɷɤɨɧɨɦɢɱɟɫɤɢɯ
ɪɟɝɢɨɧɚɯ ɫɬɪɚɧɵ. Ⱦɨɥɹ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɭɳɟɪɛɚ ɜ ɭɤɚɡɚɧɧɵɯ ɪɚɣɨɧɚɯ ɜ ɨɛɳɟɦ ɩɨɤɚɡɚɬɟɥɟ ɩɨ ɊɎ
ɫɨɫɬɚɜɢɥɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 0,01 ɢ 0,07 %.
Ɋɟɡɭɥɶɬɚɬɵ ɪɚɫɱɟɬɚ ɨɛɴɟɦɨɜ ɩɨɬɟɪɶ ɩɪɨɞɭɤɰɢɢ (ɦɨɥɨɤɨ, ɦɹɫɨ, ɩɪɢɩɥɨɞ) ɜ ɧɚɬɭɪɚɥɶɧɨɦ ɜɵɪɚɠɟɧɢɢ, ɨɛɭɫɥɨɜɥɟɧɧɵɯ ɡɚɛɨɥɟɜɚɧɢɟɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɬɭɛɟɪɤɭɥɟɡɨɦ ɜ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ
ɡɚ ɩɟɪɢɨɞ ɫ 1961 ɩɨ 2003 ɝɨɞ, ɩɨɪɚɠɚɸɬ ɜɨɨɛɪɚɠɟɧɢɟ. Ɂɚ ɷɬɨ ɜɪɟɦɹ ɷɤɨɧɨɦɢɤɚ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
Ɋɨɫɫɢɢ ɩɨɬɟɪɹɥɚ ɧɟ ɦɟɧɟɟ 15 ɦɥɧ 265,5 ɬɨɧɧ ɦɨɥɨɤɚ, 1 ɦɥɧ 616,4 ɬɨɧɧ ɦɹɫɚ ɢ 3 ɦɥɧ 522,9 ɬɵɫ.
ɝɨɥɨɜ ɩɪɢɩɥɨɞɚ.
Ⱦɥɹ ɨɛɪɚɡɧɨɝɨ ɜɨɫɩɪɢɹɬɢɹ ɬɚɤɢɯ ɨɛɴɟɦɨɜ ɩɨɬɟɪɶ ɩɪɨɞɭɤɰɢɢ ɩɪɢɜɟɞɟɦ ɪɹɞ ɚɥɥɟɝɨɪɢɣ. Ɍɚɤ, ɩɨ
ɫɭɳɟɫɬɜɭɸɳɢɦ ɧɚ ɫɟɝɨɞɧɹ ɧɨɪɦɚɦ ɩɢɬɚɧɢɹ ɜ ɫɬɪɚɧɟ, ɬɨɝɨ ɤɨɥɢɱɟɫɬɜɚ ɦɨɥɨɤɚ, ɤɨɬɨɪɨɟ ɩɨɬɟɪɹɥɚ
Ɋɨɫɫɢɹ ɡɚ ɚɧɚɥɢɡɢɪɭɟɦɵɣ ɩɟɪɢɨɞ, ɯɜɚɬɢɥɨ ɛɵ, ɱɬɨɛɵ ɩɪɨɤɨɪɦɢɬɶ ɜ ɬɟɱɟɧɢɟ ɨɞɧɨɝɨ ɝɨɞɚ ɜɫɟɦɢ
ɜɢɞɚɦɢ ɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɬɨɜ 38,2 ɦɥɧ ɱɟɥɨɜɟɤ; ɦɹɫɚ (ɢ ɞɪɭɝɢɟ ɦɹɫɧɵɟ ɩɪɨɞɭɤɬɵ) – 20,7 ɦɥɧ ɱɟɥɨɜɟɤ. ɂɧɵɦɢ ɫɥɨɜɚɦɢ, ɧɚɫɟɥɟɧɢɟ ɦɢɥɥɢɨɧɧɨɝɨ ɝɨɪɨɞɚ ɦɨɝɥɨ ɛɵ ɭɩɨɬɪɟɛɥɹɬɶ ɷɬɢ ɜɢɞɵ ɩɪɨɞɭɤɬɨɜ
ɩɢɬɚɧɢɹ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɜ ɬɟɱɟɧɢɟ 38-ɦɢ ɢ 20-ɬɢ ɫ ɥɢɲɧɢɦ ɥɟɬ.
Ʉɪɨɦɟ ɬɨɝɨ, ɩɨ ɩɪɢɱɢɧɟ ɬɭɛɟɪɤɭɥɟɡɚ ɡɚ 1961–2003 ɝɨɞɵ Ɋɨɫɫɢɹ ɩɨɬɟɪɹɥɚ ɧɟ ɦɟɧɟɟ 3 ɦɥɧ
522,9 ɬɵɫ. ɝɨɥɨɜ ɩɪɢɩɥɨɞɚ (ɬɟɥɹɬɚ).
Ɍɨɥɶɤɨ ɡɚ ɩɟɪɢɨɞ ɫ 1987 ɩɨ 2003 ɝɨɞɵ (17 ɥɟɬ) ɧɚ ɦɹɫɨɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɩɪɟɞɩɪɢɹɬɢɹɯ Ɋɨɫɫɢɢ
ɩɨ ɩɪɢɱɢɧɟ ɬɭɛɟɪɤɭɥɟɡɚ ɩɨɞɜɟɪɝɧɭɬɨ ɫɚɧɢɬɚɪɧɨɣ ɩɟɪɟɪɚɛɨɬɤɟ ɢ ɭɬɢɥɢɡɢɪɨɜɚɧɨ ɫɜɵɲɟ 726 ɬɵɫ.
ɝɨɥɨɜ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɪɚɡɥɢɱɧɵɯ ɩɨɥɨɜɨɡɪɚɫɬɧɵɯ ɝɪɭɩɩ ɉɪɢ ɷɬɨɦ ɨɛɳɢɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ
241
ɭɳɟɪɛ ɨɬ ɷɬɢɯ ɜɢɞɨɜ ɩɨɬɟɪɶ ɜɵɪɚɡɢɥɫɹ ɜ ɫɭɦɦɟ 252,6 ɦɥɧ ɪɭɛɥɟɣ, ɜ ɬɨɦ ɱɢɫɥɟ 231,7 ɦɥɧ ɪɭɛɥɟɣ ɨɬ
ɫɧɢɠɟɧɢɹ ɤɚɱɟɫɬɜɚ ɦɹɫɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɩɪɨɲɟɞɲɟɣ ɝɥɭɛɨɤɭɸ ɬɟɦɩɟɪɚɬɭɪɧɭɸ ɨɛɪɚɛɨɬɤɭ, ɢ 20,9 ɦɥɧ
ɪɭɛɥɟɣ ɜɫɥɟɞɫɬɜɢɟ ɬɟɯɧɢɱɟɫɤɨɣ ɭɬɢɥɢɡɚɰɢɢ ɬɭɲ ɫ ɝɟɧɟɪɚɥɢɡɨɜɚɧɧɵɦɢ ɮɨɪɦɚɦɢ ɩɨɪɚɠɟɧɢɣ.
Ʉɪɨɦɟ ɨɝɪɨɦɧɵɯ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɩɨɬɟɪɶ ɜ ɢɯ ɜɢɞɨɜɨɦ ɦɧɨɝɨɨɛɪɚɡɢɢ, ɩɪɢɱɢɧɹɟɦɵɯ ɬɭɛɟɪɤɭɥɟɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɜɟɥɢɤɢ ɦɚɬɟɪɢɚɥɶɧɵɟ ɢ ɬɪɭɞɨɜɵɟ ɡɚɬɪɚɬɵ ɧɚ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɟ ɢ
ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɟ ɦɟɪɨɩɪɢɹɬɢɹ.
ɉɨ ɩɪɨɜɢɡɨɪɧɵɦ ɪɚɫɱɟɬɚɦ, ɫ ɭɱɟɬɨɦ ɪɚɡɪɚɛɨɬɚɧɧɵɯ ɤɨɷɮɮɢɰɢɟɧɬɨɜ, ɨɛɳɢɟ ɡɚɬɪɚɬɵ ɧɚ ɩɪɨɬɢɜɨɷɩɢɡɨɨɬɢɱɟɫɤɢɟ ɦɟɪɨɩɪɢɹɬɢɹ ɩɪɢ ɬɭɛɟɪɤɭɥɟɡɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɊɎ ɡɚ 1961–2003 ɝɨɞɵ
ɫɨɫɬɚɜɢɥɢ ɧɟ ɦɟɧɟɟ 27,4 ɦɥɪɞ ɪɭɛɥɟɣ.
ɉɪɢ ɷɬɨɦ ɬɨɥɶɤɨ ɧɚ ɚɥɥɟɪɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨɝɨɥɨɜɶɹ (ɬɭɛɟɪɤɭɥɢɧɢɡɚɰɢɢ) ɢɡɪɚɫɯɨɞɨɜɚɧɨ
691,8 ɦɥɧ ɪɭɛɥɟɣ. ɇɚɢɛɨɥɶɲɢɯ ɜɥɨɠɟɧɢɣ ɜ ɨɛɳɟɣ ɫɭɦɦɟ ɪɚɫɯɨɞɨɜ ɩɨɬɪɟɛɨɜɚɥɢ ɫɚɧɚɰɢɹ ɜɧɟɲɧɟɣ
ɫɪɟɞɵ (ɫɚɧɢɬɚɪɧɵɣ ɪɟɦɨɧɬ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɩɨɦɟɳɟɧɢɣ) ɢ ɨɛɟɡɜɪɟɠɢɜɚɧɢɟ ɩɪɨɞɭɤɰɢɢ (ɩɚɫɬɟɪɢɡɚɰɢɹ ɦɨɥɨɤɚ).
ɗɤɨɧɨɦɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɪɨɬɢɜɨɬɭɛɟɪɤɭɥɟɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɟ ɦɧɨɝɢɯ
ɫɬɪɚɧ ɦɢɪɚ, ɩɨ ɞɚɧɧɵɦ ɧɚɭɱɧɨɣ ɥɢɬɟɪɚɬɭɪɵ, ɛɥɚɝɨɞɚɪɹ ɭɥɭɱɲɟɧɢɸ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ, ɚ
ɬɚɤɠɟ ɞɨɫɬɢɠɟɧɢɹɦ ɜɟɬɟɪɢɧɚɪɧɨɣ ɧɚɭɤɢ ɢ ɩɪɚɤɬɢɤɢ, ɧɟɭɤɥɨɧɧɨ ɩɨɜɵɲɚɟɬɫɹ.
Ȼɨɥɶɲɢɧɫɬɜɨ ɜɵɫɨɤɨɪɚɡɜɢɬɵɯ ɝɨɫɭɞɚɪɫɬɜ ɭɛɟɞɢɥɢɫɶ ɜ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɢ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɜɵɝɨɞɚɯ ɩɥɚɧɨɜɵɯ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɯ ɩɪɨɝɪɚɦɦ ɩɨ ɩɪɨɮɢɥɚɤɬɢɤɟ ɢ ɥɢɤɜɢɞɚɰɢɢ ɬɭɛɟɪɤɭɥɟɡɚ ɠɢɜɨɬɧɵɯ,
ɜ ɱɚɫɬɧɨɫɬɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɷɤɨɧɨɦɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɩɪɢ ɬɭɛɟɪɤɭɥɟɡɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɦɚɫɲɬɚɛɟ ɫɬɪɚɧɵ ɩɪɨɹɜɥɹɥɚɫɶ ɧɟ ɜɨ ɜɫɟ
ɩɟɪɢɨɞɵ ɚɧɚɥɢɡɚ.
Ɍɚɤ, ɢɫɯɨɞɹ ɢɡ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ, ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɷɮɮɟɤɬ ɧɟ ɩɪɨɹɜɥɹɥɫɹ ɜ ɩɟɪɢɨɞɵ
1963–1965, ɚ ɬɚɤɠɟ 1967–1989 ɝɨɞɨɜ. ȼ ɷɬɢ ɩɟɪɢɨɞɵ ɜ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɢɹ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ
ɦɟɪɨɩɪɢɹɬɢɣ ɧɟ ɭɞɚɥɨɫɶ ɞɨɛɢɬɶɫɹ ɫɭɳɟɫɬɜɟɧɧɨɝɨ ɭɥɭɱɲɟɧɢɹ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ ɜ ɰɟɥɨɦ
ɩɨ ɊɎ, ɜ ɱɚɫɬɧɨɫɬɢ ɫɧɢɠɟɧɢɹ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ, ɱɬɨ ɢ ɩɪɟɞɨɩɪɟɞɟɥɢɥɨ ɷɤɨɧɨɦɢɱɟɫɤɭɸ ɧɟɷɮɮɟɤɬɢɜɧɨɫɬɶ ɦɟɪɨɩɪɢɹɬɢɣ.
ɋɬɚɛɢɥɶɧɨ ɢ ɪɚɜɧɨɦɟɪɧɨ (ɡɚ ɢɫɤɥɸɱɟɧɢɟɦ 1992 ɝɨɞɚ) ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ, ɜ ɫɜɹɡɢ ɫ ɭɥɭɱɲɟɧɢɟɦ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɢ, ɫɬɚɥɚ ɩɨɜɵɲɚɬɶɫɹ ɫ 1990 ɝɨɞɚ ɢ ɞɨɫɬɢɝɥɚ ɩɨ ɩɨɤɚɡɚɬɟɥɸ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɷɮɮɟɤɬɚ ɜ ɪɚɫɱɟɬɟ ɧɚ ɨɞɢɧ ɪɭɛɥɶ ɡɚɬɪɚɬ ɤ 1999–2003 ɝɨɞɚɦ ɡɧɚɱɟɧɢɹ 17–69 ɪɭɛ. ɉɪɨɬɢɜɨɷɩɢɡɨɨɬɢɱɟɫɤɚɹ ɢ ɷɤɨɧɨɦɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɪɨɬɢɜɨɬɭɛɟɪɤɭɥɟɡɧɵɯ
ɦɟɪɨɩɪɢɹɬɢɣ ɜ ɷɬɨɬ ɩɟɪɢɨɞ ɩɪɢɛɥɢɡɢɥɚɫɶ ɤ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɨɣ.
ȼ ɰɟɥɨɦ ɡɚ ɩɟɪɢɨɞ ɫ 1961 ɩɨ 2004 ɝɨɞɵ ɜ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɢɹ ɩɥɚɧɨɜɵɯ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ
ɦɟɪɨɩɪɢɹɬɢɣ ɩɪɢ ɬɭɛɟɪɤɭɥɟɡɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɊɎ ɫɭɦɦɚɪɧɵɣ ɩɪɟɞɨɬɜɪɚɳɟɧɧɵɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ ɜɵɪɚɡɢɥɫɹ ɜ ɫɭɦɦɟ 21 ɦɥɪɞ 544,4 ɬɵɫ. ɪɭɛɥɟɣ, ɷɤɨɧɨɦɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ – 17
ɦɥɪɞ 723,4 ɬɵɫ. ɪɭɛɥɟɣ.
ɉɪɢ ɷɬɨɦ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɷɮɮɟɤɬ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɡɚ ɜɟɫɶ ɩɟɪɢɨɞ ɜ ɫɪɟɞɧɟɦ ɛɵɥ
ɫɪɚɜɧɢɬɟɥɶɧɨ ɧɟɜɵɫɨɤɢɦ ɢ ɫɨɫɬɚɜɢɥ 1,3 ɪɭɛ. ɜ ɪɚɫɱɟɬɟ ɧɚ ɨɞɢɧ ɪɭɛɥɶ ɡɚɬɪɚɬ, ɱɬɨ ɨɛɴɹɫɧɹɟɬɫɹ ɨɬɫɭɬɫɬɜɢɟɦ ɷɮɮɟɤɬɚ ɜ ɩɟɪɢɨɞ ɞɨ 1991 ɝɨɞɚ.
ɋ 1990 ɝɨɞɚ ɷɩɢɡɨɨɬɢɱɟɫɤɚɹ ɨɛɫɬɚɧɨɜɤɚ ɩɨ ɬɭɛɟɪɤɭɥɟɡɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɫɬɪɚɧɟ ɫɬɚɥɚ
ɫɬɚɛɢɥɶɧɨ ɭɥɭɱɲɚɬɶɫɹ ɢ, ɫ ɧɚɪɚɫɬɚɸɳɢɦ ɢɬɨɝɨɦ, ɫɬɚɥɢ ɩɨɜɵɲɚɬɶɫɹ ɜɫɟ ɩɨɤɚɡɚɬɟɥɢ ɷɤɨɧɨɦɢɱɟɫɤɨɣ
ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɤɨɦɩɥɟɤɫɧɵɯ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ.
Ʉɪɨɦɟ ɬɨɝɨ, ɜ ɪɟɡɭɥɶɬɚɬɟ ɨɫɭɳɟɫɬɜɥɟɧɢɹ ɤɨɦɩɥɟɤɫɚ ɩɪɨɬɢɜɨɬɭɛɟɪɤɭɥɟɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɡɚ ɩɟɪɢɨɞ ɚɧɚɥɢɡɚ ɩɪɟɞɭɩɪɟɠɞɟɧɵ ɷɤɨɧɨɦɢɱɟɫɤɢɟ ɩɨɬɟɪɢ 3 ɦɥɧ 752 ɬɵɫ. ɬɨɧɧ ɦɨɥɨɤɚ ɫɬɨɢɦɨɫɬɶɸ ɫɜɵɲɟ 23,3 ɦɥɪɞ ɪɭɛ., 43,2 ɬɵɫ. ɬɨɧɧ ɦɹɫɚ ɝɨɜɹɞɢɧɵ ɧɚ ɫɭɦɦɭ 2,9 ɦɥɪɞ ɪɭɛ.ɢ 1,4 ɦɥɧ ɝɨɥɨɜ ɩɪɢɩɥɨɞɚ
(1,4 ɦɥɪɞ ɪɭɛ.).
ɍȾɄ: 638.08.124.123.132.2.15
ɆȿɌɈȾɕ ɉɊɈɎɂɅȺɄɌɂɄɂ ɂ Ʌȿɑȿɇɂə ɉɑȿɅ
ɋ ɂɋɉɈɅɖɁɈȼȺɇɂȿɆ ɗɏȺ ɊȺɋɌȼɈɊȺ «ȺɇɈɅɂɌ»
ȿȽɈɊɈȼȺ ɋ.ɇ.,
ɌɈɈ «ȼɨɫɬɨɱɧɨ-Ʉɚɡɚɯɫɬɚɧɫɤɢɣ ɧɚɭɱɧɨ- ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɫɟɥɶɫɤɨɝɨ
ɯɨɡɹɣɫɬɜɚ», ɝ. ɍɫɬɶ-Ʉɚɦɟɧɨɝɨɪɫɤ, Ʉɚɡɚɯɫɬɚɧ, appi_vko@mail.ru
Ⱥɧɧɨɬɚɰɢɹ. ȼ ɞɚɧɧɨɣ ɫɬɚɬɶɟ ɩɪɢɜɟɞɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɷɥɟɤɬɪɨɯɢɦɢɱɟɫɤɢ ɚɤɬɢɜɢɪɨɜɚɧɧɵɯ ɜɨɞɧɵɯ ɪɚɫɬɜɨɪɨɜ ɞɥɹ ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɦɟɬɨɞɨɜ ɥɟɱɟɧɢɹ ɢ ɩɪɨɮɢɥɚɤɬɢɤɢ ɡɚɛɨɥɟɜɚɧɢɣ ɩɱɟɥ.
242
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: Ⱥɧɨɥɢɬ, ɤɚɬɨɥɢɬ, ɩɨɞɤɨɪɦɤɚ, ɨɪɨɲɟɧɢɟ, ɡɚɥɢɜɚɧɢɟ ɜ ɭɥɨɱɤɢ, ɫɬɷɥ, ɗɏȺ ɪɚɫɬɜɨɪɵ.
ɋɢɬɭɚɰɢɹ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɩɨ ɩɨɥɭɱɟɧɢɸ ɷɤɨɥɨɝɢɱɟɫɤɢ ɱɢɫɬɨɝɨ ɦɟɞɚ ɢɡ-ɡɚ ɩɪɢɦɟɧɟɧɢɹ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɩɪɟɩɚɪɚɬɨɜ ɯɢɦɢɱɟɫɤɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ, ɤɚɱɟɫɬɜɨ ɩɨɥɭɱɚɟɦɨɝɨ ɦɟɞɚ, ɜ ɤɨɬɨɪɨɦ ɨɫɬɚɸɬɫɹ
ɨɫɬɚɬɨɱɧɵɟ ɥɟɤɚɪɫɬɜɟɧɧɵɟ ɜɟɳɟɫɬɜɚ, ɹɜɥɹɸɳɢɟɫɹ ɜɪɟɞɧɵɦɢ ɞɥɹ ɡɞɨɪɨɜɶɹ ɧɚɫɟɥɟɧɢɹ ɢ ɨɫɬɚɜɥɹɟɬ
ɠɟɥɚɬɶ ɥɭɱɲɟɝɨ. ɉɨ ɛɨɥɟɡɧɹɦ ɩɱɟɥ ɫɢɬɭɚɰɢɹ ɨɫɬɚɺɬɫɹ ɬɚɤ ɠɟ ɫɥɨɠɧɨɣ, ɱɬɨ ɬɪɟɛɭɟɬ ɢɡɵɫɤɚɧɢɹ ɧɨɜɵɯ ɢ ɞɚɥɶɧɟɣɲɟɝɨ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɭɠɟ ɫɭɳɟɫɬɜɭɸɳɢɯ ɫɪɟɞɫɬɜ ɢ ɦɟɬɨɞɨɜ ɞɢɚɝɧɨɫɬɢɤɢ, ɩɪɨɮɢɥɚɤɬɢɤɢ ɢ ɥɟɱɟɧɢɹ ɛɨɥɟɡɧɟɣ ɩɱɟɥ.
ɍɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟ ɦɟɬɨɞɨɜ ɥɟɱɟɧɢɹ ɢ ɩɪɨɮɢɥɚɤɬɢɤɢ ɪɚɡɥɢɱɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɷɥɟɤɬɪɨɯɢɦɢɱɟɫɤɢ ɚɤɬɢɜɢɪɨɜɚɧɧɵɯ ɜɨɞɧɵɯ ɪɚɫɬɜɨɪɨɜ ɜ ɩɪɨɢɡɜɨɞɫɬɜɟ ɤɨɦɩɨɡɢɰɢɨɧɧɵɯ ɩɪɟɩɚɪɚɬɨɜ ɨɬɧɨɫɢɬɫɹ ɤ ɧɨɜɢɡɧɟ ɢɫɫɥɟɞɨɜɚɧɢɣ.
ȼ ɷɬɨɣ ɫɜɹɡɢ ɧɟɨɛɯɨɞɢɦɨ ɩɪɨɜɨɞɢɬɶ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɟ ɪɚɛɨɬɵ ɩɨ ɢɡɵɫɤɚɧɢɸ ɧɨɜɵɯ
ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɢ ɬɟɪɚɩɟɜɬɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɢ ɦɟɬɨɞɨɜ ɛɨɪɶɛɵ, ɩɪɢɦɟɧɹɟɦɵɯ ɩɪɢ ɡɚɛɨɥɟɜɚɧɢɹɯ
ɩɱɟɥ
ȼ 2012 ɝɨɞɭ ɜ ɇɂɂ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɛɵɥɨ ɧɚɱɚɬɨ, ɚ ɜ ɩɨɫɥɟɞɭɸɳɢɟ ɞɜɚ ɝɨɞɚ, ɩɪɨɞɨɥɠɟɧɨ
ɢɡɭɱɟɧɢɟ ɩɪɟɩɚɪɚɬɨɜ: ɷɥɟɤɬɪɨɯɢɦɢɱɟɫɤɢ ɚɤɬɢɜɢɪɨɜɚɧɧɨɝɨ ɪɚɫɬɜɨɪɚ ɧɚɬɪɢɹ ɯɥɨɪɢɞɚ – «Ⱥɧɨɥɢɬ» ɢ
ɨɫɧɨɜɚɧɧɨɝɨ ɧɚ ɚɧɨɥɢɬɟ, ɤɚɬɨɥɢɬɟ ɢ ɪɚɫɬɢɬɟɥɶɧɨɦ ɫɵɪɶɟ – «Ɏɢɬɨɥɢɬ».
Ⱦɥɹ ɩɪɨɜɟɪɤɢ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɪɟɩɚɪɚɬɨɜ ɧɚ ɢɧɮɟɤɰɢɨɧɧɵɟ ɢ ɢɧɜɚɡɢɨɧɧɵɟ ɡɚɛɨɥɟɜɚɧɢɹ ɛɵɥɢ
ɩɪɨɜɟɞɟɧɵ ɢɫɩɵɬɚɧɢɹ ɦɟɬɨɞɨɦ ɩɨɞɤɨɪɦɤɢ, ɡɚɥɢɜɚɧɢɟɦ ɜ ɭɥɨɱɤɢ ɢ ɨɪɨɲɟɧɢɟɦ ɪɚɦɨɤ. ɉɪɢ ɤɚɠɞɨɦ
ɨɩɵɬɟ ɭɱɢɬɵɜɚɥɚɫɶ ɡɚɤɥɟɳɟɧɧɨɫɬɶ ɫɟɦɟɣ, ɩɨɪɚɠɟɧɢɟ ɚɫɤɨɫɮɟɪɨɡɨɦ ɢ ɧɨɡɟɦɚɬɨɡɨɦ.
Ɋɟɡɭɥɶɬɚɬɵ ɩɪɢɜɟɞɟɧɵ ɜ ɬɚɛɥɢɰɟ 1.
Ʉɚɤ ɜɢɞɧɨ ɢɡ ɬɚɛɥɢɰɵ, ɥɭɱɲɢɟ ɪɟɡɭɥɶɬɚɬɵ ɧɚɛɥɸɞɚɥɢɫɶ ɜ 2014 ɝɨɞɭ. ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɨɞɤɨɪɦɤɢ
ɫɚɯɚɪɧɵɦ ɫɢɪɨɩɨɦ ɫ ɞɨɛɚɜɥɟɧɢɟɦ ɚɧɨɥɢɬɚ ɡɚɤɥɟɳɟɧɧɨɫɬɶ, ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɚ 0,6 %, ɱɬɨ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɨɣ ɦɟɧɶɲɟ ɧɚ 70 %, ɫ ɮɢɬɨɥɢɬɨɦ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ ɤɨɧɬɪɨɥɸ ɭɦɟɧɶɲɢɥɚɫɶ ɧɚ 55 %, ɚ ɜ ɫɪɚɜɧɟɧɢɢ ɫ ɚɧɨɥɢɬɨɦ ɜɨɡɪɨɫɥɚ ɧɚ 21 %.
ɉɪɢ ɩɪɨɜɟɞɟɧɢɢ ɨɩɵɬɚ ɜɟɥɢ ɭɱɟɬ ɩɨ ɚɫɤɨɫɮɟɪɨɡɭ. Ⱦɨ ɩɨɞɤɨɪɦɤɢ ɜ ɝɪɭɩɩɚɯ ɨɬɦɟɱɚɥɚɫɶ ɫɪɟɞɧɹɹ
ɫɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɹ ɚɫɤɨɫɮɟɪɨɡɨɦ. ɉɨɫɥɟ ɩɪɨɜɟɞɟɧɧɨɝɨ ɥɟɱɟɧɢɹ ɜ ɩɟɪɜɨɣ ɝɪɭɩɩɟ ɩɱɟɥɨɫɟɦɟɣ ɩɪɢɡɧɚɤɨɜ ɚɫɤɨɫɮɟɪɨɡɚ ɧɟ ɧɚɛɥɸɞɚɥɨɫɶ, ɚ ɜɨ ɜɬɨɪɨɣ ɝɪɭɩɩɟ – ɫɥɚɛɚɹ ɫɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɹ, ɤɨɧɬɪɨɥɶɧɨɣ
ɝɪɭɩɩɟ – ɩɪɨɞɨɥɠɚɥɨɫɶ ɪɚɡɜɢɬɢɟ ɚɫɤɨɫɮɟɪɨɡɚ.
Ɍɚɛɥɢɰɚ 1
Ⱦɢɚɝɧɨɫɬɢɤɚ ɛɨɥɟɡɧɟɣ ɩɱɟɥɨɫɟɦɟɣ
Ⱦɨ ɨɛɪɚɛɨɬɤɢ
ɉɨɞɤɨɪɦɤɚ
Ɉɪɨɲɟɧɢɟ
Ɂɚɥɢɜɚɧɢɟ ɜ
ɭɥɨɱɤɢ
1,0
4,3
1,1
8,2
1,0
7,9
ɋɥ. ɋɥɚɛ. ɋɪ.
ɋɪ. ɋɪ. ɋɥɚɛ.
-
2,3
5,8
8,0
ɋɪ.
ɋɪ.
ɋɪ.
-
ɉɨɞɤɨɪɦɤɚ
Ɉɪɨɲɟɧɢɟ
Ɂɚɥɢɜɚɧɢɟ ɜ
ɭɥɨɱɤɢ
0,9
4,2
1,2
8,2
1,1
7,9
ɋɪ.
ɋɪ.
ɋɪ.
ɋɪ.
ɋɪ.
ɋɥɚɛ.
-
2,2
4,9
8
ɋɪ.
ɋɪ.
ɋɪ.
-
2014
-
2013
ɋɪ. ɋɥɚɛ.
2012
7,9
2014
6,4
2013
3,8
2012
-
ɉɨɪɚɠɟɧɢɹ
ɧɨɡɟɦɚɬɨɡɨɦ
2014
ɋɪ. ɋɥɚɛ. ɋɪ.
ɋɪ. ɋɪ. ɋɥɚɛ.
ɋɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɟ
ɚɫɤɨɫɮɟɪɨɡɨɦ
2013
0,9
7,6
Ɂɚɤɥɟɳɟɧɧɨɫɬɶ, %
2012
1,1
7,9
2014
1,1
4,0
2013
ɉɨɞɤɨɪɦɤɚ
Ɉɪɨɲɟɧɢɟ
Ɂɚɥɢɜɚɧɢɟ ɜ
ɭɥɨɱɤɢ
ɋɪ.
2012
2014
2013
Ƚɨɞ
2012
ɉɨɪɚɠɟɧɢɹ
ɧɨɡɟɦɚɬɨɡɨɦ
2014
ɋɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɟ ɚɫɤɨɫɮɟɪɨɡɨɦ
2013
Ɂɚɤɥɟɳɟɧɧɨɫɬɶ, %
2012
Ɇɟɬɨɞ
ɉɨɫɥɟ ɨɛɪɚɛɨɬɤɢ
0,9
3,5
0,8
4,9
0,6
1,9
ɋɥɚɛ.
ɋɥɚɛ.
-
-
-
-
-
-
3,3
5,5
4,2
ɋɥɚɛ.
-
-
-
-
-
Ɏɢɬɨɥɢɬ
+
-
0,9
3,9
1,0
8,0
0,9
6,9
ɋɥɚɛ.
ɋɥɚɛ.
ɋɥɚɛ.
ɋɥɚɛ.
-
-
-
-
-
2,1
5,2
7,2
ɋɥɚɛ.
ɋɥɚɛ.
ɋɥɚɛ.
-
-
-
Ʉɨɧɬɪɨɥɶ
-
1,5
4,5
1,8
8,4
2,0
8,2
ɋɪ.
ɋɪ.
ɋɪ.
ɋɢɥɶɧ. ɋɢɥɶɧ. ɋɥɚɛ.
-
-
-
2,3
5,2
8,4
ɋɢɥɶɧ.
ɋɢɥɶɧ. -
-
-
Ⱥɧɨɥɢɬ
+
-
-
-
-
ɋɪ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɚɧɨɥɢɬɚ ɩɪɟɜɵɲɚɟɬ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɮɢɬɨɥɢɬɚ, ɚ ɬɚɤ ɠɟ ɩɨɜɵɲɚɟɬ ɢɦɦɭɧɢɬɟɬ ɩɱɟɥ.
Ɇɟɬɨɞ ɨɪɨɲɟɧɢɹ ɩɨɤɚɡɚɥ ɫɥɟɞɭɸɳɢɟ ɪɟɡɭɥɶɬɚɬɵ, ɩɪɢ ɨɛɪɚɛɨɬɤɟ ɚɧɨɥɢɬɨɦ ɡɚɤɥɟɳɟɧɧɨɫɬɶ ɫɧɢɡɢɥɚɫɶ ɧɚ 75 %, ɚ ɮɢɬɨɥɢɬɨɦ ɧɚ 11,7 % , ɱɬɨ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ ɚɧɨɥɢɬɭ ɦɟɧɶɲɟ ɧɚ 63,3 %. Ⱦɨ ɨɛɪɚɛɨɬɤɢ ɧɚɛɥɸɞɚɥɚɫɶ ɫɥɚɛɚɹ ɫɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɹ ɚɫɤɨɫɮɟɪɨɡɨɦ – ɩɨɫɥɟ, ɩɪɢɡɧɚɤɨɜ ɡɚɛɨɥɟɜɚɧɢɹ ɧɟ
ɨɛɧɚɪɭɠɟɧɨ, ɩɱɟɥɵ ɩɨɥɧɨɫɬɶɸ ɜɵɱɢɫɬɢɥɢ ɩɨɪɚɠɟɧɧɵɟ ɹɱɟɣɤɢ.
243
ȼ ɪɟɡɭɥɶɬɚɬɟ ɨɛɪɚɛɨɬɨɤ ɦɟɬɨɞɨɦ ɡɚɥɢɜɚɧɢɹ ɜ ɭɥɨɱɤɢ ɮɢɬɨɥɢɬɨɦ ɡɚɤɥɟɳɟɧɧɨɫɬɶ ɩɱɟɥɢɧɵɯ ɫɟɦɟɣ ɭɦɟɧɶɲɢɥɚɫɶ ɧɚ 10 %, ɜ ɫɥɭɱɚɟ ɫ ɚɧɨɥɢɬɨɦ ɭɦɟɧɶɲɢɥɚɫɶ ɧɚ 46,8 %.
Ⱦɨ ɨɛɪɚɛɨɬɤɢ ɜ ɝɪɭɩɩɚɯ ɨɬɦɟɱɚɥɚɫɶ ɫɪɟɞɧɹɹ ɫɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɹ ɚɫɤɨɫɮɟɪɨɡɨɦ. ɉɨɫɥɟ ɩɪɨɜɟɞɟɧɧɨɝɨ ɥɟɱɟɧɢɹ ɜ ɩɟɪɜɨɣ ɝɪɭɩɩɟ ɩɱɟɥɨɫɟɦɟɣ ɫɥɟɞɨɜ ɚɫɤɨɫɮɟɪɨɡɚ ɧɟ ɧɚɛɥɸɞɚɥɨɫɶ, ɜɨ ɜɬɨɪɨɣ ɝɪɭɩɩɟ ɧɚɛɥɸɞɚɥɚɫɶ ɫɥɚɛɚɹ ɫɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɹ, ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɛɟɡ ɢɡɦɟɧɟɧɢɣ. ɂɡ ɷɬɨɝɨ ɫɥɟɞɭɟɬ,
ɱɬɨ ɚɧɨɥɢɬ ɹɜɥɹɟɬɫɹ ɷɮɮɟɤɬɢɜɧɵɦ ɩɪɟɩɚɪɚɬɨɦ ɜ ɥɟɱɟɧɢɢ ɜɚɪɪɨɚɬɨɡɚ.
ɉɨɪɚɠɟɧɢɟ ɧɨɡɟɦɚɬɨɡɨɦ ɜ ɨɩɵɬɧɵɯ ɩɨɞɝɪɭɩɩɚɯ ɧɚɛɥɸɞɚɥɨɫɶ ɜɟɫɧɨɣ 2013 ɝɨɞɚ ɞɨ ɩɨɞɤɨɪɦɤɢ,
ɩɨɫɥɟ ɩɨɞɤɨɪɦɤɢ ɫɚɯɚɪɧɵɦ ɫɢɪɨɩɨɦ ɫ ɞɨɛɚɜɥɟɧɢɟɦ ɩɪɟɩɚɪɚɬɨɜ «Ⱥɧɨɥɢɬ» ɢ «Ɏɢɬɨɥɢɬ» ɡɚɛɨɥɟɜɚɧɢɟ ɧɟ ɧɚɛɥɸɞɚɥɨɫɶ.
Ɋɟɡɭɥɶɬɚɬɵ ɩɪɨɜɟɞɟɧɧɵɯ ɨɩɵɬɨɜ ɩɨɞɬɜɟɪɠɞɚɸɬ ɜɨɡɦɨɠɧɨɫɬɶ ɜɤɥɸɱɟɧɢɹ ɷɥɟɤɬɪɨɚɤɬɢɜɢɪɨɜɚɧɧɨɝɨ ɪɚɫɬɜɨɪɚ ɚɧɨɥɢɬ ɜ ɜɟɬɟɪɢɧɚɪɧɭɸ ɩɪɚɤɬɢɤɭ ɫɨɜɪɟɦɟɧɧɨɝɨ ɩɱɟɥɨɜɨɞɫɬɜɚ ɤɚɤ ɷɮɮɟɤɬɢɜɧɨɝɨ ɥɟɱɟɛɧɨ-ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɨɝɨ ɢ ɜ ɨɩɪɟɞɟɥɟɧɧɨɣ ɫɬɟɩɟɧɢ ɫɬɢɦɭɥɢɪɭɸɳɟɝɨ ɫɪɟɞɫɬɜɚ.
Ⱥɧɨɥɢɬ, ɩɨɥɭɱɟɧɧɵɣ ɫ ɩɨɦɨɳɶɸ ɷɥɟɤɬɪɨɯɢɦɢɱɟɫɤɢɯ ɬɟɯɧɨɥɨɝɢɣ, ɧɟɬɨɤɫɢɱɟɧ ɢ ɧɟ ɧɚɤɚɩɥɢɜɚɟɬɫɹ ɜ ɩɪɨɞɭɤɬɚɯ ɩɱɟɥɨɜɨɞɫɬɜɚ, ɨɧ ɨɛɥɚɞɚɟɬ ɷɮɮɟɤɬɨɦ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɫɬɢɦɭɥɹɰɢɢ ɢ ɛɥɚɝɨɩɪɢɹɬɧɨ
ɫɤɚɡɵɜɚɸɬɫɹ ɧɚ ɩɪɨɰɟɫɫɚɯ ɨɛɦɟɧɚ ɜɟɳɟɫɬɜ. ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɷɬɨɝɨ ɪɚɫɬɜɨɪɚ ɩɪɟɞɨɯɪɚɧɢɬ ɩɱɟɥɢɧɵɟ
ɫɟɦɶɢ ɨɬ ɢɧɮɟɤɰɢɨɧɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ, ɚ ɬɚɤɠɟ ɛɭɞɟɬ ɫɬɢɦɭɥɢɪɨɜɚɬɶ ɪɚɡɜɢɬɢɟ ɫɟɦɟɣ. ɉɪɢɜɵɤɚɧɢɹ
ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ ɤ ɷɬɨɦɭ ɪɚɫɬɜɨɪɭ ɧɟɬ, ɜ ɨɬɥɢɱɢɟ ɨɬ ɦɧɨɝɢɯ ɫɨɜɪɟɦɟɧɧɵɯ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɩɪɟɩɚɪɚɬɨɜ, ɤɨɬɨɪɵɟ ɜ ɧɚɫɬɨɹɳɢɣ ɦɨɦɟɧɬ ɬɟɪɹɸɬ ɫɜɨɸ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɢɡ-ɡɚ ɩɪɢɜɵɤɚɧɢɹ ɤ ɧɢɦ ɩɚɬɨɝɟɧɧɨɣ ɮɥɨɪɵ. Ȼɨɥɟɟ ɬɨɝɨ, ɨɛɪɚɛɨɬɤɭ ɷɬɢɦ ɪɚɫɬɜɨɪɚɦ ɦɨɠɧɨ ɩɪɨɜɨɞɢɬɶ ɢ ɜɨ ɜɪɟɦɹ ɜɡɹɬɤɨɜ, ɧɟ
ɨɩɚɫɚɹɫɶ ɡɚ ɤɚɱɟɫɬɜɨ ɦɟɞɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
Ʉɨɥɛɢɧɚ Ʌ.Ɇ., ɇɟɩɟɣɜɨɞɚ ɋ.ɇ. ɇɟɬɪɚɞɢɰɢɨɧɧɵɟ ɫɩɨɫɨɛɵ ɥɟɱɟɧɢɹ ɩɱɟɥ. – ɂɠɟɜɫɤ, 2004
ɉɚɬɟɧɬ ɊɎ 2156060. ɋɩɨɫɨɛ ɨɛɫɥɭɠɢɜɚɧɢɹ ɩɱɟɥ, ru-patent.info
Ɇɟɬɨɞɢɱɟɫɤɢɟ ɭɤɚɡɚɧɢɹ ɩɨ ɩɪɢɦɟɧɟɧɢɸ ɧɟɣɬɪɚɥɶɧɨɝɨ ɚɧɨɥɢɬɚ ȺɇɄ, ɜɵɪɚɛɚɬɵɜɚɟɦɨɝɨ ɜ ɭɫɬɚɧɨɜɤɟ
ɋɬɷɥ, ɞɥɹ ɰɟɥɟɣ ɞɟɡɢɧɮɟɤɰɢɢ, ɨɱɢɫɬɤɢ ɜ ɩɱɟɥɨɜɨɞɫɬɜɟ. ɉɪɢɥɨɠɟɧɢɟ ɤ Ɇɟɬɨɞɢɱɟɫɤɢɦ ɭɤɚɡɚɧɢɹɦ ʋ
Ɇɍ-17–12 ɨɬ 14.02.1997 ɝ.
ɍȾɄ. 616:001.16 – 092+619.615.356
ɂɇɇɈȼȺɐɂɈɇɇɈȿ ɇȺɉɊȺȼɅȿɇɂȿ ɉɊɂɆȿɇȿɇɂə
ɋɍɉɊȺɆɈɅȿɄɍɅəɊɇɕɏ ɄɈɆɉɅȿɄɋɈȼ ɉɊɈɌɂȼ
ȼɈɁȻɍȾɂɌȿɅȿɃ ɂɇɎȿɄɐɂɈɇɇɕɏ ȻɈɅȿɁɇȿɃ
ɄȺɒɂɇ Ⱥ.ɋ. *, ɄȺɒɂɇȺ Ƚ.ȼ.**, ɒȿɅȿɉɈȼ ȼ.Ƚ.**,
*ɎȽȻɈɍ ȼɉɈ Ʉɪɚɫɧɨɹɪɫɤɢɣ ɚɝɪɚɪɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ (Ʉɪɚɫɧɨɹɪɫɤ, ɊɎ.)
**
ɎȽȻɍ “ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ”
(ɊɎ, ɩɨɫ. Ʉɪɚɫɧɨɨɛɫɤ ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ), gal8@mail.ru
Ɋɟɫɩɢɪɚɬɨɪɧɵɟ ɜɢɪɭɫɧɵɟ ɢɧɮɟɤɰɢɢ ɹɜɥɹɸɬɫɹ ɩɪɨɜɨɤɚɬɨɪɨɦ ɜɨɡɧɢɤɧɨɜɟɧɢɹ ɫɟɤɭɧɞɚɪɧɵɯ ɢɧɮɟɤɰɢɣ ɦɨɥɨɞɧɹɤɚ. ɉɪɟɠɞɟ ɜɫɟɝɨ, ɷɬɨ ɨɬɧɨɫɢɬɫɹ ɤ ɠɟɥɭɞɨɱɧɨ- ɤɢɲɟɱɧɵɦ ɛɨɥɟɡɧɹɦ ɬɟɥɹɬ ɩɪɨɞɭɤɬɢɜɧɵɯ ɠɢɜɨɬɧɵɯ. ɂɫɫɥɟɞɨɜɚɧɢɹɦɢ ɩɨɫɥɟɞɧɢɯ ɥɟɬ ɞɨɤɚɡɚɧɨ, ɱɬɨ ɫɪɟɞɢ ɚɤɬɭɚɥɶɧɵɯ ɩɪɢɱɢɧ
ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ ɧɨɜɨɪɨɠɞɟɧɧɵɯ ɬɟɥɹɬ ɜ ɧɚɲɟɦ ɪɟɝɢɨɧɟ ɩɨ ɦɚɫɫɨɜɨɫɬɢ ɩɨɪɚɠɟɧɢɹ, ɬɹɠɟɫɬɢ ɩɪɨɹɜɥɟɧɢɹ ɢ ɝɢɛɟɥɢ ɠɢɜɨɬɧɵɯ ɨɞɧɨ ɢɡ ɜɟɞɭɳɢɯ ɦɟɫɬ ɡɚɧɢɦɚɸɬ ɷɧɬɟɪɨɩɚɬɨɝɟɧɧɵɟ
ɷɲɟɪɢɯɢɢ – E. Coli (1,2).
ɇɚɥɢɱɢɟ ɭ ɬɟɥɹɬ ɜ ɭɫɥɨɜɢɹɯ ɯɨɡɹɣɫɬɜ ɋɢɛɢɪɢ ɛɨɥɶɲɨɝɨ ɧɚɛɨɪɚ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɜɚɪɢɚɧɬɨɜ E.
Coli, ɫɩɨɫɨɛɧɨɫɬɢ ɢɯ ɩɪɨɞɭɰɢɪɨɜɚɬɶ ɷɧɬɟɪɨɬɨɤɫɢɧɵ ɛɥɚɝɨɞɚɪɹ ɢɯ ɚɞɝɟɡɢɜɧɨɣ ɢ ɢɧɜɚɡɢɜɧɨɣ ɚɤɬɢɜɧɨɫɬɢ, ɭɫɬɨɣɱɢɜɨɫɬɢ ɤ ɲɢɪɨɤɨɦɭ ɫɩɟɤɬɪɭ ɚɧɬɢɛɚɤɬɟɪɢɚɥɶɧɵɯ ɮɚɪɚɦɚɤɨɥɨɝɢɱɟɫɤɢɯ ɩɪɟɩɚɪɚɬɨɜ,
ɨɛɟɫɩɟɱɢɜɚɟɬ ɞɚɧɧɨɦɭ ɦɢɤɪɨɨɪɝɚɧɢɡɦɭ ɞɥɢɬɟɥɶɧɨɟ ɰɢɪɤɭɥɢɪɨɜɚɧɢɟ ɜɨ ɜɧɟɲɧɟɣ ɫɪɟɞɟ ɢ ɜ ɨɪɝɚɧɢɡɦɟ ɠɢɜɨɬɧɵɯ.
ɐɟɥɶɸ ɪɚɛɨɬɵ ɹɜɥɹɟɬɫɹ ɩɨɤɚɡɚɬɶ ɩɟɪɫɩɟɤɬɢɜɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɯɨɥɨɞɧɨɣ ɫɲɢɜɤɢ ɩɪɢɪɨɞɧɵɯ
ɩɨɥɢɦɟɪɨɜ: ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɨɝɨ ɩɨɥɢɫɚɯɚɪɢɞɚ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚ ɢ ȾɄɉ Ƚɋ ɞɥɹ ɦɨɞɢɮɢɤɚɰɢɢ
ɩɪɨɬɢɜɨɢɧɮɟɤɰɢɨɧɧɵɯ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɫɪɟɞɫɬɜ ɫ ɜɵɫɨɤɨ-ɢɨɧɧɵɦ ɦɚɫɫ ɨɛɦɟɧɨɦ.
ȼ ɫɜɹɡɢ ɫ ɚɤɬɭɚɥɶɧɨɫɬɶɸ ɞɚɧɧɨɣ ɩɪɨɛɥɟɦɵ ɡɚɞɚɱɚɦɢ ɧɚɲɟɣ ɪɚɛɨɬɵ ɹɜɢɥɨɫɶ ɩɪɨɞɨɥɠɟɧɢɟ ɰɢɤɥɚ ɪɚɛɨɬ ɩɨ ɢɡɭɱɟɧɢɸ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ ɢ ɛɢɨɥɨɝɢɱɟɫɤɢɯ ɫɜɨɣɫɬɜ ɤɭɥɶɬɭɪ
ɷɲɟɪɢɯɢɣ, ɜɤɥɸɱɚɸɳɢɯ ɪɟɝɢɨɧɚɥɶɧɵɟ ɨɫɨɛɟɧɧɨɫɬɢ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢ ɩɪɨɹɜɥɟɧɢɹ ɛɨɥɟɡɧɢ, ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɢ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ.
244
Ɇɨɧɢɬɨɪɝɨɜɵɟ ɧɚɤɨɩɥɟɧɧɵɟ ɞɚɧɧɵɟ ɡɚ ɩɨɫɥɟɞɧɢɟ 10 ɥɟɬ ɩɨɡɜɨɥɹɸɬ ɭɬɜɟɪɠɞɚɬɶ, ɱɬɨ ɷɧɬɟɪɨɩɚɬɨɝɟɧɧɵɟ ɢ ɷɧɬɟɪɨɬɨɤɫɢɝɟɧɧɵɟ ɷɲɟɪɢɯɢɢ, ɤɚɤ ɦɨɧɨɢɧɮɟɤɰɢɹ ɜ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɯɨɡɹɣɫɬɜɚɯ
ɪɟɝɢɨɧɚ. ɑɚɳɟ ɜɫɬɪɟɱɚɸɬɫɹ ɧɚ ɮɨɧɟ ɧɚɪɭɲɟɧɢɣ ɦɟɯɚɧɢɡɦɚ ɮɨɪɦɢɪɨɜɚɧɢɹ ɤɢɲɟɱɧɨɝɨ ɦɢɤɪɨɛɢɨɰɟɧɨɡɚ ɭ ɧɨɜɨɪɨɠɞɟɧɧɵɯ ɬɟɥɹɬ. ɂɡɨɥɹɬɵ ɷɲɟɪɢɯɢɣ ɫ ɚɞɝɟɡɢɜɧɵɦɢ ɚɧɬɢɝɟɧɚɦɢ Ⱥ20, Ʉ99, ɞɜɚɞɰɚɬɶ
ɥɟɬ ɧɚɡɚɞ, ɛɵɥɢ ɪɟɡɢɫɬɟɧɬɧɵɦɢ ɤ 4 ɪɚɫɩɪɨɫɬɪɚɧɟɧɧɵɦ ɚɧɬɢɛɢɨɬɢɤɚɦ. ɋɩɭɫɬɹ ɞɟɫɹɬɶ ɥɟɬ ɧɚɡɚɞ, ɢɡ
48 % ɜɵɞɟɥɟɧɧɵɯ ɷɧɬɟɪɨɬɨɤɫɢɝɟɧɧɵɯ ɲɬɚɦɦɨɜ E. Coli ɨɤɚɡɚɥɢɫɶ ɭɫɬɨɣɱɢɜɵɦɢ ɤ 8 ɚɧɬɢɛɢɨɬɢɤɚɦ,
35 % – ɤ 10–11 ɩɪɢɦɟɧɹɟɦɵɦ ɚɧɬɢɛɢɨɬɢɤɚɦ ɜ ɯɨɡɹɣɫɬɜɚɯ ɪɟɝɢɨɧɚ.
ɉɟɪɫɩɟɤɬɢɜɧɵɦ ɢɧɧɨɜɚɰɢɨɧɧɵɦ ɧɚɩɪɚɜɥɟɧɢɟɦ ɜ ɪɟɲɟɧɢɢ ɭɫɢɥɟɧɢɹ ɚɤɬɢɜɧɨɫɬɢ ɢ ɪɚɫɲɢɪɟɧɢɹ
ɚɪɟɚɥɚ ɜɨɡɞɟɣɫɬɜɢɹ ȾɄ ɉȽɋ ɢ ɩɨɥɢɫɚɯɚɪɢɞɚ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚ ɧɚ ɜɨɡɛɭɞɢɬɟɥɟɣ ɢɧɮɟɤɰɢɨɧɧɵɯ
ɧɚɱɚɥ, ɫɱɢɬɚɟɦ ɧɟɨɛɯɨɞɢɦɵɦ ɫɨɡɞɚɧɢɟ ɧɨɜɨɣ ɬɟɯɧɨɥɨɝɢɢ ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɫɢɫɬɟɦ/ɤɨɦɩɥɟɤɫɨɜ.
Ⱦɥɹ ɩɨɥɭɱɟɧɢɹ ɬɚɤɢɯ ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɫɢɫɬɟɦ ɪɚɡɪɚɛɨɬɚɧɚ ɨɪɢɝɢɧɚɥɶɧɚɹ ɬɜɟɪɞɨɮɚɡɧɚɹ ɦɟɯɚɧɨɯɢɦɢɱɟɫɤɚɹ ɬɟɯɧɨɥɨɝɢɹ ɩɨɥɭɱɟɧɢɹ ɬɜɟɪɞɵɯ ɞɢɫɩɟɪɫɢɨɧɧɵɯ ɤɨɦɩɨɧɟɧɬɨɜ. ɉɪɢ ɷɬɨɦ ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɟ ɤɨɦɩɥɟɤɫɵ ɨɛɪɚɡɭɸɬɫɹ ɜ ɩɪɨɰɟɫɫɟ ɬɜɟɪɞɨɮɚɡɧɨɝɨ ɫɢɧɬɟɡɚ, ɥɢɛɨ ɩɪɢ ɪɚɫɬɜɨɪɟɧɢɢ
ɩɨɥɭɱɟɧɧɵɯ ɞɢɫɩɟɪɫɢɣ ɜ ɜɨɞɧɵɯ ɪɚɫɬɜɨɪɚɯ. ɉɨɥɭɱɟɧɢɹ ɬɚɤɢɯ ɜɵɫɨɤɨɷɮɮɟɤɬɢɜɧɵɯ ɫɭɛɫɬɚɧɰɢɣ
ɩɪɟɩɚɪɚɬɨɜ ɞɨɫɬɢɝɧɭɬɨ ɦɟɬɨɞɨɦ ɯɨɥɨɞɧɨɝɨ ɫɲɢɜɚɧɢɹ ɦɚɤɪɨɦɨɥɟɤɭɥ ȾɄ ɉȽɋ ɫ ɩɨɥɢɫɚɯɚɪɢɞɚɦɢ
(ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚɦɢ). Ⱥɪɚɛɢɧɨɝɚɥɚɤɬɚɧɬ ɨɛɥɚɞɚɟɬ ɢɨɧɧɨ – ɨɛɦɟɧɧɨɣ ɪɟɚɤɰɢɟɣ ɜ ɜɨɞɧɵɯ ɮɢɡɢɨɥɨɝɢɱɟɫɤɢɯ ɪɚɫɬɜɨɪɚɯ, ɱɬɨ ɨɛɟɫɩɟɱɢɜɚɟɬ ɢɨɧɧɵɣ ɦɚɫɫ ɨɛɦɟɧ ɫ ɢɧɬɟɝɪɚɰɢɟɣ (ɧɚ ɭɪɨɜɧɟ ɦɟɠɦɨɥɟɤɭɥɹɪɧɨɣ ɞɢɮɮɭɡɢɢ) ɬɪɚɧɫɩɨɪɬɧɵɯ ɧɨɫɢɬɟɥɟɣ ɛɟɥɤɨɜ ɱɟɪɟɡ ɦɟɦɛɪɚɧɵ ɤɥɟɬɨɤ ɤ ɤɥɟɬɨɱɧɵɦ ɜɤɥɸɱɟɧɢɹɦ. ɍɫɢɥɟɧɧɵɣ ɮɚɪɦɚɤɨɥɨɝɢɱɟɫɤɢɣ ɩɪɨɬɢɜɨɢɧɮɟɤɰɢɨɧɧɵɣ ɷɮɮɟɤɬ, ɬɚɤɢɯ ɫɬɪɭɤɬɭɪ ȾɄ ɉȽɋ
ɞɨɫɬɢɝɚɟɬɫɹ ɡɚ ɫɱɟɬ «ɚɞɪɟɫɧɨɣ» ɞɨɫɬɚɜɤɢ ɦɨɥɟɤɭɥ ɤɨɦɩɥɟɤɫɧɨɣ ɫɵɜɨɪɨɬɤɢ ɤ ɚɤɬɢɜɧɵɦ ɰɟɧɬɪɚɦ
ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɯ ɪɟɰɟɩɬɨɪɨɜ ɨɪɝɚɧɨɜ ɢ ɬɤɚɧɟɣ (3). ɗɮɮɟɤɬɢɜɧɨɫɬɶ ȾɄ ɉȽɋ ɡɚɜɢɫɢɬ ɨɬ ɞɨɡɵ ɩɪɢɦɟɧɟɧɢɹ. ɉɨɷɬɨɦɭ ɫɨɡɞɚɧɢɟ ɧɢɡɤɨɞɨɡɨɜɵɯ ɫɵɜɨɪɨɬɨɤ ɡɚ ɫɱɟɬ ɯɨɥɨɞɧɨɝɨ ɫɲɢɜɚɧɢɹ ɫ ɩɨɥɢɫɚɯɚɪɢɞɨɦ
ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɨɦ ɹɜɢɥɨɫɶ ɚɧɬɢɛɚɤɬɟɪɢɚɥɶɧɵɦ ɥɟɤɚɪɫɬɜɟɧɧɵɦ ɫɪɟɞɫɬɜɨɦ ɫ ɩɨɧɢɠɟɧɧɨɣ ɬɨɤɫɢɱɧɨɫɬɶɸ ɢ ɩɨɜɵɲɟɧɧɨɣ ɮɚɪɦɚɤɨɥɨɝɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɶɸ ɢ ɛɟɡɨɩɚɫɧɨɫɬɶɸ ɢɯ ɞɟɣɫɬɜɢɹ – ɞɨ
80–150 ɪɚɡ. ɋɭɳɟɫɬɜɟɧɧɨ ɞɨɫɬɢɝɚɥɨɫɶ ɩɨɜɵɲɟɧɢɟ ɬɟɪɚɩɟɜɬɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ ɞɨɡɵ ɥɟɤɚɪɫɬɜ,
ɭɦɟɧɶɲɟɧɢɟ (ɜɩɥɨɬɶ ɞɨ ɩɨɥɧɨɝɨ ɢɫɱɟɡɧɨɜɟɧɢɹ) ɜɪɟɞɧɵɯ ɩɨɛɨɱɧɵɯ ɷɮɮɟɤɬɨɜ ɢ ɜ ɧɟɤɨɬɨɪɵɯ ɫɥɭɱɚɹɯ ɭɫɢɥɟɧɢɹ ɧɟɬɢɩɢɱɧɵɯ, ɬɚɤ ɧɚɡɵɜɚɟɦɵɯ ɩɥɟɣɨɬɪɨɩɧɵɯ ɫɜɨɣɫɬɜ ɩɪɟɩɚɪɚɬɨɜ. ɉɥɟɣɨɬɪɨɩɧɨɫɬɶ
ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɤɨɦɩɥɟɤɫɨɜ ȾɄ ɉȽɋ ɢ ɨɮɢɰɢɧɚɥɶɧɨɝɨ ɩɨɥɢɫɚɯɚɪɢɞɚ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚ ɩɪɟɞɩɨɥɚɝɚɟɬ ɜɥɢɹɧɢɟ ɩɪɟɩɚɪɚɬɚ ɧɚ ɧɟɫɤɨɥɶɤɨ ɦɢɲɟɧɟɣ, ɡɚɩɭɫɤɚɸɳɟɟ ɪɚɡɥɢɱɧɵɟ ɛɢɨɯɢɦɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ ɜ ɨɪɝɚɧɢɡɦɟ; ɞɢɜɟɪɝɟɧɰɢɸ ɛɢɨɯɢɦɢɱɟɫɤɢɯ ɢ ɩɚɬɨɮɢɡɢɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ, ɢɫɯɨɞɹɳɢɯ
ɨɬ ɨɫɧɨɜɧɨɣ (ɚɧɬɢɛɚɤɬɟɪɢɚɥɶɧɨɣ) ɦɢɲɟɧɢ.
ɇɚ ɦɨɞɟɥɢ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɝɨ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ ɬɟɥɹɬ ɩɪɨɜɟɞɟɧɵ ɫɪɚɜɧɢɬɟɥɶɧɵɟ ɢɫɩɵɬɚɧɢɹ
ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɤɨɦɩɥɟɤɫɨɜ ȾɄ ɉȽɋ ɢ ɮɚɪɦɚɤɨɩɟɣɧɨɝɨ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚ (ɎȺȽ). ɉɨɤɚɡɚɧɨ,
ɱɬɨ ɩɪɢ ɪɚɜɧɵɯ ɞɨɡɢɪɨɜɤɚɯ ȾɄ ɉȽɋ, ɩɪɨɬɢɜɨɢɧɮɟɤɰɢɨɧɧɚɹ ɚɤɬɢɜɧɨɫɬɶ ɤɨɦɩɥɟɤɫɨɜ ɎȺȽ ɫɭɳɟɫɬɜɟɧɧɨ ɜɵɲɟ, ɱɟɦ ɨɮɢɰɢɧɚɥɶɧɚɹ ɫɵɜɨɪɨɬɤɚ. Ɏɚɪɦɚɤɨɤɢɧɟɬɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɚɧɬɢɬɟɥ ɩɨɞɬɜɟɪɞɢɥɢ ɦɧɨɝɨɤɪɚɬɧɨɟ ɭɜɟɥɢɱɟɧɢɟ ɢɯ ɨɬɧɨɫɢɬɟɥɶɧɨɣ ɛɢɨɞɨɫɬɭɩɧɨɫɬɢ ɢ ɞɟɣɫɬɜɭɸɳɢɯ ɤɨɧɰɟɧɬɪɚɰɢɣ
ɜ ɤɪɨɜɢ ɩɨɞɨɩɵɬɧɵɯ ɠɢɜɨɬɧɵɯ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɜɧɟɞɪɟɧɢɟ ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɤɨɦɩɥɟɤɫɨɜ ȾɄ ɉȽɋ ɜ ɤɨɦɛɢɧɚɰɢɢ ɫ ɮɚɪɦɚɤɨɩɟɣɧɵɦ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɨɦ (ɎȺȽ) ɛɭɞɟɬ ɫɩɨɫɨɛɫɬɜɨɜɚɬɶ ɫɧɢɠɟɧɢɸ ɜɨɡɧɢɤɧɨɜɟɧɢɹ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ ɜ ɪɟɝɢɨɧɟ, ɰɢɪɤɭɥɹɰɢɢ ɜɨɡɛɭɞɢɬɟɥɟɣ ɜɢɪɭɫɧɵɯ ɢɧɮɟɤɰɢɣ ɢ ɜɨɡɛɭɞɢɬɟɥɟɣ ɢɦɦɭɧɨɞɟɩɪɟɫɫɢɜɧɵɯ
ɛɨɥɟɡɧɟɣ ɬɟɥɹɬ. ɋɧɢɠɟɧɢɟ ɩɪɟɞɪɚɫɩɨɥɚɝɚɸɳɢɯ ɮɚɤɬɨɪɨɜ, ɫɩɨɫɨɛɫɬɜɭɸɳɢɯ ɜɨɡɧɢɤɧɨɜɟɧɢɸ ɫɟɤɭɧɞɚɪɧɵɯ ɢɧɮɟɤɰɢɣ, ɚ ɬɚɤɠɟ ɭɥɭɱɲɟɧɢɟ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɯ ɧɨɪɦ, ɬɟɯɧɨɥɨɝɢɢ ɤɨɪɦɥɟɧɢɹ
ɢ ɫɨɞɟɪɠɚɧɢɹ ɠɢɜɨɬɧɵɯ, ɜɧɟɞɪɟɧɢɟ ɚɧɬɢɫɬɪɟɫɫɨɜɵɯ ɢ ɚɧɬɢɦɢɤɨɬɨɤɫɢɤɨɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɩɨɡɜɨɥɢɬ ɭɫɩɟɲɧɨ ɨɡɞɨɪɨɜɢɬɶ ɯɨɡɹɣɫɬɜɨ ɨɬ ɫɟɤɭɧɞɚɪɧɵɯ ɛɨɥɟɡɧɟɣ ɦɨɥɨɞɧɹɤɚ ɩɪɨɞɭɤɬɢɜɧɵɯ ɠɢɜɨɬɧɵɯ.
ɉɪɢɦɟɧɟɧɢɟ ɚɧɬɢɛɢɨɬɢɤɨɜ ɩɪɨɬɢɜ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ ɜ ɭɫɥɨɜɢɹɯ ɫɨɜɪɟɦɟɧɧɨɝɨ ɩɪɨɦɵɲɥɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ – ɷɬɨ ɜɵɧɭɠɞɟɧɧɚɹ ɜɪɟɦɟɧɧɚɹ ɦɟɪɚ ɫ ɤɪɚɬɤɨɫɪɨɱɧɵɦ ɷɮɮɟɤɬɨɦ, ɚ ɜɨ ɦɧɨɝɢɯ ɯɨɡɹɣɫɬɜɚɯ – ɚɛɫɨɥɸɬɧɨ ɛɟɫɩɨɥɟɡɧɚɹ, ɜ ɫɪɚɜɧɟɧɢɢ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɫɭɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɤɨɦɩɥɟɤɫɨɜ ɎȺȽ
ɢ ȾɄ ɉȽɋ. Ȼɨɪɶɛɭ ɫ ɤɨɥɢɛɚɤɬɟɪɢɨɡɨɦ ɧɟɨɛɯɨɞɢɦɨ ɧɚɱɢɧɚɬɶ ɫ ɩɪɨɜɟɞɟɧɢɹ ɲɢɪɨɤɢɯ ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ, ɭɫɬɚɧɨɜɥɟɧɢɹ ɩɪɚɜɢɥɶɧɨɝɨ ɞɢɚɝɧɨɡɚ, ɩɪɨɜɟɞɟɧɢɹ ɤɨɦɩɥɟɤɫɚ ɫɩɟɰɢɮɢɱɟɫɤɢɯ
ɦɟɪɨɩɪɢɹɬɢɣ ɩɨ ɭɥɭɱɲɟɧɢɸ ɷɤɨɥɨɝɨ-ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ, ɭɥɭɱɲɟɧɢɸ ɭɫɥɨɜɢɣ ɤɨɪɦɥɟɧɢɹ ɢ
ɫɨɞɟɪɠɚɧɢɹ, ɩɪɨɮɢɥɚɤɬɢɤɟ ɫɬɪɟɫɫɨɜ.
ȼɵɜɨɞ: ɋ ɭɱɟɬɨɦ ɭɫɬɚɧɨɜɥɟɧɧɨɝɨ ɷɬɢɨɩɚɬɨɝɟɧɟɡɚ ɪɚɡɜɢɬɢɹ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ ɧɚ ɮɨɧɟ ɷɤɨɥɨɝɢɱɟɫɤɨɝɨ ɧɟɛɥɚɝɨɩɨɥɭɱɢɹ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ ɩɪɨɞɭɤɬɢɜɧɵɯ ɠɢɜɨɬɧɵɯ, ɧɚɦɢ ɪɚɡɪɚɛɨɬɚɧɚ
«Ⱦɟɬɨɤɫɢɮɢɰɢɪɭɸɳɚɹ ɤɜɚɧɬɨɜɚɹ ɩɨɥɢɜɚɥɟɧɬɧɚɹ ɝɢɩɟɪɢɦɦɭɧɧɚɹ ɫɵɜɨɪɨɬɤɚ (ȾɄ ɉȽɋ), ɧɚ ɤɨɬɨɪɭɸ
ɩɨɥɭɱɟɧ ɩɚɬɟɧɬ ɩɨɞ ʋ219659. ɉɨɫɥɟ ɞɟɫɹɬɢɥɟɬɧɟɣ ɚɩɪɨɛɚɰɢɢ ɫɵɜɨɪɨɬɤɢ ɛɵɥɢ ɜɵɹɜɥɟɧɵ ɜɨɡɦɨɠɧɨɫɬɢ ɪɟɡɤɨɝɨ ɩɨɜɵɲɟɧɢɹ ɯɢɦɢɨɬɟɪɚɩɟɜɬɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ, ɩɪɢɧɹɬɨ ɪɟɲɟɧɢɟ ɭɫɢɥɢɬɶ ɟɟ
ɚɧɬɢɛɚɤɬɟɪɢɚɥɶɧɵɣ ɢ ɚɧɬɢɬɨɤɫɢɱɟɫɤɢɣ ɷɮɮɟɤɬ ɧɚ ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɨɦ ɭɪɨɜɧɟ ɦɟɬɨɞɨɦ ɯɨɥɨɞɧɨɝɨ
ɫɲɢɜɚɧɢɹ ɫɵɜɨɪɨɬɤɢ ɫ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɨɦ. ɉɪɨɢɡɜɨɞɫɬɜɟɧɧɵɟ ɨɩɵɬɵ ɩɨɞɬɜɟɪɞɢɥɢ, ɱɬɨ ɩɪɢ ɪɚɜɧɵɯ ɞɨɡɢɪɨɜɤɚɯ ȾɄ ɉȽɋ ɢ ȾɄ ɉȽɋ + ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧ, ɩɨɫɥɟɞɧɢɣ ɫɩɨɫɨɛɫɬɜɨɜɚɥ ɫɧɢɠɟɧɢɸ ɜɨɡ245
ɧɢɤɧɨɜɟɧɢɹ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ, ɰɢɪɤɭɥɹɰɢɢ ɜɨɡɛɭɞɢɬɟɥɟɣ ɫɟɤɭɧɞɚɪɧɵɯ ɢɧɮɟɤɰɢɣ ɜ 6,7- 8,4 ɪɚɡ ɫɢɥɶɧɟɟ, ɱɟɦ ɨɞɢɧ ȾɄ ɉȽɋ. ɗɤɨɧɨɦɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ȾɄ ɉȽɋ+ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧ ɞɥɹ
ɩɪɨɮɢɥɚɤɬɢɤɢ ɢ ɬɟɪɚɩɢɢ ɤɨɥɢɛɚɤɬɟɪɢɨɡɚ ɬɟɥɹɬ ɜ 8–10 ɪɚɡ ɩɪɟɜɵɲɚɟɬ ɬɚɤɨɜɭɸ ɩɪɢ ɢɫɩɨɥɶɡɨɜɚɧɢɢ
ɲɢɪɨɤɨ ɢɫɩɨɥɶɡɭɟɦɵɯ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɫɪɟɞɫɬɜ ɩɪɢ ɞɚɧɧɨɣ ɢɧɮɟɤɰɢɢ, ɬ.ɟ. ɨɬ 19
ɞɨ 28,7 ɪɭɛ. ɧɚ 1 ɪɭɛ. ɡɚɬɪɚɬ.
ɉɨɥɭɱɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɞɟɦɨɧɫɬɪɢɪɭɸɬ ɜɨɡɦɨɠɧɨɫɬɶ ɫɨɡɞɚɧɢɹ ɚɧɬɢɢɧɮɟɤɰɢɨɧɧɵɯ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɫɪɟɞɫɬɜ ɲɢɪɨɤɨɝɨ ɫɩɟɤɬɪɚ ɞɟɣɫɬɜɢɹ ɧɚ ɨɫɧɨɜɟ ɦɟɠɦɨɥɟɤɭɥɹɪɧɵɯ ɤɨɦɩɥɟɤɫɨɜ ɎȺȽ ɢ ȾɄ
ɉȽɋ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
Ȼɭɝɚɤɨɜ ɘ.Ⱦ. ɋɢɫɬɟɦɚ ɩɨɥɭɱɟɧɢɹ ɢ ɜɵɪɚɳɢɜɚɧɢɹ ɡɞɨɪɨɜɵɯ ɬɟɥɹɬ ɜ ȺɈɁɌ ɩɥɟɦɡɚɜɨɞɚ «ɂɪɦɟɧɶ»: Ɇɟɬɨɞɢɱɟɫɤɢɟ ɪɟɤɨɦɟɧɞɚɰɢɢ // Ȼɭɝɚɤɨɜ ɘ.Ⱦ., Ʌɚɜɪɨɜ Ⱥ.ɂ., Ⱦɨɧɱɟɧɤɨ Ⱥ.ɋ., ɒɤɢɥɶ ɇ.Ⱥ. / ɋɈ ɊȺɋɏɇ. –
Ʉɪɚɫɧɨɨɛɫɤ, 2001. – 17 ɫ.
Ⱦɠɭɩɢɧɚ ɋ.ɂ. Ʉɥɚɫɫɢɱɟɫɤɢɟ ɢ ɮɚɤɬɨɪɧɵɟ ɢɧɮɟɤɰɢɨɧɧɵɟ ɛɨɥɟɡɧɢ /ȼɟɫɬɧɢɤ Ɋɨɫɫɢɣɫɤɨɣ ɚɤɚɞɟɦɢɢ ɫ.-ɯ.
ɧɚɭɤ. – 1992. – ʋ 1. – ɋ.47 – 50.
Ʉɚɲɢɧ Ⱥ.ɋ. Ʉɨɥɢɛɚɤɬɟɪɢɨɡ ɬɟɥɹɬ ɜ ɫɨɜɪɟɦɟɧɧɵɯ ɷɤɨɥɨɝɢɱɟɫɤɢɯ ɭɫɥɨɜɢɹɯ ɋɢɛɢɪɢ (Ɉɫɨɛɟɧɧɨɫɬɢ ɷɩɢɡɨɨɬɨɥɨɝɢɢ, ɤɥɢɧɢɱɟɫɤɨɝɨ ɩɪɨɹɜɥɟɧɢɹ, ɩɚɬɨɝɟɧɟɡ, ɞɢɚɝɧɨɫɬɢɤɚ, ɦɟɪɵ ɩɪɨɮɢɥɚɤɬɢɤɢ ɢ ɛɨɪɶɛɵ): Ɇɟɬɨɞɢɱɟɫɤɢɟ ɪɟɤɨɦɟɧɞɚɰɢɢ / ɊȺɋɏɇ ɋɢɛ. ɨɬɞ-ɧɢɟ, ȼɇɂɂɉɈ, ɂɗȼɋɢȾȼ,. – Ȼɚɪɧɚɭɥ: Ⱥɡ Ȼɭɤɚ, 2003.- 79 ɫ.
A.V. Dushkin et al. The Complex Worid of Polysaccharides, ed. By Dr. D.N. Karunaratn, Publisher: In Tech.,
2012, 573-602.
1.
2.
3.
4.
ɍȾɄ 619:616.995.1
ɗɉɂɁɈɈɌɈɅɈȽɂə ɅəɊȼȺɅɖɇɈȽɈ ɗɏɂɇɈɄɈɏɄɈɁȺ
ȼȿɊȻɅɘȾɈȼ ȼ ɍɋɅɈȼɂəɏ ɘȽɈ-ɁȺɉȺȾȺ ɄȺɁȺɏɋɌȺɇȺ
ɄȿɇɀȿȻȺȿȼ ɋ.Ⱥ., ɂȻɊȺȽɂɆɈȼ Ⱦ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɪɢɫɨɜɨɞɫɬɜɚ ɢɦ. ɂ.ɀɚɯɚɟɜɚ»,
ɝ. Ʉɵɡɵɥɨɪɞɚ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, pniiaesx@mail.ru
ȼ Ʉɚɡɚɯɫɬɚɧɟ ɧɟɫɦɨɬɪɹ ɧɚ ɨɬɧɨɫɢɬɟɥɶɧɨ ɯɨɪɨɲɭɸ ɜ ɢɡɭɱɟɧɧɨɫɬɶ ɜɨɩɪɨɫɨɜ ɛɢɨɥɨɝɢɢ, ɷɩɢɡɨɨɬɨɥɨɝɢɢ, ɷɯɢɧɨɤɨɤɤɨɡɚ, ɧɟɤɨɬɨɪɵɟ ɜɚɠɧɵɟ ɜɨɩɪɨɫɵ, ɢɦɟɸɳɢɟ ɩɪɚɤɬɢɱɟɫɤɢɟ ɡɧɚɱɟɧɢɟ, ɟɳɟ ɧɟ ɛɵɥɢ
ɞɨɫɬɚɬɨɱɧɨ ɪɚɫɤɪɵɬɵ. Ɍɚɤ, ɧɚ ɸɝɟ-ɡɚɩɚɞɟ Ʉɚɡɚɯɫɬɚɧɚ, ɜ ɫɜɹɡɢ ɫɨ ɫɜɨɟɨɛɪɚɡɢɟɦ ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɣ ɢ ɬɚɛɭɧɧɨɝɨ ɜɟɪɛɥɸɞɨɜɨɞɫɬɜɚ, ɫɥɚɛɨ ɢɡɭɱɟɧɚ ɜɨɩɪɨɫɵ ɷɩɢɡɨɨɬɨɥɨɝɢɢ ɷɯɢɧɨɤɨɤɤɨɡɚ, ɜ ɱɚɫɬɧɨɫɬɢ, ɤɚɫɚɸɳɢɟɫɹ ɮɚɤɬɨɪɨɜ ɩɭɬɟɣ ɢ ɫɟɡɨɧɨɜ ɡɚɪɚɠɟɧɢɹ ɷɯɢɧɨɤɨɤɤɚɦɢ ɨɤɨɧɱɚɬɟɥɶɧɵɯ ɢ ɩɪɨɦɟɠɭɬɨɱɧɵɯ ɯɨɡɹɟɜ ɩɚɪɚɡɢɬɚ.
Ɂɚ ɩɨɫɥɟɞɧɢɟ 10 ɥɟɬ (2005–2014 ɝɝ.) ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɥɹɪɜɚɥɶɧɨɝɨ ɷɯɢɧɨɤɨɤɤɨɡɚ ɜɟɪɛɥɸɞɨɜ ɜ
ɨɛɥɚɫɬɢ ɦɵ ɢɡɭɱɚɥɢ ɩɭɬɟɦ ɢɫɫɥɟɞɨɜɚɧɢɹ ɜɧɭɬɪɟɧɧɢɯ ɨɪɝɚɧɨɜ ɭɛɨɣɧɵɯ ɠɢɜɨɬɧɵɯ (ɩɟɱɟɧɶ, ɥɟɝɤɢɟ, ɫɟɪɞɰɟ, ɫɟɥɟɡɟɧɤɚ, ɩɨɱɤɢ) ɧɚ ɢɯ ɩɨɪɚɠɟɧɧɨɫɬɶ ɷɯɢɧɨɤɨɤɤɚɦɢ, ɦɟɬɨɞɚɦɢ, ɪɟɝɥɚɦɟɧɬɢɪɨɜɚɧɧɵɦɢ «ɉɪɚɜɢɥɚɦɢ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɨɫɦɨɬɪɚ ɭɛɨɣɧɵɯ ɠɢɜɨɬɧɵɯ» (ɩɪɢɤɚɡ Ɇɋɏ ɊɄ ɡɚ ʋ 351 ɨɬ
31.10.2002 ɝ.). ɉɪɢ ɷɬɨɦ ɭɱɢɬɵɜɚɥɢ ɜɨɡɪɚɫɬ, ɞɚɬɭ ɢ ɩɪɢɧɚɞɥɟɠɧɨɫɬɶ ɭɛɨɣɧɵɯ ɠɢɜɨɬɧɵɯ.
Ɂɚɪɚɠɟɧɧɨɫɬɶ ɷɯɢɧɨɤɨɤɤɚɦɢ ɢ ɞɪɭɝɢɦɢ ɬɟɧɢɢɞɚɦɢ (ɦɭɥɶɬɢɰɟɩɫɵ, ɬɟɧɢɢ ɝɢɞɚɬɢɝɟɧɧɵɟ) ɫɨɛɚɤ
ɨɩɪɟɞɟɥɹɥɢ ɦɟɬɨɞɨɦ ɞɢɚɝɧɨɫɬɢɱɟɫɤɨɣ ɞɟɝɟɥɶɦɢɧɬɢɡɚɰɢɢ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɚɪɨɤɨɥɢɧɚ ɛɪɨɦɢɫɬɨɜɨɞɨɪɨɞɧɨɝɨ, ɫɨɝɥɚɫɧɨ ɢɧɫɬɪɭɤɰɢɢ ɢ ɩɨɥɧɵɦ ɝɟɥɶɦɢɧɬɨɥɨɝɢɱɟɫɤɢɦ ɜɫɤɪɵɬɢɟɦ ɬɨɧɤɨɝɨ ɤɢɲɟɱɧɢɤɚ
ɩɨ Ʉ.ɂ. ɋɤɪɹɛɢɧɭ (1928).
ɇɚ ɸɝɟ-ɡɚɩɚɞɟ Ʉɚɡɚɯɫɬɚɧɚ, ɝɞɟ ɪɚɫɩɨɥɨɠɟɧɵ ɩɪɟɢɦɭɳɟɫɬɜɟɧɧɨ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɟ ɯɨɡɹɣɫɬɜɚ
Ʉɵɡɵɥɨɪɞɢɧɫɤɨɣ ɨɛɥɚɫɬɢ, ɷɯɢɧɨɤɨɤɤɨɡ ɞɨɜɨɥɶɧɨ ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧ ɫɪɟɞɢ ɨɜɟɰ, ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɜɟɪɛɥɸɞɨɜ ɢ ɫɨɛɚɤ. ȼ ɪɟɡɭɥɶɬɚɬɟ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢɡ 421 ɜɟɪɛɥɸɞɚ ɭ 180 (42,75 %)
ɜɵɹɜɥɟɧɵ ɥɹɪɜɚɥɶɧɵɣ ɷɯɢɧɨɤɨɤɤɨɡ. ɍ ɜɟɪɛɥɸɞɨɜ ɧɚɢɛɨɥɟɟ ɜɵɫɨɤɢɣ ɭɪɨɜɟɧɶ ɢɧɜɚɡɢɢ ɧɚɛɥɸɞɚɥɫɹ
ɜ ɸɝɨ-ɜɨɫɬɨɱɧɵɯ ɪɚɣɨɧɚɯ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɜ əɧɵɤɭɪɝɚɧɫɤɨɦ – 45,7 % ɢ ɒɢɟɥɢɣɫɤɨɦ – 65,6 %).
ȼ ɧɚɩɪɚɜɥɟɧɢɢ ɤ ɫɟɜɟɪɭ-ɡɚɩɚɞɭ ɨɛɥɚɫɬɢ ɷɬɨɬ ɩɨɤɚɡɚɬɟɥɶ ɡɚɦɟɬɧɨ ɫɧɢɠɚɥɫɹ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɜ
Ʉɚɡɚɥɢɧɫɤɨɦ – 9,11 ɢ ɜ Ⱥɪɚɥɶɫɤɨɦ – 10,5 %). Ɂɨɧɚɥɶɧɨɫɬɶ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢɧɜɚɡɢɢ ɭ ɨɜɟɰ ɢ ɭ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɛɵɥɚ ɚɧɚɥɨɝɢɱɧɚ ɬɚɤɨɜɨɣ ɤɚɤ ɭ ɜɟɪɛɥɸɞɨɜ, ɧɨ ɗɂ ɭ ɨɜɟɰ ɛɵɥɚ 2 ɪɚɡɚ
ɧɢɠɟ (21,06 %) ɢ 5 ɪɚɡ ɧɢɠɟ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ (8,07 %). ȼɵɫɨɤɚɹ ɗɂ ɭ ɜɟɪɛɥɸɞɨɜ, ɤɚɤ
ɦɵ ɫɱɢɬɚɟɦ, ɫɜɹɡɚɧɚ ɛɨɥɶɲɨɣ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶɸ ɠɢɡɧɢ, ɫɥɟɞɨɜɚɬɟɥɶɧɨ, ɜɵɫɨɤɨɣ ɜɟɪɨɹɬɧɨɫɬɶɸ
ɧɟɨɞɧɨɤɪɚɬɧɨɝɨ ɤɨɧɬɚɤɬɚ ɫ ɢɧɜɚɡɢɨɧɧɵɦ ɧɚɱɚɥɨɦ.
246
ȼɨɡɪɚɫɬɧɚɹ ɞɢɧɚɦɢɤɚ ɡɚɪɚɠɟɧɧɨɫɬɢ ɨɜɟɰ, ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɢ ɜɟɪɛɥɸɞɨɜ ɥɹɪɜɚɥɶɧɵɦ
ɷɯɢɧɨɤɨɤɤɨɡɨɦ ɜɨ ɦɧɨɝɨɦ ɨɞɧɨɬɢɩɧɵ.
ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ ɥɹɪɜɚɥɶɧɨɝɨ ɷɯɢɧɨɤɨɤɤɨɡɚ ɭ ɜɟɪɛɥɸɞɨɜ ɧɚɪɚɫɬɚɟɬ ɫ ɭɜɟɥɢɱɟɧɢɟɦ ɜɨɡɪɚɫɬɚ ɠɢɜɨɬɧɵɯ. (Ɇɨɥɨɞɧɹɤ ɞɨ 2 ɥɟɬ ɡɚɪɚɠɟɧɵ ɧɚ 27,9 %, ɚ ɜɟɪɛɥɸɞɵ ɫɬɚɪɲɟ 7 ɥɟɬ – ɧɚ 50 %).
ɂɧɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ ɬɚɤɠɟ ɡɚɜɢɫɟɥɚ ɨɬ ɜɨɡɪɚɫɬɚ ɠɢɜɨɬɧɵɯ. ɍ ɦɨɥɨɞɧɹɤɚ ɞɨ 2 ɥɟɬ ɩɪɟɨɛɥɚɞɚɥɚ ɫɥɚɛɚɹ ɢɧɬɟɧɫɢɜɧɨɫɬɶ (58,3 %) ɢ ɨɬɫɭɬɫɬɜɨɜɚɥɚ ɜɵɫɨɤɚɹ ɢɧɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ (0 %), ɬɨɝɞɚ
ɤɚɤ ɭ ɜɟɪɛɥɸɞɨɜ ɫɬɚɪɲɟ 7 ɥɟɬ – ɛɵɥɚ ɧɚɦɧɨɝɨ ɛɨɥɶɲɟ ɜɵɫɨɤɚɹ ɫɬɟɩɟɧɶ ɢɧɬɟɧɫɢɜɧɨɫɬɢ ɢ ɨɧɢ ɛɵɥɢ
ɜ ɩɪɟɞɟɥɚɯ 69,2 %.
ɂɂ ɭ ɨɜɟɰ ɛɵɥɚ ɚɧɚɥɨɝɢɱɧɚ ɬɚɤɨɜɨɣ ɤɚɤ ɭ ɜɟɪɛɥɸɞɨɜ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 17,9 % ɢ 52,7 %) ɜ ɫɪɟɞɧɟɦ.
ɍ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɟɨɛɥɚɞɚɥɚ ɫɥɚɛɚɹ ɢ ɫɪɟɞɧɹɹ ɫɬɟɩɟɧɶ ɩɨɪɚɠɟɧɢɹ ɩɚɪɢɧɯɢɦɚɬɨɡɧɵɯ
ɨɪɝɚɧɨɜ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 51,2 % ɢ 29,9 %) ɜ ɫɪɟɞɧɟɦ.
ɍ ɜɟɪɛɥɸɞɨɜ ɢ ɨɜɟɰ ɢɧɬɟɧɫɢɜɧɟɟ ɢ ɱɚɳɟ ɩɨɪɚɠɚɥɢɫɶ ɩɟɱɟɧɶ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 48,8 % ɢ 56,1 %),
ɪɟɠɟ ɥɟɝɤɢɟ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 27,2 % ɢ 17,9 %). Ɉɞɧɨɜɪɟɦɟɧɧɨɟ ɩɨɪɚɠɟɧɢɟ ɩɟɱɟɧɢ ɢ ɥɟɝɤɢɯ ɭ ɨɛɨɢɯ ɜɢɞɨɜ ɠɢɜɨɬɧɵɯ ɜɫɬɪɟɱɚɥɢɫɶ ɜ ɤɚɠɞɨɦ ɱɟɬɜɟɪɬɨɦ ɫɥɭɱɚɟ, ɚ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, – ɧɚɨɛɨɪɨɬ, ɱɚɫɬɨ ɩɨɪɚɠɚɥɢɫɶ ɥɟɝɤɢɟ (46,4 %), ɧɟɠɟɥɢ ɩɟɱɟɧɶ (27,8 %).
Ⱥɧɚɥɢɡ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɥɹɪɜɨɰɢɫɬ ɷɯɢɧɨɤɨɤɤɨɜ, ɢɦɟɸɳɢɟ ɷɩɢɡɨɨɬɨɥɨɝɢɱɟɫɤɨɟ
ɡɧɚɱɟɧɢɟ, ɩɨɤɚɡɚɥ, ɱɬɨ ɭ ɜɟɪɛɥɸɞɨɜ ɫ ɭɜɟɥɢɱɟɧɢɟɦ ɜɨɡɪɚɫɬɚ ɭɜɟɥɢɱɢɜɚɟɬɫɹ ɢ ɤɨɥɢɱɟɫɬɜɨ ɮɟɪɬɢɥɶɧɵɯ ɥɹɪɜɨɰɢɫɬ (8,3 % ɭ ɦɨɥɨɞɧɹɤɚ ɞɨ ɞɜɭɯ ɥɟɬ, ɞɨ 76,9 % ɭ ɠɢɜɨɬɧɵɯ ɫɬɚɪɲɟ 7 ɥɟɬ). Ɉɞɧɨɜɪɟɦɟɧɧɨ
ɧɚɪɚɫɬɚɟɬ ɤɨɥɢɱɟɫɬɜɨ ɠɢɡɧɟɫɩɨɫɨɛɧɵɯ ɩɪɨɬɨɫɤɟɥɟɤɫɨɜ ɜ ɥɹɪɜɨɰɢɫɬɚɯ ɫ 19,7 % ɞɨ 83,7 %.
ɍ ɨɜɟɰ ɱɢɫɥɨ ɰɟɮɚɥɨɰɢɫɬ ɢ ɚɰɟɮɚɥɨɰɢɫɬ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɢɯ ɜɨɡɪɚɫɬɚ ɛɵɥɚ ɚɧɚɥɨɝɢɱɧɚ ɬɚɤɨɜɨɣ ɭ ɜɟɪɛɥɸɞɨɜ, ɧɨ ɤɨɥɢɱɟɫɬɜɨ ɮɟɪɬɢɥɶɧɵɯ ɰɢɫɬ ɛɵɥɨ ɧɚɦɧɨɝɨ ɦɟɧɶɲɟ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 0 % ɭ
ɹɝɧɹɬ ɞɨ ɝɨɞɚ ɢ ɭ ɨɜɟɰ ɫɬɚɪɲɟ 5 ɥɟɬ – 43,8 %).
ȼ ɪɟɡɭɥɶɬɚɬɟ ɪɚɛɨɬ, ɦɵ ɭɫɬɚɧɨɜɢɥɢ, ɱɬɨ ɱɚɫɬɨɬɚ ɜɫɬɪɟɱɚɟɦɨɫɬɢ ɩɥɨɞɨɧɨɫɬɧɵɯ ɥɹɪɜɨɰɢɫɬ, ɢɦɟɸɳɟɟ ɷɩɢɡɨɨɬɨɥɨɝɢɱɟɫɤɨɟ ɡɧɚɱɟɧɢɟ, ɭ ɜɟɪɛɥɸɞɨɜ ɛɵɥɨ ɜ 10 ɪɚɡ ɜɵɲɟ, ɱɟɦ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
(4,5 %). ȿɫɥɢ ɭɱɟɫɬɶ, ɱɬɨ ɝɨɦɨɡɢɝɨɬɧɵɟ ɜɚɪɢɚɧɬɵ E. granulosus ɨɬɧɨɫɢɬɟɥɶɧɨ ɥɟɝɤɨ ɜɨɡɧɢɤɚɸɬ ɢ ɡɚɤɪɟɩɥɹɸɬɫɹ ɧɚɫɥɟɞɫɬɜɟɧɧɨ ɜɫɥɟɞɫɬɜɢɟ ɩɪɢɫɭɳɟɝɨ ɝɟɥɶɦɢɧɬɭ ɤ ɫɚɦɨɨɩɥɨɞɨɬɜɨɪɟɧɢɸ ɜɨ ɜɡɪɨɫɥɨɣ
ɫɬɚɞɢɢ ɢ ɧɟɩɨɥɧɨɣ ɪɟɩɪɨɞɭɤɰɢɢ ɜ ɥɢɱɢɧɨɱɧɨɣ ɫɬɚɞɢɢ, ɢ ɨɧɢ ɢɞɟɧɬɢɮɢɰɢɪɭɸɬɫɹ ɩɨ ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɦ, ɛɢɨɥɨɝɢɱɟɫɤɢɦ, ɢɦɦɭɧɨɥɨɝɢɱɟɫɤɢɦ ɨɫɨɛɟɧɧɨɫɬɹɦ, ɬɨ ɦɨɠɧɨ ɫɤɚɡɚɬɶ, ɱɬɨ ɡɞɟɫɶ, ɜɟɪɨɹɬɧɨ
ɫɭɳɟɫɬɜɭɟɬ ɧɚɪɹɞɭ ɫ «ɨɜɟɱɶɢɦ» ɲɬɚɦɦɨɦ ɢ «ɜɟɪɛɥɸɠɢɣ» ɲɬɚɦɦ, ɷɯɢɧɨɤɨɤɤɚ ɱɬɨ ɹɜɥɹɟɬɫɹ ɩɪɟɞɦɟɬɨɦ ɞɚɥɶɧɟɣɲɟɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ.
Ʉɨɥɢɱɟɫɬɜɨ ɧɚɝɧɨɢɜɲɢɯɫɹ ɢ ɩɟɬɪɢɮɢɰɢɪɨɜɚɧɧɵɯ ɥɹɪɜɨɰɢɫɬ ɷɯɢɧɨɤɨɤɤɨɜ ɭ ɜɟɪɛɥɸɞɨɜ, ɨɜɟɰ ɢ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɚɤɬɢɱɟɫɤɢ ɧɟ ɡɚɜɢɫɟɥɚ ɨɬ ɜɨɡɪɚɫɬɚ ɠɢɜɨɬɧɵɯ.
ɍɪɨɜɟɧɶ ɡɚɪɚɠɟɧɧɨɫɬɢ ɫɨɛɚɤ ɱɚɛɚɧɨɜ ɢ ɜɟɪɛɥɸɞɨɜ ɬɟɧɢɢɞɚɦɢ ɡɚɜɢɫɟɥɚ ɨɬ ɫɟɡɨɧɚ ɝɨɞɚ. ɋɨɛɚɤɢ
ɧɚɢɛɨɥɟɟ ɢɧɬɟɧɫɢɜɧɨ ɡɚɪɚɠɚɥɢɫɶ E. granulosus, M. multiceps ɢ T. hydatigera ɜ ɩɟɪɜɨɦ ɤɜɚɪɬɚɥɟ ɝɨɞɚ
(ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 29,9 %, 7,6 % ɢ 13,7 %), ɨɛɭɫɥɨɜɥɟɧɧɵɟ ɫɪɚɜɧɢɬɟɥɶɧɨ ɛɨɥɶɲɢɦ ɩɚɞɟɠɨɦ ɫɤɨɬɚ
(ɯɨɥɨɞ, ɧɟɯɜɚɬɤɚ ɤɨɪɦɨɜ ɢ ɛɟɪɟɦɟɧɧɨɫɬɢ ɦɚɬɨɤ ɢ ɬ.ɞ.).
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɦɨɠɧɨ ɭɬɜɟɪɠɞɚɬɶ, ɱɬɨ ɡɞɟɫɶ, ɜ ɩɪɢɪɨɞɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɹɯ ɸɝɨ-ɡɚɩɚɞɚ Ʉɚɡɚɯɫɬɚɧɚ (ɠɚɪɤɨɟ, ɫɭɯɨɟ ɥɟɬɨ ɢ ɯɨɥɨɞɧɚɹ, ɫɨ ɫɥɚɛɵɦɢ ɨɫɚɞɤɚɦɢ ɡɢɦɚ) ɩɪɢ ɷɤɫɬɟɧɫɢɜɧɨɟ
ɠɢɜɨɬɧɨɜɨɞɫɬɜɨ ɜ ɫɨɱɟɬɚɧɢɢ ɫ ɞɪɭɝɢɦɢ ɮɚɤɬɨɪɚɦɢ (ɫɥɚɛɚɹ ɪɚɛɨɬɚ ɜɟɬɟɪɢɧɚɪɨɜ ɩɨ ɩɟɪɢɨɞɢɱɟɫɤɨɣ ɞɟɝɟɥɶɦɢɧɬɢɡɚɰɢɢ ɫɥɭɠɟɛɧɵɯ ɫɨɛɚɤ, ɩɨɞɜɨɪɧɵɣ ɭɛɨɣ ɠɢɜɨɬɧɵɯ ɧɚ ɦɹɫɨ, ɧɟ ɫɜɨɟɜɪɟɦɟɧɧɨɟ
ɨɛɟɡɜɪɟɠɢɜɚɧɢɟ ɛɨɟɧɫɤɢɯ ɨɬɯɨɞɨɜ, ɭɬɢɥɢɡɚɰɢɹ ɩɚɜɲɢɯ ɠɢɜɨɬɧɵɯ ɢ ɬ.ɞ.) ɫɩɨɫɨɛɫɬɜɭɟɬ ɚɤɬɢɜɧɨɦɭ
ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɸ ɛɢɨɥɨɝɢɱɟɫɤɢɯ ɰɢɤɥɨɜ «ɫɨɛɚɤɚ – ɜɟɪɛɥɸɞ» ɢ «ɫɨɛɚɤɚ – ɨɜɰɚ», ɨɛɭɫɥɨɜɥɟɧɧɵɟ
ɜɵɫɨɤɨɣ ɮɟɪɬɢɥɶɧɨɫɬɶɸ ɥɹɪɜɨɰɢɫɬ ɢ ɫ ɠɢɡɧɟɫɩɨɫɨɛɧɨɫɬɶɸ ɩɪɨɬɨɫɤɨɥɟɤɫɨɜ ɷɯɢɧɨɤɨɤɤɨɜ ɭ ɜɟɪɛɥɸɞɨɜ (48,8 %) ɢ ɭ ɨɜɟɰ (43,8 %).
ɇɟɨɛɯɨɞɢɦɨ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɜ ɭɫɥɨɜɢɹɯ ɸɝɨ-ɡɚɩɚɞɚ Ʉɚɡɚɯɫɬɚɧɚ ɦɵ ɧɟ ɜɫɬɪɟɱɚɥɢ ɫɩɨɧɬɚɧɧɨ ɡɚɪɚɠɟɧɧɵɯ ɷɯɢɧɨɤɨɤɤɚɦɢ ɥɨɲɚɞɟɣ. Ɋɟɡɭɥɶɬɚɬɚ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɝɨ ɡɚɪɚɠɟɧɢɹ ɥɨɲɚɞɟɣ ɨɧɤɨɫɮɟɪɚɦɢ ɷɯɢɧɨɤɨɤɤɨɜ ɬɚɤɠɟ ɛɵɥ ɨɬɪɢɰɚɬɟɥɶɧɵɦ, ɩɨɷɬɨɦɭ ɢɯ ɪɨɥɶ ɜ ɷɩɢɡɨɨɬɨɥɨɝɢɢ ɷɯɢɧɨɤɨɤɤɨɡɚ ɦɵ
ɢɫɤɥɸɱɢɥɢ.
ɂɫɯɨɞɹ ɢɡ ɨɫɨɛɟɧɧɨɫɬɟɣ ɷɩɢɡɨɨɬɨɥɨɝɢɢ ɷɯɢɧɨɤɨɤɤɨɡɚ ɢ ɬɟɯɧɨɥɨɝɢɢ ɷɤɫɬɟɧɫɢɜɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɪɟɝɢɨɧɚ ɞɟɝɟɥɶɦɢɧɬɢɡɚɰɢɸ ɫɨɛɚɤ ɪɟɤɨɦɟɧɞɭɟɦ ɩɪɨɜɨɞɢɬɶ 4 ɪɚɡɚ ɜ ɝɨɞ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɚɧɬɝɟɥɶɦɢɧɬɢɤɚ ɩɪɚɡɢɤɜɚɧɬɟɥ (ɞɪɨɧɰɢɬ) ɢɥɢ ɚɡɢɧɨɤɫɚ ɜ ɪɟɤɨɦɟɧɞɭɟɦɵɯ ɞɨɡɚɯ ɫ ɨɞɧɨɜɪɟɦɟɧɧɵɦ ɩɪɨɜɟɞɟɧɢɟɦ ɞɪɭɝɢɯ ɩɪɨɬɢɜɨɷɯɢɧɨɤɨɤɤɨɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɢ (ɍɫɢɥɟɧɢɹ ɤɨɧɬɪɨɥɹ ɡɚ ɭɛɨɟɦ ɠɢɜɨɬɧɵɯ,
ɫɨɤɪɚɳɟɧɢɟ ɞɨ ɦɢɧɢɦɭɦɚ ɫɥɭɠɟɛɧɵɯ ɢ ɭɧɢɱɬɨɠɟɧɢɟ ɛɪɨɞɹɱɢɯ ɫɨɛɚɤ, ɩɪɨɫɜɟɬɢɬɟɥɶɧɵɟ ɪɚɛɨɬɵ ɨ
ɝɟɥɶɦɢɧɬɨɡɨɨɧɨɡɚɯ).
247
ɍȾɄ 619:616.98:578.828.11+616.981.42
ȼɅɂəɇɂȿ ȼȺɄɐɂɇȺɐɂɂ ɉɊɈɌɂȼ ȻɊɍɐȿɅɅȬɁȺ
ɇȺ ȽȿɆȺɌɈɅɈȽɂɑȿɋɄɂȿ ɉɈɄȺɁȺɌȿɅɂ ɂ ɌɂɌɊɕ
ɉɊɈɌɂȼɈȼɂɊɍɋɇɕɏ ȺɇɌɂɌȿɅ ɍ ȼɅɄɊɋ-ɂɇɎɂɐɂɊɈȼȺɇɇɕɏ
ɄɈɊɈȼ ȼ ɉɈɋɌȼȺɄɐɂɇȺɅɖɇɕɃ ɉȿɊɂɈȾ
ɅɈȽɂɇɈȼ ɋ.ɂ., 1 ɉɈɁɈɅɈɌɂɇȺ Ⱥ.ɋ.,
2
ȾɂɆɈȼ ɋ.Ʉ., 2 ɄɍɊȿɇɋɄȺə ɇ.ɂ., 2 ɏɊȺɆɐɈȼ ȼ.ȼ.
1
ɇɨɜɨɫɢɛɢɪɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɚɝɪɚɪɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ
2
ɂɧɫɬɢɬɭɬ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɣ ɜɟɬɟɪɢɧɚɪɢɢ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɝɨ ȼɨɫɬɨɤɚ.
E-mail: logsi-nsk@yandex.ru
1
Ɉɛɳɟɢɡɜɟɫɬɧɨ, ɱɬɨ ɜ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɵɣ ɩɟɪɢɨɞ ɭ ɠɢɜɨɬɧɵɯ ɦɨɝɭɬ ɢɡɦɟɧɹɬɶɫɹ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢ ɢɦɦɭɧɨɥɨɝɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ. ɗɬɨ ɩɨɫɥɭɠɢɥɨ ɨɞɧɢɦ ɢɡ ɨɫɧɨɜɚɧɢɣ ɞɥɹ ɫɞɜɢɝɚ ɫɪɨɤɨɜ
ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɠɢɜɨɬɧɵɯ ɧɚ ɢɧɮɟɤɰɢɨɧɧɵɟ ɛɨɥɟɡɧɢ ɜ ɩɟɪɢɨɞ ɩɨɫɥɟ ɩɪɢɦɟɧɟɧɢɹ
ɜɚɤɰɢɧ ɢ ɞɪɭɝɢɯ ɛɢɨɩɪɟɩɚɪɚɬɨɜ. ɂɦɟɸɬɫɹ ɟɞɢɧɢɱɧɵɟ ɪɚɛɨɬɵ ɩɨ ɢɡɭɱɟɧɢɸ ɫɩɟɰɢɮɢɤɢ ɫɟɪɨɥɨɝɢɱɟɫɤɨɣ ɢ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɧɚ ɥɟɣɤɨɡ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɩɟɪɢɨɞ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɪɚɡɧɵɯ ɜɚɤɰɢɧ [1, 2], ɚ ɬɚɤɠɟ ɩɪɢ ɧɚɥɢɱɢɢ ɫɨɩɭɬɫɬɜɭɸɳɢɯ ɛɨɥɟɡɧɟɣ [3].
ɐɟɥɶ ɢɫɫɥɟɞɨɜɚɧɢɣ – ɩɪɨɚɧɚɥɢɡɢɪɨɜɚɬɶ ɢɡɦɟɧɟɧɢɹ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɢ ɬɢɬɪɨɜ ɚɧɬɢɬɟɥ ɤ ɜɢɪɭɫɭ ɥɟɣɤɨɡɚ ɭ ȼɅɄɊɋ-ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɤɨɪɨɜ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɺɡɧɨɣ
ɜɚɤɰɢɧɵ ɢɡ ɲɬ. B. abortus 82 ɢ ɨɩɬɢɦɢɡɢɪɨɜɚɬɶ ɫɪɨɤɢ ɩɪɨɜɟɞɟɧɢɹ ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ
ɧɚ ɥɟɣɤɨɡ ɜ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɵɣ ɩɟɪɢɨɞ.
Ɇɚɬɟɪɢɚɥɵ ɢ ɦɟɬɨɞɵ. ɉɪɨɢɡɜɨɞɫɬɜɟɧɧɵɟ ɷɤɫɩɟɪɢɦɟɧɬɵ ɩɨɫɬɚɜɥɟɧɵ ɜ ɧɟɛɥɚɝɨɩɨɥɭɱɧɨɦ ɩɨ
ɥɟɣɤɨɡɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɯɨɡɹɣɫɬɜɟ – ɁȺɈ «ɋɤɚɥɚ» Ʉɨɥɵɜɚɧɫɤɨɝɨ ɪɚɣɨɧɚ ɇɨɜɨɫɢɛɢɪɫɤɨɣ
ɨɛɥɚɫɬɢ.
Ƚɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɢ ɫɟɪɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ ɥɟɣɤɨɡ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ
ɫɤɨɬɚ ɜ ɪɟɚɤɰɢɢ ɢɦɦɭɧɨɞɢɮɮɭɡɢɢ (ɊɂȾ) ɢ ɢɦɦɭɧɨɮɟɪɦɟɧɬɧɵɦ ɚɧɚɥɢɡɨɦ (ɂɎȺ) ɩɪɨɜɨɞɢɥɢ ɫɨɝɥɚɫɧɨ Ɇɟɬɨɞɢɱɟɫɤɢɦ ɭɤɚɡɚɧɢɹɦ ɩɨ ɞɢɚɝɧɨɫɬɢɤɟ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ [4].
ɂɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɜɟɞɟɧɵ ɧɚ 4-ɯ ɝɪɭɩɩɚɯ ɤɨɪɨɜ 3–4-ɥɟɬɧɟɝɨ ɜɨɡɪɚɫɬɚ ɩɨ 4 ɝɨɥɨɜɵ ɜ ɤɚɠɞɨɣ
ɝɪɭɩɩɟ:
ɫɟɪɨɧɟɝɚɬɢɜɧɵɟ ɤ ɜɢɪɭɫɭ ɥɟɣɤɨɡɚ (ȼɅɄɊɋ) (ɊɂȾ –), ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɟ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬ. ȼ.
abortus 82;
ɫɟɪɨɩɨɡɢɬɢɜɧɵɟ ɤ ȼɅɄɊɋ (ɊɂȾ +), ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɟ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬ. ȼ. abortus 82;
ɫɟɪɨɧɟɝɚɬɢɜɧɵɟ ɤ ȼɅɄɊɋ (ɊɂȾ –), ɧɟ ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɟ ɤɨɧɬɪɨɥɶɧɵɟ;
ɫɟɪɨɩɨɡɢɬɢɜɧɵɟ ɤ ȼɅɄɊɋ (ɊɂȾ +), ɧɟ ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɟ ɤɨɧɬɪɨɥɶɧɵɟ.
Ɋɚɧɟɟ ɤɨɪɨɜɵ ɛɵɥɢ ɜ ɩɥɚɧɨɜɨɦ ɩɨɪɹɞɤɟ ɩɪɢɜɢɬɵ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɺɡɚ, ɧɚɱɢɧɚɹ ɫ 4–5-ɦɟɫɹɱɧɨɝɨ
ɜɨɡɪɚɫɬɚ.
Ʉɨɪɨɜ ɢɫɫɥɟɞɨɜɚɥɢ ɜ ɞɢɧɚɦɢɤɟ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɦ ɦɟɬɨɞɨɦ 5-ɤɪɚɬɧɨ: ɞɨ ɜɚɤɰɢɧɚɰɢɢ, ɱɟɪɟɡ 1, 3,
7 ɢ 15 ɞɧɟɣ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ; ɫɟɪɨɥɨɝɢɱɟɫɤɢɦɢ ɦɟɬɨɞɚɦɢ ɜ ɊɂȾ ɢ ɂɎȺ 7-ɤɪɚɬɧɨ: ɞɨ ɜɚɤɰɢɧɚɰɢɢ,
ɱɟɪɟɡ 1, 3, 7, 15, 37 ɢ 64 ɞɧɹ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ.
ɉɟɪɟɞ ɢɦɦɭɧɢɡɚɰɢɟɣ ɢɫɩɨɥɶɡɭɟɦɭɸ ɜɚɤɰɢɧɭ ɩɪɨɜɟɪɢɥɢ ɧɚ ɠɢɡɧɟɫɩɨɫɨɛɧɨɫɬɶ ɢ ɚɧɬɢɝɟɧɧɭɸ ɫɬɪɭɤɬɭɪɭ (ɤɨɥɢɱɟɫɬɜɟɧɧɵɣ ɢ ɤɚɱɟɫɬɜɟɧɧɵɣ ɫɨɫɬɚɜ ɩɨɩɭɥɹɰɢɣ) ɦɟɬɨɞɚɦɢ ɨɤɪɚɫɤɢ ɩɨ ɍɚɣɬȼɢɥɫɨɧɭ, ɪɟɚɤɰɢɟɣ ɚɝɝɥɸɬɢɧɚɰɢɢ ɫ S- ɢ R-ɫɵɜɨɪɨɬɤɚɦɢ, ɪɟɚɤɰɢɟɣ ɫ ɬɪɢɩɚɮɥɚɜɢɧɨɦ, ɪɟɚɤɰɢɟɣ ɬɟɪɦɨɚɝɝɥɸɬɢɧɚɰɢɢ [5].
Ƚɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ. ɍ ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ȼɅɄɊɋ (ɊɂȾ –) ɤɨɪɨɜ 1-ɣ ɝɪɭɩɩɵ ɩɨɫɥɟ
ɢɦɦɭɧɢɡɚɰɢɢ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɺɡɚ ɧɚ 1–3-ɣ ɞɧɢ ɨɬɦɟɱɟɧɨ ɬɟɧɞɟɧɰɢɹ ɤ ɭɜɟɥɢɱɟɧɢɸ ɤɨɥɢɱɟɫɬɜɚ ɥɟɣɤɨɰɢɬɨɜ (ɞɨ ɜɚɤɰɢɧɚɰɢɢ 6,1 ± 0,97 ɯ109/ɥ; ɧɚ 3-ɣ ɞɟɧɶ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ 9,6 ± 1,61 ɯ109/ɥ), ɧɟɣɬɪɨɮɢɥɢɹ ɜɨɫɩɚɥɢɬɟɥɶɧɨɝɨ ɯɚɪɚɤɬɟɪɚ ɢ ɧɟɡɧɚɱɢɬɟɥɶɧɨɟ ɩɨɜɵɲɟɧɢɟ ɚɛɫɨɥɸɬɧɨɝɨ ɫɨɞɟɪɠɚɧɢɹ ɥɢɦɮɨɰɢɬɨɜ ɩɪɢ ɫɧɢɠɟɧɢɢ ɢɯ ɨɬɧɨɫɢɬɟɥɶɧɨɝɨ ɭɪɨɜɧɹ ɜ ɥɟɣɤɨɮɨɪɦɭɥɟ (ɞɨ ɜɚɤɰɢɧɚɰɢɢ 67,1 ± 1,59 %; ɧɚ
3-ɣ ɞɟɧɶ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ 55,4 ± 3,14 %). ɂɡɦɟɧɟɧɢɹ ɛɵɥɢ ɧɚɢɛɨɥɟɟ ɜɵɪɚɠɟɧɵ ɧɚ 3-ɣ ɞɟɧɶ ɩɨɫɥɟ
ɢɦɦɭɧɢɡɚɰɢɢ, ɛɵɥɢ ɫɬɚɬɢɫɬɢɱɟɫɤɢ ɧɟɞɨɫɬɨɜɟɪɧɵ ɢ ɧɟɫɪɚɜɧɢɦɨ ɛɨɥɟɟ ɫɝɥɚɠɟɧɵ, ɱɟɦ ɭ ɬɺɥɨɤ ɩɨɫɥɟ ɩɟɪɜɨɣ ɜɚɤɰɢɧɚɰɢɢ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɺɡɚ ɜ ɚɧɚɥɨɝɢɱɧɵɯ ɨɩɵɬɚɯ, ɩɪɨɜɟɞɺɧɧɵɯ ɧɚɦɢ ɪɚɧɟɟ [6].
Ⱥɧɚɥɨɝɢɱɧɵɟ, ɧɨ ɛɨɥɟɟ ɜɵɪɚɠɟɧɧɵɟ, ɢɡɦɟɧɟɧɢɹ ɜ ɥɟɣɤɨɮɨɪɦɭɥɟ ɛɵɥɢ ɨɬɦɟɱɟɧɵ ɭ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ (ɊɂȾ +) ɤɨɪɨɜ 2-ɣ ɝɪɭɩɩɵ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɺɡɚ ɭɠɟ ɧɚ 1-ɣ ɞɟɧɶ
ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɩɪɟɩɚɪɚɬɚ, ɩɪɢ ɷɬɨɦ ɫɥɟɞɭɟɬ ɜɵɞɟɥɢɬɶ ɞɨɫɬɨɜɟɪɧɨ ɛɨɥɟɟ ɜɵɫɨɤɢɣ ɥɟɣɤɨɰɢɬɨɡ ɩɨ
ɫɪɚɜɧɟɧɢɸ ɫ ɬɚɤɨɜɵɦ ɭ ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɤɨɪɨɜ 1-ɣ ɝɪɭɩɩɵ (13,7 ± 1,41 ɢ 8,9 ± 1,02 ɯ109/ɥ,
Ɋ < 0,05). Ⱥ ɤ 3-ɦɭ ɞɧɸ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɭ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ (ɊɂȾ +) ɤɨɪɨɜ ɫɪɟɞɧɟɟ
248
ɤɨɥɢɱɟɫɬɜɨ ɥɢɦɮɨɰɢɬɨɜ ɩɪɢɛɥɢɠɚɥɨɫɶ ɤ «ɤɪɢɬɢɱɟɫɤɨɦɭ», ɛɥɢɡɤɨɦɭ ɤ ɩɨɞɨɡɪɟɧɢɸ ɧɚ ɡɚɛɨɥɟɜɚɧɢɟ
ɥɟɣɤɨɡɨɦ – 8,0 ± 0,69 ɯ109/ɥ, ɡɧɚɱɢɬɟɥɶɧɨ ɩɪɟɜɵɲɚɹ ɬɚɤɨɜɨɟ ɭ ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɤɨɪɨɜ 1ɣ ɝɪɭɩɩɵ (5,5 ± 0,77 ɯ109/ɥ). ɂɡ 4-ɯ ɩɨɞɨɩɵɬɧɵɯ ɠɢɜɨɬɧɵɯ 2-ɣ ɝɪɭɩɩɵ ɭ ɨɞɧɨɣ ɤɨɪɨɜɵ (ʋ371) ɜ
1-ɣ ɞɟɧɶ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɨɬɦɟɱɟɧɚ ɤɚɪɬɢɧɚ ɤɪɨɜɢ, ɯɚɪɚɤɬɟɪɧɚɹ ɞɥɹ ɥɟɣɤɨɡɚ, ɩɪɢ ɚɛɫɨɥɸɬɧɨɦ
ɥɢɦɮɨɰɢɬɨɡɟ 10,1 ɯ109/ɥ ɢ ɥɟɣɤɨɰɢɬɨɡɟ 17,2 ɯ109/ɥ. ɍ ɤɨɪɨɜɵ ʋ370 ɨɬɧɨɫɢɬɟɥɶɧɵɣ ɥɟɣɤɨɰɢɬɨɡ ɧɚ
3-ɣ ɞɟɧɶ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɩɪɟɩɚɪɚɬɚ ɞɨɯɨɞɢɥ ɞɨ 83,5 % ɩɪɢ ɥɟɣɤɨɰɢɬɨɡɟ 10,4 ɯ109/ɥ. Ɉɞɧɚɤɨ ɧɚ 7-ɣ
ɢ 15-ɣ ɞɧɢ ɢɫɫɥɟɞɨɜɚɧɢɣ ɤɚɪɬɢɧɚ ɤɪɨɜɢ ɭ ɤɨɪɨɜ ɧɨɪɦɚɥɢɡɨɜɚɥɚɫɶ ɞɨ ɜɟɪɯɧɢɯ ɝɪɚɧɢɰ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ.
ɍ ɧɟ ɢɦɦɭɧɢɡɢɪɨɜɚɧɧɵɯ ɤɨɪɨɜ ɞɜɭɯ ɤɨɧɬɪɨɥɶɧɵɯ 3-ɣ ɢ 4-ɣ ɝɪɭɩɩ ɨɬɦɟɱɟɧɵ ɧɟɡɧɚɱɢɬɟɥɶɧɵɟ
ɪɚɡɧɨɧɚɩɪɚɜɥɟɧɧɵɟ ɤɨɥɟɛɚɧɢɹ ɩɨɤɚɡɚɬɟɥɟɣ ɜ ɩɪɟɞɟɥɚɯ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ. ɉɪɢ ɷɬɨɦ ɭ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɤɨɪɨɜ 4-ɣ ɝɪɭɩɩɵ ɚɛɫɨɥɸɬɧɨɟ ɫɨɞɟɪɠɚɧɢɟ ɥɟɣɤɨɰɢɬɨɜ ɢ ɥɢɦɮɨɰɢɬɨɜ ɛɵɥɨ
ɡɚɤɨɧɨɦɟɪɧɨ ɧɟɫɤɨɥɶɤɨ ɜɵɲɟ, ɱɟɦ ɭ ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɠɢɜɨɬɧɵɯ 3-ɣ ɝɪɭɩɩɵ.
ɋɟɪɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ. ɍ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɤɨɪɨɜ 2-ɣ ɝɪɭɩɩɵ, ɩɪɢɜɢɬɵɯ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬ. B. abortus 82, ɨɬɦɟɱɟɧɚ ɬɟɧɞɟɧɰɢɹ ɫɧɢɠɟɧɢɹ ɬɢɬɪɨɜ ɚɧɬɢɬɟɥ ɤ ȼɅɄɊɋ ɜ ɊɂȾ ɧɚ 3-ɣ
ɞɟɧɶ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ ɫ 3,5 ± 1,19 log2 ɞɨ 2,8 ± 1,18 log2 (ɭɪɨɜɟɧɶ ɡɧɚɱɢɦɨɫɬɢ ɪɚɡɥɢɱɢɣ ɧɟɞɨɫɬɨɜɟɪɟɧ, P > 0,05). ɉɪɚɤɬɢɱɟɫɤɢ ɩɨɥɧɨɟ ɜɨɫɫɬɚɧɨɜɥɟɧɢɟ ɬɢɬɪɨɜ ɚɧɬɢɬɟɥ ɭ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ
ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɯ ɤɨɪɨɜ ɧɚɛɥɸɞɚɥɢ ɧɚ 15–37-ɣ ɞɧɢ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ.
ɍ ɧɟ ɜɚɤɰɢɧɢɪɨɜɚɧɧɵɯ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɤɨɪɨɜ 4-ɣ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɬɢɬɪɵ ɚɧɬɢɬɟɥ
ɤ ȼɅɄɊɋ ɜ ɊɂȾ ɤɨɥɟɛɚɥɢɫɶ ɜ ɫɪɟɞɧɟɦ ɩɨ ɝɪɭɩɩɟ ɜ ɩɪɟɞɟɥɚɯ 3,0–3,5 log2. Ʉ 64-ɦɭ ɞɧɸ ɧɚɛɥɸɞɟɧɢɣ
ɬɢɬɪɵ ɚɧɬɢɬɟɥ ɭ ɤɨɪɨɜ ɨɛɟɢɯ ɝɪɭɩɩ ɭɜɟɥɢɱɢɥɢɫɶ ɞɨ 3,8 ± 1,49 log2 ɢ 3,8 ± 1,03 log2 ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ.
ɉɨ-ɜɢɞɢɦɨɦɭ, ɷɬɨ ɦɨɝɥɨ ɨɬɪɚɠɚɬɶ ɫɟɡɨɧɧɵɟ ɤɨɥɟɛɚɧɢɹ ɜ ɛɥɚɝɨɩɪɢɹɬɧɵɣ ɥɟɬɧɢɣ ɩɟɪɢɨɞ (ɨɩɵɬ ɧɚɱɚɬ 25 ɚɩɪɟɥɹ, ɚ 64-ɣ ɞɟɧɶ ɢɫɫɥɟɞɨɜɚɧɢɣ – 28 ɢɸɧɹ).
ɂɫɫɥɟɞɨɜɚɧɢɟ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɤɨɪɨɜ 2-ɣ ɢ 4-ɣ ɝɪɭɩɩ ɜ ɂɎȺ ɞɥɹ ɜɵɹɜɥɟɧɢɹ ɚɧɬɢɬɟɥ ɤ
ɜɢɪɭɫɭ ɥɟɣɤɨɡɚ ɩɨɞɬɜɟɪɞɢɥɨ ɜɫɟ ɫɥɭɱɚɢ ɢɯ ɪɟɚɝɢɪɨɜɚɧɢɹ ɜ ɊɂȾ.
ɍ ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɢɦɦɭɧɢɡɢɪɨɜɚɧɧɵɯ ɜɚɤɰɢɧɨɣ B. abortus 82 ɤɨɪɨɜ 1-ɣ ɝɪɭɩɩɵ ɢ
ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ȼɅɄɊɋ ɧɟ ɢɦɦɭɧɢɡɢɪɨɜɚɧɧɵɯ ɤɨɪɨɜ 3-ɣ ɝɪɭɩɩɵ ɫɥɭɱɚɟɜ ɧɟɫɩɟɰɢɮɢɱɟɫɤɨɝɨ ɪɟɚɝɢɪɨɜɚɧɢɹ ɜ ɊɂȾ ɢ ɂɎȺ ɧɟ ɨɬɦɟɱɟɧɨ.
Ɉɬɦɟɱɟɧɧɚɹ ɬɟɧɞɟɧɰɢɹ ɫɧɢɠɟɧɢɹ ɬɢɬɪɨɜ ɩɪɨɬɢɜɨɜɢɪɭɫɧɵɯ ɚɧɬɢɬɟɥ ɫɨɝɥɚɫɭɟɬɫɹ ɫ ɪɟɡɭɥɶɬɚɬɚɦɢ
ɢɫɫɥɟɞɨɜɚɧɢɣ ɞɪɭɝɢɯ ɚɜɬɨɪɨɜ, ɜɵɹɜɢɜɲɢɯ ɢɦɦɭɧɨɥɨɝɢɱɟɫɤɢɟ ɧɚɪɭɲɟɧɢɹ ɭ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ ɬɟɥɹɬ ɩɨɫɥɟ ɢɯ ɢɦɦɭɧɢɡɚɰɢɢ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɨɣ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬɚɦɦɚ
B. abortus 82 [7, 8].
ȼɵɜɨɞɵ
ɍ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ɜɢɪɭɫɭ ɥɟɣɤɨɡɚ ɤɨɪɨɜ ɧɚ 1–3-ɣ ɞɧɢ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɨɣ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬ. ȼ. abortus 82 ɧɚɛɥɸɞɚɥɫɹ ɥɟɣɤɨɰɢɬɨɡ, ɧɟɣɬɪɨɮɢɥɢɹ ɜɨɫɩɚɥɢɬɟɥɶɧɨɝɨ ɯɚɪɚɤɬɟɪɚ ɢ ɥɢɦɮɨɰɢɬɨɡ. ȼ ɷɬɨɬ ɜɪɟɦɟɧɧɨɣ ɩɪɨɦɟɠɭɬɨɤ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɨɝɨ ɩɟɪɢɨɞɚ ɨɬɦɟɱɟɧɵ ɟɞɢɧɢɱɧɵɟ
ɫɥɭɱɚɢ ɫɯɨɞɫɬɜɚ ɥɟɣɤɨɮɨɪɦɭɥɵ ɭ ɤɨɪɨɜ ɫ ɤɚɪɬɢɧɨɣ ɤɪɨɜɢ, ɯɚɪɚɤɬɟɪɧɨɣ ɞɥɹ ɧɚɱɚɥɶɧɨɣ ɫɬɚɞɢɢ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɧɨɝɨ ɩɪɨɰɟɫɫɚ. ɇɚ 7-ɣ ɢ 15-ɣ ɞɧɢ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɨɝɨ ɩɟɪɢɨɞɚ ɤɚɪɬɢɧɚ ɤɪɨɜɢ ɭ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɜɢɪɭɫɨɦ ɥɟɣɤɨɡɚ ɤɨɪɨɜ ɧɨɪɦɚɥɢɡɨɜɚɥɚɫɶ ɞɨ ɜɟɪɯɧɢɯ ɝɪɚɧɢɰ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ.
ɍ ɫɟɪɨɧɟɝɚɬɢɜɧɵɯ ɤ ɜɢɪɭɫɭ ɥɟɣɤɨɡɚ ɤɨɪɨɜ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɨɣ ɜɚɤɰɢɧɨɣ
ɢɡ ɲɬ. ȼ. abortus 82 ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɡɦɟɧɟɧɢɹ ɢɦɟɸɬ ɛɨɥɟɟ ɫɝɥɚɠɟɧɧɵɣ ɯɚɪɚɤɬɟɪ ɜ ɩɪɟɞɟɥɚɯ
ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ.
ɇɚ 1–8-ɣ ɞɧɢ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɺɡɧɨɣ ɜɚɤɰɢɧɵ ɭ ɫɟɪɨɩɨɡɢɬɢɜɧɵɯ ɤ ɜɢɪɭɫɭ ɥɟɣɤɨɡɚ ɤɨɪɨɜ ɨɬɦɟɱɟɧɚ ɬɟɧɞɟɧɰɢɹ ɫɧɢɠɟɧɢɹ ɬɢɬɪɨɜ ɩɪɨɬɢɜɨɜɢɪɭɫɧɵɯ ɚɧɬɢɬɟɥ ɜ ɊɂȾ. ɋɥɭɱɚɟɜ ɩɨɥɧɨɝɨ
«ɢɫɱɟɡɧɨɜɟɧɢɹ» ɪɟɚɤɰɢɣ ɜ ɊɂȾ ɢ ɂɎȺ ɧɟ ɜɵɹɜɥɟɧɨ. ȼɨɫɫɬɚɧɨɜɥɟɧɢɟ ɬɢɬɪɨɜ ɚɧɬɢɬɟɥ ɨɬɦɟɱɟɧɨ ɫ
15-ɝɨ ɞɧɹ ɩɨɫɥɟ ɜɚɤɰɢɧɚɰɢɢ.
ȼ ɩɨɫɬɜɚɤɰɢɧɚɥɶɧɵɣ ɩɟɪɢɨɞ ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ ɜɚɤɰɢɧɨɣ ɢɡ ɲɬ. ȼ. abortus 82 ɪɟɤɨɦɟɧɞɭɟɬɫɹ
ɩɪɨɜɨɞɢɬɶ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ ɥɟɣɤɨɡ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ ɤɨɪɨɜ ɧɟ ɪɚɧɟɟ ɱɟɦ
ɱɟɪɟɡ 7 ɞɧɟɣ, ɚ ɫɟɪɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ ɥɟɣɤɨɡ ɜ ɊɂȾ – ɧɟ ɪɚɧɟɟ ɱɟɦ ɱɟɪɟɡ 15 ɞɧɟɣ ɩɨɫɥɟ
ɜɜɟɞɟɧɢɹ ɜɚɤɰɢɧɵ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
Ⱥɯɦɟɞɶɹɪɨɜ Ⱥ. ȼɥɢɹɧɢɟ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɩɪɢɜɢɜɨɤ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɧɚ ɩɨɤɚɡɚɬɟɥɢ ɛɟɥɨɣ
ɤɪɨɜɢ ɢ ɡɧɚɱɟɧɢɟ ɢɯ ɩɪɢ ɞɢɚɝɧɨɫɬɢɤɟ ɥɟɣɤɨɡɚ: Ⱥɜɬɨɪɟɮ. ɞɢɫ. … ɤɚɧɞ. ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ / Ⱥ. Ⱥɯɦɟɞɶɹɪɨɜ. – ɋɚɦɚɪɤɚɧɞ, 1972. – 16 ɫ.
Ɇɢɧɚɫɹɧ ȼ.Ƚ. Ɋɚɫɩɪɨɫɬɪɚɧɟɧɢɟ, ɦɟɬɨɞɵ ɞɢɚɝɧɨɫɬɢɤɢ ɢ ɛɨɪɶɛɵ ɫ ɥɟɣɤɨɡɨɦ ɜ ɦɨɥɨɱɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ:
Ⱥɜɬɨɪɟɮ. ɞɢɫ. … ɤɚɧɞ. ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ / ȼ.Ƚ. Ɇɢɧɚɫɹɧ. – Ɇɢɧɫɤ, 1991. – 20 ɫ.
Ɍɢɦɨɲɢɧɚ ɋ.ȼ. ȼɥɢɹɧɢɟ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ ɤɨɪɨɜ ɧɟɡɚɪɚɡɧɵɦɢ ɛɨɥɟɡɧɹɦɢ ɧɚ ɪɟɡɭɥɶɬɚɬɵ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ
ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɢ ɥɟɣɤɨɡɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ / ɋ.ȼ. Ɍɢɦɨɲɢɧɚ, Ɉ.Ȼ. Ȼɚɞɟɟɜɚ // Ⱥɤɬɭɚɥɶɧɵɟ ɜɨɩɪɨɫɵ ɜɟɬɟɪɢɧɚɪɧɨɣ ɦɟɞɢɰɢɧɵ: Ɇɚɬɟɪ. II ɋɢɛɢɪɫɤɨɝɨ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɤɨɧɝɪɟɫɫɚ / ɇɨɜɨɫɢɛ. ɝɨɫ. ɚɝɪɚɪ.
ɭɧ-ɬ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2010. – ɋ. 367–368.
249
4.
5.
6.
7.
8.
Ɇɟɬɨɞɢɱɟɫɤɢɟ ɭɤɚɡɚɧɢɹ ɩɨ ɞɢɚɝɧɨɫɬɢɤɟ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ / Ⱦɟɩɚɪɬɚɦɟɧɬ ɜɟɬɟɪɢɧɚɪɢɢ
Ɇɢɧɫɟɥɶɯɨɡɚ Ɋɨɫɫɢɢ. – Ɇ., 2000. – 34 ɫ.
Ʉɨɫɢɥɨɜ ɂ.Ⱥ. Ȼɪɭɰɟɥɥɟɡ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ / ɂ.Ⱥ. Ʉɨɫɢɥɨɜ, ɉ.Ʉ. Ⱥɪɚɤɟɥɹɧ, ɋ.Ʉ. Ⱦɢɦɨɜ,
Ⱥ.Ƚ. ɏɥɵɫɬɭɧɨɜ / ɉɨɞ ɪɟɞ. ɂ.Ⱥ. Ʉɨɫɢɥɨɜɚ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1999. – 344 ɫ.
Ʌɨɝɢɧɨɜ ɋ.ɂ. ɂɡɦɟɧɟɧɢɹ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɪɢ ȼɅɄɊɋ-ɢɧɮɟɤɰɢɢ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɜɚɤɰɢɧ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥɺɡɚ / ɋ.ɂ. Ʌɨɝɢɧɨɜ, ɋ.Ʉ. Ⱦɢɦɨɜ, ɇ.ɂ. Ʉɭɪɟɧɫɤɚɹ, Ⱥ.ɋ. ɉɨɡɨɥɨɬɢɧɚ // ȼɟɫɬɧɢɤ ɇȽȺɍ. – 2012. – ʋ 1, ɱ. 2. – ɋ. 119–122.
ɋɦɢɪɧɨɜ ɉ.ɇ. Ȼɨɥɟɡɧɶ ɜɟɤɚ – ɥɟɣɤɨɡ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ / ɉ.ɇ. ɋɦɢɪɧɨɜ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2007. –
301 ɫ.
Ɋɚɡɭɦɨɜɫɤɚɹ ȼ.ȼ. ɋɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟ ɫɢɫɬɟɦɵ ɭɩɪɚɜɥɟɧɢɹ ɷɩɢɡɨɨɬɢɱɟɫɤɢɦ ɩɪɨɰɟɫɫɨɦ ɥɟɣɤɨɡɚ ɢ ɛɪɭɰɟɥɥɺɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ: Ⱥɜɬɨɪɟɮ. ɞɢɫ. … ɞ-ɪɚ ɜɟɬ. ɧɚɭɤ / ȼ.ȼ. Ɋɚɡɭɦɨɜɫɤɚɹ. – Ȼɚɪɧɚɭɥ, 2004. –
40 ɫ.
ɍȾɄ 619:636.294:576.89.
ȺɇȺɅɂɁ ɗɉɂɁɈɈɌɂɑȿɋɄɈɃ ɋɂɌɍȺɐɂɂ
ɉɈ ɗɅȺɎɈɋɌɊɈɇȽɂɅȿɁɍ ɂ ɀȿɅɍȾɈɑɇɈ-ɄɂɒȿɑɇɕɆ
ɋɌɊɈɇȽɂɅəɌɈɁȺɆ ɆȺɊȺɅɈȼ
Ʌɍɇɂɐɕɇ ȼ.Ƚ., ɆɂɏȺɃɅɈȼ ȼ.ɂ., ɌɂɒɄɈȼ Ɇ.ɘ.
ɉɚɧɬɨɜɨɟ ɨɥɟɧɟɜɨɞɫɬɜɨ ɹɜɥɹɟɬɫɹ ɨɬɧɨɫɢɬɟɥɶɧɨ ɦɨɥɨɞɨɣ ɨɬɪɚɫɥɶɸ ɢ ɧɚɫɱɢɬɵɜɚɟɬ ɧɟɦɧɨɝɢɦ ɛɨɥɟɟ 200 ɥɟɬ. ɂɫɬɨɪɢɱɟɫɤɢ ɫɥɨɠɢɥɨɫɶ ɬɚɤ, ɱɬɨ ɦɚɪɚɥɨɜ ɫɬɚɥɢ ɪɚɡɜɨɞɢɬɶ ɧɚ ɬɟɪɪɢɬɨɪɢɢ Ⱥɥɬɚɣɫɤɨɝɨ
ɤɪɚɹ ɢ Ɋɟɫɩɭɛɥɢɤɢ Ⱥɥɬɚɣ, ɧɨ ɩɨɞ ɜɥɢɹɧɢɟɦ ɚɧɬɪɨɩɨɝɟɧɧɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ, ɩɚɧɬɨɜɵɯ ɨɥɟɧɟɣ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ, ɚɤɬɢɜɧɨ ɪɚɡɜɨɞɹɬ ɢ ɜ ɰɟɧɬɪɚɥɶɧɨɣ ɱɚɫɬɢ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ [3].
ɍ ɦɚɪɚɥɨɜ, ɤɚɤ ɢ ɭ ɞɪɭɝɢɯ ɞɨɦɚɲɧɢɯ ɠɢɜɨɬɧɵɯ, ɧɚɫɱɢɬɵɜɚɟɬɫɹ ɪɹɞ ɢɧɜɚɡɢɨɧɧɵɯ ɛɨɥɟɡɧɟɣ, ɤɨɬɨɪɵɟ ɩɨɥɭɱɢɥɢ ɞɨɫɬɚɬɨɱɧɨ ɲɢɪɨɤɨɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɢɡ-ɡɚ ɛɟɫɤɨɧɬɪɨɥɶɧɨɝɨ ɩɟɪɟɜɨɡɚ ɠɢɜɨɬɧɵɯ
ɢɡ ɯɨɡɹɣɫɬɜɚ ɜ ɯɨɡɹɣɫɬɜɨ ɢ ɞɪɭɝɢɟ ɪɟɝɢɨɧɵ ɫɬɪɚɧɵ. Ȼɨɥɶɲɢɧɫɬɜɨ ɝɟɥɶɦɢɧɬɨɡɨɜ ɩɪɨɬɟɤɚɸɬ ɫɭɛɤɥɢɧɢɱɟɫɤɢ ɢ ɧɚɧɨɫɹɬ ɡɧɚɱɢɬɟɥɶɧɵɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ ɨɬɪɚɫɥɢ ɧɟ ɜɵɡɵɜɚɹ ɩɚɞɟɠɚ ɠɢɜɨɬɧɵɯ.
Ȼɨɪɶɛɚ ɫ ɩɚɪɚɡɢɬɚɪɧɵɦɢ ɛɨɥɟɡɧɹɦɢ ɦɚɪɚɥɨɜ ɢɦɟɟɬ ɛɨɥɶɲɭɸ ɚɤɬɭɚɥɶɧɨɫɬɶ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ,
ɬɚɤ ɤɚɤ ɧɚ ɮɨɧɟ ɦɧɨɝɨɥɟɬɧɟɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɪɟɩɚɪɚɬɨɜ ɢɡ ɝɪɭɩɩɵ ɦɚɤɪɨɰɢɤɥɢɱɟɫɤɢɯ ɥɚɤɬɨɧɨɜ ɭ
ɧɟɤɨɬɨɪɵɯ ɩɚɪɚɡɢɬɨɜ ɩɪɨɢɡɨɲɥɚ ɜɵɪɚɛɨɬɤɚ ɪɟɡɢɫɬɟɧɬɧɨɫɬɢ ɤ ɧɢɦ, ɱɬɨ ɫɩɨɫɨɛɫɬɜɭɟɬ ɩɨɢɫɤɭ ɧɨɜɵɯ
ɩɪɟɩɚɪɚɬɨɜ [2].
ȼ ɯɨɞɟ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɨɛ ɮɟɤɚɥɢɣ ɨɬ ɦɚɪɚɥɨɜ ɢɡ 4 ɯɨɡɹɣɫɬɜ ɡɚ ɫɟɦɢɥɟɬɧɢɣ ɩɟɪɢɨɞ ɧɚɦɢ ɛɵɥɨ
ɩɪɨɜɟɞɟɧɨ 4235 ɤɨɩɪɨɥɚɪɜɨɫɤɨɩɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ, 192 ɝɟɥɶɦɢɧɬɨɥɨɝɢɱɟɫɤɢɯ ɜɫɤɪɵɬɢɹ [1,4].
ɍɫɬɚɧɨɜɥɟɧɵ: ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡ, ɞɢɤɪɨɰɟɥɢɨɡ, ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɟ ɫɬɪɨɧɝɢɥɹɬɨɡɵ, ɦɨɧɢɟɡɢɨɡ,
ɧɟɦɚɬɨɞɢɪɨɡ ɢ ɷɣɦɟɪɢɨɡ, ɚ ɬɚɤ ɠɟ ɥɟɝɨɱɧɵɟ ɧɟɦɚɬɨɞɨɡɵ (ɞɢɤɬɢɨɤɚɭɥɟɡ ɢ ɜɚɪɟɫɬɪɨɧɝɢɥɟɡ). ɉɪɢ
ɚɧɚɥɢɡɟ ɩɨɥɭɱɟɧɧɵɯ ɞɚɧɧɵɯ ɛɵɥɨ ɨɬɦɟɱɟɧɨ, ɱɬɨ ɞɨɦɢɧɢɪɭɸɳɢɦɢ ɜɢɞɚɦɢ ɹɜɥɹɸɬɫɹ ɷɥɚɮɨɫɬɪɨɧɝɢɥɵ ɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɟ ɫɬɪɨɧɝɢɥɹɬɵ (ɀɄɋ) ɧɚ ɤɨɬɨɪɵɟ ɛɵɥ ɫɞɟɥɚɧ ɨɫɧɨɜɧɨɣ ɚɤɰɟɧɬ ɜ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɹɯ.
ɗɩɢɡɨɨɬɢɱɟɫɤɭɸ ɫɢɬɭɚɰɢɸ ɩɨ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɭ ɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɦ ɫɬɪɨɧɝɢɥɹɬɨɡɚɦ
ɢɡɭɱɚɥɢ ɜ ɪɚɡɧɵɯ ɩɪɢɪɨɞɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɡɨɧɚɯ, ɚ ɢɦɟɧɧɨ ɜ Ⱥɥɬɚɣɫɤɨɦ ɢ ɑɚɪɵɲɫɤɨɦ ɪɚɣɨɧɚɯ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ, ɚ ɬɚɤɠɟ ɒɟɛɚɥɢɧɫɤɨɦ ɢ ɍɫɬɶ-Ʉɨɤɫɢɧɫɤɨɦ ɪɚɣɨɧɚɯ Ɋɟɫɩɭɛɥɢɤɢ Ⱥɥɬɚɣ.
ɂɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɜɨɞɢɥɢ ɜ ɥɚɛɨɪɚɬɨɪɢɢ ȼɇɂɂɉɈ.
ȼ ɈɈɈ «Ɇɚɪɚɥ-Ɍɨɥɭɫɨɦɚ» ɒɟɛɚɥɢɧɫɤɨɝɨ ɪɚɣɨɧɚ Ɋɟɫɩɭɛɥɢɤɢ Ⱥɥɬɚɣ ɡɚ ɩɟɪɢɨɞ ɫ 2007 ɩɨ
2013 ɝɨɞɵ ɗɂ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɚ ɜ ɫɪɟɞɧɟɦ ɤɨɥɟɛɚɥɚɫɶ ɜ ɩɪɟɞɟɥɚɯ 70 – 85 % ɫ ɦɢɧɢɦɚɥɶɧɵɦ ɩɨɤɚɡɚɬɟɥɟɦ 58 % ɜ 2010 ɝɨɞɭ ɩɪɢ ɂɂ ɨɬ 3 ɞɨ 28 ɥɢɱɢɧɨɤ ɜ ɩɪɨɛɟ (ɪɢɫ 1). Ɇɚɤɫɢɦɚɥɶɧɚɹ ɗɂ ɨɬɦɟɱɟɧɚ
ɜ 2013 ɝɨɞɭ ɢ ɫɨɫɬɚɜɢɥɚ 98 % ɫ ɂɂ ɞɨ 3600 ɥɢɱɢɧɨɤ ɷɥɚɮɨɫɬɪɨɧɝɢɥ.
ɗɤɫɬɟɧɫɢɜɧɵɟ ɩɨɤɚɡɚɬɟɥɢ ɀɄɋ ɡɚ ɢɫɫɥɟɞɭɟɦɵɣ ɩɟɪɢɨɞ ɤɨɥɟɛɥɸɬɫɹ ɨɬ 20 ɞɨ 40 % ɫ ɦɢɧɢɦɭɦɨɦ
ɜ 2007 ɝɨɞɭ 10 % ɩɪɢ ɂɂ – 1 ɹɣɰɨ ɜ ɝɪɚɦɦɟ ɦɚɬɟɪɢɚɥɚ. Ɇɚɤɫɢɦɚɥɶɧɵɣ ɩɨɤɚɡɚɬɟɥɶ ɗɂ ɨɬɦɟɱɟɧ ɜ
2012 ɝɨɞɭ ɢ ɫɨɫɬɚɜɢɥ 50 % ɫ ɂɂ ɞɨ 20 ɹɢɰ ɜ ɝɪɚɦɦɟ.
ȼ ɈɈɈ «Ɇɨɪɚɭɦ» ɍɫɬɶ-Ʉɨɤɫɢɧɫɤɨɝɨ ɪɚɣɨɧɚ Ɋɟɫɩɭɛɥɢɤɢ Ⱥɥɬɚɣ ɫɢɬɭɚɰɢɹ ɩɨ ɝɟɥɶɦɢɧɬɨɡɚɦ
ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɫɥɟɞɭɸɳɭɸ ɤɚɪɬɢɧɭ (ɪɢɫ 2). Ɍɚɤ, ɫɪɟɞɧɢɟ ɩɨɤɚɡɚɬɟɥɢ ɷɤɫɬɟɧɫɢɜɧɨɫɬɢ ɢɧɜɚɡɢɢ
ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɚ ɡɚ 7 ɥɟɬ ɜɚɪɶɢɪɭɸɬ ɜ ɩɪɟɞɟɥɚɯ ɨɬ 65 ɞɨ 82 % ɩɪɢ ɦɢɧɢɦɚɥɶɧɨɦ ɩɨɤɚɡɚɬɟɥɟ ɜ
2012 ɝɨɞɭ – 56 % ɫ ɂɂ ɨɬ 10 ɞɨ 12 ɥɢɱɢɧɨɤ. Ɇɚɤɫɢɦɭɦ ɗɂ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɚ ɩɪɢɲɟɥɫɹ ɧɚ 2011 ɝɨɞ
ɢ ɫɨɫɬɚɜɢɥ 92 % ɫ ɂɂ ɞɨ 2500 ɥɢɱɢɧɨɤ ɜ ɩɪɨɛɟ.
250
Ɋɢɫ. 1. ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ
ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɢ ɀɄɋ
ɡɚ ɩɟɪɢɨɞ ɫ 2007 ɩɨ 2013 ɝɨɞɵ
ɜ ɈɈɈ «Ɇɚɪɚɥ-Ɍɨɥɭɫɨɦɚ»
Ɋɢɫ. 2. ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ
ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɢ ɀɄɋ
ɡɚ ɩɟɪɢɨɞ ɫ 2007 ɩɨ 2013 ɝɨɞɵ
ɜ ɈɈɈ «Ɇɨɪɚɭɦ»
ɗɂ ɩɪɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɯ ɫɬɪɨɧɝɢɥɹɬɨɡɚɯ ɡɚ ɢɫɫɥɟɞɭɟɦɵɣ ɩɟɪɢɨɞ ɜɪɟɦɟɧɢ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɚ 35 – 45 % ɫ ɦɢɧɢɦɚɥɶɧɨɣ ɷɤɫɬɟɧɫɢɜɧɨɫɬɶɸ ɜ 2012 ɝɨɞɭ 27 % ɩɪɢ ɂɂ ɞɨ 2 ɹɢɰ. Ɇɚɤɫɢɦɭɦ
ɢɧɜɚɡɢɢ ɀɄɋ ɛɵɥ ɬɚɤɠɟ ɜ 2011 ɝɨɞɭ ɢ ɫɨɫɬɚɜɢɥ 62 % ɫ ɂɂ ɞɨ 18 ɹɢɰ ɜ 1 ɝɪɚɦɦɟ.
ȼ ɈɈɈ «Ⱥɪɟɤɫ» Ⱥɥɬɚɣɫɤɨɝɨ ɪɚɣɨɧɚ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ ɗɂ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɚ (ɪɢɫ. 3) ɜɚɪɶɢɪɭɟɬ ɜ
ɫɪɟɞɧɟɦ ɜ ɩɪɟɞɟɥɚɯ 50 – 70 % ɫ ɦɢɧɢɦɚɥɶɧɵɦ ɩɨɤɚɡɚɬɟɥɟɦ ɜ 2011 ɝɨɞɭ 30 % ɩɪɢ ɂɂ ɞɨ 30 ɥɢɱɢɧɨɤ
ɜ ɩɪɨɛɟ. Ɇɚɤɫɢɦɭɦ ɢɧɜɚɡɢɢ ɨɬɦɟɱɟɧ ɜ 2010 ɝɨɞɭ ɢ ɞɨɫɬɢɝ ɨɬɦɟɬɤɢ 90 % ɫ ɂɂ ɞɨ 1200 ɷɤɡɟɦɩɥɹɪɨɜ.
ɉɪɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɯ ɫɬɪɨɧɝɢɥɹɬɨɡɚɯ ɗɂ ɜ ɫɪɟɞɧɟɦ ɤɨɥɟɛɥɟɬɫɹ ɨɬ 20 ɞɨ 40 % ɫ ɦɢɧɢɦɚɥɶɧɨɣ
ɷɤɫɬɟɧɫɢɜɧɨɫɬɶɸ ɜ 2010 ɝɨɞɭ 12 % ɢ ɂɂ 1 ɹɣɰɨ ɜ ɝɪɚɦɦɟ ɦɚɬɟɪɢɚɥɚ. ɇɚɢɜɵɫɲɚɹ ɬɨɱɤɚ ɢɧɜɚɡɢɪɨɜɚɧɧɨɫɬɢ ɦɚɪɚɥɨɜ ɀɄɋ ɜɵɩɚɥɚ ɧɚ 2009 ɝɨɞ ɢ ɫɨɫɬɚɜɢɥɚ 53 % ɫ ɂɂ ɞɨ 4 ɹɢɰ.
ɋɪɟɞɧɹɹ ɷɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɜ Ɉɉɏ «ɇɨɜɨɬɚɥɢɰɤɨɟ» ɑɚɪɵɲɫɤɨɝɨ
ɪɚɣɨɧɚ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ (ɪɢɫ. 4) ɡɚ ɩɟɪɢɨɞ ɫ 2007 ɩɨ 2013 ɝɨɞɵ ɞɜɢɠɟɬɫɹ ɜ ɩɪɟɞɟɥɚɯ 70 – 80 % ɩɪɢ
ɦɢɧɢɦɚɥɶɧɨɦ ɩɨɤɚɡɚɬɟɥɟ ɜ 2011 ɝɨɞɭ 58 % ɫ ɂɂ ɞɨ 10 ɥɢɱɢɧɨɤ ɜ ɩɪɨɛɟ. ɉɢɤ ɗɂ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɚ
ɨɬɦɟɱɟɧ ɜ 2012 ɝɨɞɭ ɢ ɫɨɫɬɚɜɢɥ 90 % ɫ ɂɂ 1800 ɷɤɡɟɦɩɥɹɪɨɜ ɥɢɱɢɧɨɤ. ɗɤɫɬɟɧɫɢɜɧɵɟ ɩɨɤɚɡɚɬɟɥɢ
ɀɄɋ ɜ ɫɪɟɞɧɟɦ ɜɚɪɶɢɪɭɸɬ ɜ ɞɢɚɩɚɡɨɧɟ ɨɬ 30 ɞɨ 60 %. Ɇɢɧɢɦɚɥɶɧɚɹ ɗɂ ɩɪɢɯɨɞɢɬɫɹ ɧɚ 2009 ɝɨɞ
ɢ ɫɨɫɬɚɜɥɹɟɬ 11 % ɫ ɂɂ ɞɨ 1 ɹɣɰɚ ɜ ɝɪɚɦɦɟ ɮɟɤɚɥɢɣ. Ɇɚɤɫɢɦɭɦ ɢɧɜɚɡɢɪɨɜɚɧɧɨɫɬɢ ɩɪɢɯɨɞɢɬɫɹ ɧɚ
2011 ɝɨɞ ɢ ɫɨɨɬɜɟɬɫɬɜɭɟɬ 80 % ɫ ɂɂ ɞɨ 40 ɹɢɰ.
Ɋɢɫ. 3. ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ
ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɢ ɀɄɋ
ɡɚ ɩɟɪɢɨɞ ɫ 2007 ɩɨ 2012 ɝɨɞɵ
ɜ ɈɈɈ «Ⱥɪɟɤɫ»
Ɋɢɫ. 4. ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ
ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɢ ɀɄɋ
ɡɚ ɩɟɪɢɨɞ ɫ 2007 ɩɨ 2013 ɝɨɞɵ
ɜ Ɉɉɏ «ɇɨɜɨɬɚɥɢɰɤɨɟ»
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɧɟ ɫɦɨɬɪɹ ɧɚ ɬɨ, ɱɬɨ ɯɨɡɹɣɫɬɜɚ ɪɚɫɩɨɥɚɝɚɸɬɫɹ ɜ ɪɚɡɥɢɱɧɵɯ ɩɪɢɪɨɞɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɡɨɧɚɯ ɢ ɧɚ ɪɚɡɧɨɣ ɜɵɫɨɬɟ ɧɚɞ ɭɪɨɜɧɟɦ ɦɨɪɹ, ɗɂ ɭ ɦɚɪɚɥɨɜ ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɩɪɚɤɬɢɱɟɫɤɢ ɧɟ ɨɬɥɢɱɚɟɬɫɹ ɞɪɭɝ ɨɬ ɞɪɭɝɚ ɢ ɫɨɫɬɚɜɥɹɟɬ ɜ ɫɪɟɞɧɟɦ 50 – 70 % ɫ ɦɢɧɢɦɚɥɶɧɵɦ ɩɨɤɚɡɚɬɟɥɟɦ
ɢɧɜɚɡɢɪɨɜɚɧɧɨɫɬɢ 30 % ɢ ɩɢɤɨɦ ɷɤɫɬɟɧɫɢɜɧɨɫɬɢ 98 %, ɩɪɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɯ ɫɬɪɨɧɝɢɥɹɬɨɡɚɯ
251
ɤɚɪɬɢɧɚ ɷɤɫɬɟɧɫɢɜɧɨɫɬɢ ɢɧɜɚɡɢɢ ɬɚɤ ɠɟ ɚɧɚɥɨɝɢɱɧɚ ɭ ɠɢɜɨɬɧɵɯ ɜɫɟɯ ɦɚɪɚɥɨɮɟɪɦ ɢ ɜ ɫɪɟɞɧɟɦ ɜɚɪɶɢɪɭɟɬ ɜ ɩɪɟɞɟɥɚɯ 40 – 60 % ɫ ɦɢɧɢɦɭɦɨɦ 10 % ɢ ɦɚɤɫɢɦɭɦɨɦ 80 %.
Ɇɚɤɫɢɦɚɥɶɧɵɟ ɢ ɦɢɧɢɦɚɥɶɧɵɟ ɤɨɥɟɛɚɧɢɹ ɜ ɗɂ ɩɪɢ ɷɥɚɮɨɫɬɪɨɧɝɢɥɟɡɟ ɢ ɀɄɋ ɦɨɠɧɨ ɨɛɴɹɫɧɢɬɶ ɧɚɥɢɱɢɟɦ ɧɟɫɤɨɥɶɤɢɯ ɚɧɬɪɨɩɨɝɟɧɧɵɯ ɮɚɤɬɨɪɨɜ, ɩɪɢɫɭɬɫɬɜɭɸɳɢɯ ɜ ɨɛɫɥɟɞɨɜɚɧɧɵɯ ɦɚɪɚɥɨɜɨɞɱɟɫɤɢɯ ɯɨɡɹɣɫɬɜɚɯ: ɨɬɫɭɬɫɬɜɢɟ ɩɚɫɬɛɢɳɟɨɛɨɪɨɬɚ, ɱɬɨ ɧɟ ɩɨɡɜɨɥɹɟɬ ɪɚɡɨɪɜɚɬɶ ɰɢɤɥ ɪɚɡɜɢɬɢɹ
ɝɟɥɶɦɢɧɬɨɜ; ɧɟ ɩɪɨɜɟɞɟɧɢɟ ɦɟɪɨɩɪɢɹɬɢɣ ɩɨ ɥɢɤɜɢɞɚɰɢɢ ɩɪɨɦɟɠɭɬɨɱɧɵɯ ɯɨɡɹɟɜ (ɨɛɪɚɛɨɬɤɚ ɦɨɥɸɫɤɨɰɢɞɚɦɢ ɤɨɪɦɨɜɵɯ ɩɥɨɳɚɞɨɤ, ɪɚɫɱɢɫɬɤɚ ɡɢɦɧɢɤɨɜ ɨɬ ɨɫɬɚɬɤɨɜ ɤɨɪɦɨɜ, ɛɭɪɬɨɜɚɧɢɟ ɧɚɜɨɡɚ ɢ
ɞɪɭɝɢɟ ɦɟɪɵ); ɧɟ ɨɛɟɫɩɟɱɟɧɢɟ ɫɬɨɩɪɨɰɟɧɬɧɨɣ ɞɟɝɟɥɶɦɢɧɬɢɡɚɰɢɢ ɦɚɪɚɥɨɩɨɝɨɥɨɜɶɹ ɜɨ ɜɪɟɦɹ ɨɫɟɧɧɟɣ ɢ ɜɟɫɟɧɧɟɣ ɪɚɡɛɢɜɨɤ; ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɨɞɧɨɝɨ ɢ ɬɨɝɨ ɠɟ ɩɪɟɩɚɪɚɬɚ ɧɚ ɩɪɨɬɹɠɟɧɢɢ ɪɹɞɚ ɥɟɬ ɢɥɢ
ɟɝɨ ɚɧɚɥɨɝɨɜ, ɱɬɨ ɩɪɢɜɨɞɢɬ ɤ ɜɵɪɚɛɨɬɤɟ ɪɟɡɢɫɬɟɧɬɧɨɫɬɢ ɭ ɩɚɪɚɡɢɬɨɜ ɧɚ ɞɟɣɫɬɜɭɸɳɟɟ ɜɟɳɟɫɬɜɨ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɜ ɤɨɥɟɛɚɧɢɹɯ ɷɤɫɬɟɧɫɢɜɧɨɫɬɢ ɢɧɜɚɡɢɢ ɧɟɬ ɥɢɧɟɣɧɨɣ ɡɚɜɢɫɢɦɨɫɬɢ ɧɚ ɩɪɨɬɹɠɟɧɢɢ ɚɧɚɥɢɡɢɪɭɟɦɨɝɨ ɩɟɪɢɨɞɚ ɜɪɟɦɟɧɢ (7 ɥɟɬ). ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɷɜɨɥɸɰɢɨɧɧɵɣ ɚɤɬ ɧɟɨɞɧɨɪɨɞɧɨɫɬɢ ɛɢɨɩɨɩɭɥɹɰɢɣ ɫ ɨɞɧɨɣ ɫɬɨɪɨɧɵ ɢ ɧɚɥɨɠɟɧɢɟɦ ɧɚ ɧɟɝɨ ɚɧɬɪɨɩɨɝɟɧɧɵɯ ɜɨɡɞɟɣɫɬɜɢɣ ɫ ɞɪɭɝɨɣ. ȼ ɪɟɡɭɥɶɬɚɬɟ ɱɟɝɨ ɛɢɨɥɨɝɢɱɟɫɤɢɟ ɩɨɩɭɥɹɰɢɢ (ɦɚɪɚɥ – ɝɟɥɶɦɢɧɬ – ɦɨɥɥɸɫɤ) ɩɨɞ ɜɥɢɹɧɢɟɦ ɷɬɢɯ ɮɚɤɬɨɪɨɜ ɩɪɟɬɟɪɩɟɜɚɸɬ ɡɚɤɨɧɨɦɟɪɧɵɟ ɤɨɥɢɱɟɫɬɜɟɧɧɵɟ ɫɞɜɢɝɢ ɜ ɬɭ ɢɥɢ
ɢɧɭɸ ɫɬɨɪɨɧɭ ɨɬ ɫɧɢɠɟɧɢɹ ɞɨ ɜɨɫɫɬɚɧɨɜɥɟɧɢɹ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
Ʉɨɬɟɥɶɧɢɤɨɜ Ƚ.Ⱥ. Ƚɟɥɶɦɢɧɬɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɠɢɜɨɬɧɵɯ ɢ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ.- Ɇ.: « Ʉɨɥɨɫ»,
1984.-208ɫ.
Ʌɭɧɢɰɵɧ ȼ.Ƚ., Ɇɢɯɚɣɥɨɜ ȼ.ɂ., ɒɭɤɥɢɧɚ ȿ.ȼ., Ȼɨɪɚɧɛɚɟɜ Ⱥ.ȼ. Ɇɟɪɥɢɱ ɉ.ɇ. Ⱦɢɚɝɧɨɫɬɢɤɚ ɢ ɦɟɪɵ ɛɨɪɶɛɵ ɫ ɩɚɪɚɡɢɬɨɡɚɦɢ ɦɚɪɚɥɨɜ: Ɇɟɬɨɞɢɱɟɫɤɢɟ ɪɟɤɨɦɟɧɞɚɰɢɢ / ɊȺɋɏɇ, ȼɇɂɂɉɈ. -Ȼɚɪɧɚɭɥ, 2010.-34ɫ
Ʌɭɧɢɰɵɧ ȼ.Ƚ., Ɍɢɲɤɨɜ Ɇ.ɘ., Ɇɢɯɚɣɥɨɜ ȼ.ɂ. ɗɩɢɡɨɨɬɢɱɟɫɤɢɣ ɦɨɧɢɬɨɪɢɧɝ, ɩɪɨɮɢɥɚɤɬɢɤɚ ɢ ɦɟɪɵ ɛɨɪɶɛɵ ɫ ɩɚɪɚɡɢɬɨɡɚɦɢ ɦɚɪɚɥɨɜ: Ɇɟɬɨɞɢɱɟɫɤɢɟ ɪɟɤɨɦɟɧɞɚɰɢɢ / ɊȺɋɏɇ, ȼɇɂɂɉɈ. -Ȼɚɪɧɚɭɥ, 2013.-46ɫ.
ɋɤɪɹɛɢɧ Ʉ.ɂ. Ɇɟɬɨɞ ɩɨɥɧɵɯ ɝɟɥɶɦɢɧɬɨɥɨɝɢɱɟɫɤɢɯ ɜɫɤɪɵɬɢɣ ɩɨɡɜɨɧɨɱɧɵɯ, ɜɤɥɸɱɚɹ ɱɟɥɨɜɟɤɚ.-Ɇ.:
ɂɡɞ-ɜɨ 1 ɆȽɍ, 1928, 45ɫ.
ȼɅɂəɇɂȿ ɐȿɈɅɂɌɈȼ ɇȺ ɆɈɌɈɊɂɄɍ
ɂ ɋȿɄɊȿɐɂɘ ɀȿɅɍȾɄȺɆɈɇȽɈɅɖɋɄɂɏ ɅɈɒȺȾȿɃ
ɅɏȺɆɋȺɃɁɆȺȺ Ⱦ.1, ɌȺɊɇɍȿȼ Ⱥ.ɋ.2,
Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ,
ɇɂɂ ɜɟɬɟɪɢɧɚɪɧɵɣ ɦɟɞɢɰɢɧɵ, ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ
2ɎȽȻɈɍ ȼɉɈ “Ȼɭɪɹɬɫɤɚɹ ɝɨɫɭɞɚɪɫɬɜɟɧɧɚɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ ɚɤɚɞɟɦɢɹ
ɢɦ. ȼ.Ɋ. Ɏɢɥɢɩɩɨɜɚ”, ɍɥɚɧ-ɍɞɷ, Ɋɨɫɫɢɹ, e-mail: Lkham7704@gmail.com
1-
Ɇɨɧɝɨɥɶɫɤɢɣ ɰɟɨɥɢɬ ɐɚɝɚɚɧ-ɐɚɜɫɤɨɝɨ ɦɟɫɬɨɪɨɠɞɟɧɢɹ, ɤɨɬɨɪɵɣ ɦɵ ɩɪɢɦɟɧɹɥɢ ɜ ɜɢɞɟ ɰɟɨɥɢɬɨɜɨɣ ɩɨɞɤɨɪɦɤɢ ɢɦɟɟɬ ɜɟɳɟɫɬɜɟɧɧɵɣ ɫɨɫɬɚɜ ɰɟɨɥɢɬɢɡɢɪɨɜɚɧɧɵɯ ɬɭɮɨɜ ɤɥɢɧɨɩɬɢɥɨɥɢɬɨɜɨɝɨ ɬɢɩɚ
(ɩɨɪɨɞɵ ɛɟɥɨɝɨ ɢ ɡɟɥɟɧɨɜɚɬɨɝɨ ɰɜɟɬɚ).
ɂɫɫɥɟɞɨɜɚɧɢɹ ɩɨ ɩɪɢɦɟɧɟɧɢɸ ɰɟɨɥɢɬɨɜɨɣ ɩɨɞɤɨɪɦɤɢ ɥɨɲɚɞɹɦ ɩɪɨɜɟɞɟɧɵ ɜ ɪɚɣɨɧɟ ɏɚɧ-ɍɭɥ,
ɍɥɡɢɣɬ ɯɨɪɨɨɥɨɥ Ɇɨɧɝɨɥɢɢ. Ɋɚɛɨɱɟɣ ɦɟɬɨɞɢɤɨɣ ɩɪɟɞɭɫɦɚɬɪɢɜɚɥɨɫɶ ɨɛɟɫɩɟɱɢɬɶ ɫɜɨɛɨɞɧɵɣ ɞɨɫɬɭɩ
ɥɨɲɚɞɹɦ ɤ ɩɨɞɤɨɪɦɤɟ. ɗɬɨ ɞɨɫɬɢɝɚɥɨɫɶ ɭɫɬɚɧɨɜɤɨɣ ɤɨɪɦɭɲɟɤ ɫ ɰɟɨɥɢɬɚɦɢ ɮɪɚɤɰɢɢ 0,1-0,3 ɦɦ ɜ
ɫɬɨɥɨɜɵɯ ɞɥɹ ɥɨɲɚɞɟɣ. ɐɟɨɥɢɬɵ ɡɚɞɚɜɚɥɢ ɜ ɱɢɫɬɨɦ ɜɢɞɟ ɢɡ ɪɚɫɱɟɬɚ 0,5 ɝ ɧɚ 1 ɤɝ ɦɚɫɫɵ ɥɨɲɚɞɟɣ.
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɧɵɯɧɚɭɱɧɨ-ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɨɩɵɬɨɜ ɛɵɥɨ ɨɬɦɟɱɟɧɨ, ɱɬɨ ɠɟɪɟɛɹɬɚ ɫ ɩɪɢɡɧɚɤɚɦɢ ɡɚɛɨɥɟɜɚɧɢɹ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ ɜɵɡɞɨɪɨɜɟɥɢ, ɚ ɜ ɤɨɧɬɪɨɥɶɧɨɣ ɠɟ
ɝɪɭɩɩɟ 1 ɠɟɪɟɛɟɧɨɤ ɩɚɥ ɨɬ ɞɢɚɪɟɢ. ɋɪɟɞɧɟɫɭɬɨɱɧɵɟ ɩɪɢɪɨɫɬɵ ɠɢɜɨɣ ɦɚɫɫɵ ɦɨɥɨɞɧɹɤɚ ɜ ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɛɵɥɢ ɜɵɲɟ, ɱɟɦ ɜ ɤɨɧɬɪɨɥɶɧɨɣ (250 ɢ 180 ɝ. ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ). ɋɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ,
ɱɬɨ ɪɚɡɧɢɰɚ ɜɩɪɢɪɨɫɬɟ ɠɢɜɨɣ ɦɚɫɫɵ ɜ ɨɫɧɨɜɧɨɦ ɩɨɥɭɱɟɧɚ ɤ 2-ɦɟɫɹɱɧɨɦɭ ɜɨɡɪɚɫɬɭ – ɞɨ ɜɵɯɨɞɚ
ɠɟɪɟɛɹɬ ɧɚ ɩɚɫɬɛɢɳɟ.
Ɋɟɡɭɥɶɬɚɬɚɦɢ ɢɫɫɥɟɞɨɜɚɧɢɣ ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɯ ɢ ɛɢɨɯɢɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɤɪɨɜɢ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɳɟɥɨɱɧɨɣ ɪɟɡɟɪɜ ɤɪɨɜɢ ɠɟɪɟɛɹɬ ɨɛɟɢɯ ɝɪɭɩɩ ɧɚɯɨɞɢɥɫɹ ɜ ɩɪɟɞɟɥɚɯ ɧɨɪɦɵ ɱɬɨ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɨ ɧɨɪɦɚɥɶɧɨɦ ɬɟɱɟɧɢɢ ɭɝɥɟɜɨɞɧɨ-ɠɢɪɨɜɨɝɨ ɢ ɦɢɧɟɪɚɥɶɧɨɝɨ ɨɛɦɟɧɚ ɜ ɨɪɝɚɧɢɡɦɟ ɠɢɜɨɬɧɵɯ.
Ƚɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɤɪɨɜɢ ɩɨɞɨɩɵɬɧɨɝɨ ɦɨɥɨɞɧɹɤɚ ɫɭɳɟɫɬɜɟɧɧɵɯ ɪɚɡɥɢɱɢɣ ɦɟɠɞɭ ɫɨɛɨɣ ɧɟ ɢɦɟɥɢ ɢ ɫɨɨɬɜɟɬɫɬɜɨɜɚɥɢ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɟ.
ɇɚɲɢ ɢɫɫɥɟɞɨɜɚɧɢɹ, ɩɪɨɜɟɞɟɧɧɵɟ ɜ 2008–2014 ɝɨɞɚɯ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɠɟɪɟɛɹɬɚ ɩɨɟɞɚɸɬ ɰɟɨɥɢɬɵ
ɭɠɟ ɫ 30-ɞɧɟɜɧɨɝɨ ɜɨɡɪɚɫɬɚ ɩɪɢ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɦɟɥɤɨɣ ɮɪɚɤɰɢɢ (0,1-0,3 ɦɦ), ɨɬɥɢɱɚɸɳɟɣɫɹ ɧɚɥɢɱɢɟɦ ɩɵɥɟɜɢɞɧɵɯ ɱɚɫɬɢɰ. ɉɪɢ ɫɤɚɪɦɥɢɜɚɧɢɢ ɰɟɨɥɢɬɨɜ ɬɚɤɨɣ ɮɪɚɤɰɢɢ ɜ ɱɢɫɬɨɦ ɜɢɞɟ ɩɵɥɟɜɢɞɧɵɟ
252
ɱɚɫɬɢɰɵ ɦɨɝɭɬ ɩɪɨɧɢɤɚɬɶ ɜ ɨɪɝɚɧɵ ɞɵɯɚɧɢɹ ɠɟɪɟɛɹɬ, ɱɬɨ ɧɟɠɟɥɚɬɟɥɶɧɨ. ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɩɪɨɜɟɞɟɧ
ɧɚɭɱɧɨ-ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɣ ɷɤɫɩɟɪɢɦɟɧɬ ɩɨ ɫɪɚɜɧɢɬɟɥɶɧɨɦɭ ɢɫɩɨɥɶɡɨɜɚɧɢɸ ɞɥɹ ɩɨɞɤɨɪɦɤɢ ɠɟɪɟɛɹɬ ɦɟɥɤɨɣ (0,1-0,3 ɦɦ) ɢ ɛɨɥɟɟ ɤɪɭɩɧɨɣ (1–3 ɦɦ) ɮɪɚɤɰɢɣ.
ɂɫɫɥɟɞɨɜɚɧɢɹ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɩɪɢ ɩɨɟɞɚɧɢɢ ɰɟɨɥɢɬɚ ɛɨɥɟɟ ɤɪɭɩɧɨɣɮɪɚɤɰɢɢ ɠɟɪɟɛɹɬɚ ɩɟɪɟɠɟɜɵɜɚɸɬ ɟɝɨ. ɉɪɢ ɷɬɨɦ ɨɬɦɟɱɟɧɨ ɧɟɫɤɨɥɶɤɨɛɨɥɶɲɟɟ ɩɨɬɪɟɛɥɟɧɢɟ ɤɪɭɩɧɨɣ ɮɪɚɤɰɢɢ (0,3-0,5 ɝ. ɜ ɫɭɬɤɢ
ɧɚ ɠɟɪɟɛɟɧɤɚ).
ɉɪɢ ɚɧɚɥɢɡɟ ɪɟɡɭɥɶɬɚɬɨɜ ɢɫɫɥɟɞɨɜɚɧɢɣ ɨɬɦɟɱɟɧɚ ɜɵɫɨɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɨɞɤɨɪɦɤɢ ɜ ɫɧɢɠɟɧɢɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ.
ɉɪɢ ɩɥɚɧɢɪɨɜɚɧɢɢ ɩɨɬɪɟɛɧɨɫɬɢ ɜ ɰɟɨɥɢɬɨɜɨɣ ɩɨɞɤɨɪɦɤɟ ɞɥɹ ɠɟɪɟɛɹɬ ɢɫɯɨɞɹɬ ɢɡ ɫɪɨɤɨɜ ɜɵɠɟɪɟɛɤɢ, ɬɚɤ ɤɚɤ ɫ ɜɵɯɨɞɨɦ ɧɚ ɡɟɥɟɧɨɟ ɩɚɫɬɛɢɳɟ ɩɨɟɞɚɟɦɨɫɬɶ ɩɨɞɤɨɪɦɤɢ ɪɟɡɤɨ ɩɚɞɚɟɬ.
ɉɨɞɤɨɪɦɤɭ ɠɟɪɟɛɹɬ ɰɟɨɥɢɬɚɦɢ ɪɟɤɨɦɟɧɞɭɟɬɫɹ ɧɚɱɢɧɚɬɶ ɫ ɦɟɫɹɱɧɨɝɨ ɜɨɡɪɚɫɬɚ. ɇɟɨɛɯɨɞɢɦɨ ɫɥɟɞɢɬɶ, ɱɬɨɛɵ ɜ ɤɨɪɦɭɲɤɢ ɫ ɰɟɨɥɢɬɚɦɢ ɧɟ ɩɨɩɚɞɚɥɢ ɝɪɹɡɶ, ɧɚɜɨɡ, ɜɥɚɝɚ.
ɇɚ ɨɫɧɨɜɚɧɢɢ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɫɞɟɥɚɧ ɜɵɜɨɞ, ɱɬɨ ɫɤɚɪɦɥɢɜɚɧɢɟ ɰɟɨɥɢɬɨɜɨɣ ɞɨɛɚɜɤɢ ɜ ɞɨɡɟ 2 % ɤ ɫɭɯɨɦɭ ɜɟɳɟɫɬɜɭ ɪɚɰɢɨɧɚ ɜɫɨɫɬɚɜɟ ɤɨɧɰɟɧɬɪɚɬɨɜ ɩɪɢ ɨɬɤɨɪɦɟ ɠɟɪɟɛɹɬ ɭɥɭɱɲɚɟɬ
ɩɟɪɟɜɚɪɢɦɨɫɬɶ ɨɫɧɨɜɧɵɯ ɩɢɬɚɬɟɥɶɧɵɯ ɜɟɳɟɫɬɜ ɪɚɰɢɨɧɚ, ɭɜɟɥɢɱɢɜɚɟɬ ɨɬɥɨɠɟɧɢɹ ɚɡɨɬɚ ɧɚ 5-6 %,
ɩɨɜɵɲɚɟɬ ɦɹɫɧɵɟ ɤɚɱɟɫɬɜɚ, ɭɥɭɱɲɚɟɬ ɨɩɥɚɬɭ ɤɨɪɦɚ ɢ ɷɤɨɧɨɦɢɱɟɫɤɢ ɨɩɪɚɜɞɚɧɨ.
Ɉɫɧɨɜɧɨɣ ɡɚɞɚɱɟɣ ɩɪɢɦɟɧɟɧɢɹ ɦɨɧɝɨɥɶɫɤɢɯ ɰɟɨɥɢɬɨɜ ɜ ɧɚɲɢɯ ɨɩɵɬɚɯ ɛɵɥɨ ɢɡɭɱɟɧɢɟ ɫɥɟɞɭɸɳɢɯ ɜɨɩɪɨɫɨɜ:
1) ɤɚɤɨɜɨ ɜɥɢɹɧɢɟ ɰɟɨɥɢɬɨɜ ɧɚ ɫɟɤɪɟɬɨɪɧɨ-ɦɨɬɨɪɧɭɸ ɮɭɧɤɰɢɸ ɠɟɥɭɞɤɚ ɠɟɪɟɛɹɬ ɜ ɞɢɧɚɦɢɤɟ
ɩɢɳɟɜɚɪɟɧɢɹ?
2) ɤɚɤɢɟ ɢɡɦɟɧɟɧɢɹ ɧɚɫɬɭɩɚɸɬ ɜ ɠɟɥɭɞɤɟ, ɞɜɟɧɚɞɰɚɬɢɩɟɪɫɬɧɨɣ ɤɢɲɤɟ ɩɨɞ ɜɥɢɹɧɢɟɦ ɰɟɨɥɢɬɨɜ
ɩɪɢ ɝɚɫɬɪɨɷɧɬɟɪɢɬɟ ɠɟɪɟɛɹɬ?
Ɉɩɵɬɵ ɩɪɨɜɟɞɟɧɵ ɧɚ 4 ɡɞɨɪɨɜɵɯ ɠɟɪɟɛɹɬɚɯ ɢ 2 ɛɨɥɶɧɵɯ ɝɚɫɬɪɨɷɧɬɟɪɢɬɨɦ. Ⱦɨ ɢ ɩɨɫɥɟ ɞɚɱɢ
ɩɪɢɪɨɞɧɵɯ ɰɟɨɥɢɬɨɜ ɢɫɫɥɟɞɨɜɚɥɨɫɶɫɨɞɟɪɠɢɦɨɟ ɠɟɥɭɞɤɚɢɨɞɧɨɜɪɟɦɟɧɧɨɫɧɢɦɚɥɢɫɶɛɢɨɩɨɬɟɧɰɢɚɥɵɠɟɥɭɞɤɚ ɷɥɟɤɬɪɨɝɚɫɬɪɨɝɪɚɮɚɦɢ.
ɉɪɢɜɟɞɟɧɧɵɣ ɧɚɦɢ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɣ ɦɚɬɟɪɢɚɥ ɩɨ ɩɪɢɦɟɧɟɧɢɸ ɩɪɢɪɨɞɧɵɯ ɰɟɨɥɢɬɨɜ ɧɚ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɹɯ ɩɨɡɜɨɥɹɟɬ ɫɞɟɥɚɬɶ ɫɥɟɞɭɸɳɢɟ ɡɚɤɥɸɱɟɧɢɟ: ɱɟɪɟɡ 1 ɱɚɫ ɩɨɫɥɟ ɞɚɱɢ ɰɟɨɥɢɬɨɜ ɩɪɨɢɫɯɨɞɢɬ ɩɨɫɬɟɩɟɧɧɨɟ ɭɫɩɨɤɨɟɧɢɟ ɦɨɬɨɪɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɠɟɥɭɞɤɚ ɥɨɲɚɞɢ ɜ ɬɟɱɟɧɢɟ ɫɭɬɨɤ.
Ɉɛ ɷɬɨɦ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɩɨɫɬɟɩɟɧɧɨɟ ɫɧɢɠɟɧɢɟ ɜɫɟɯ ɩɨɤɚɡɚɬɟɥɟɣ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɢɯ ɩɨɬɟɧɰɢɚɥɨɜ ɠɟɥɭɞɤɚ ɢ ɞɜɟɧɚɞɰɚɬɢɩɟɪɫɬɧɨɣ ɤɢɲɤɢ. Ɍɨɧɭɫ ɦɵɲɰ ɠɟɥɭɞɤɚ ɫɨɯɪɚɧɹɟɬɫɹ, ɬ.ɟ. ɱɚɫɬɨɬɚ ɢɦɩɭɥɶɫɨɜ ɩɨɱɬɢ ɧɟ ɢɡɦɟɧɹɟɬɫɹ ɞɨ ɢ ɩɨɫɥɟ ɞɚɱɢ ɰɟɨɥɢɬɨɜ.
ȼ ɞɚɥɶɧɟɣɲɟɦ, ɜ ɫɜɹɡɢ ɫ ɧɟɩɪɨɞɨɥɠɢɬɟɥɶɧɵɦ ɭɫɩɨɤɚɢɜɚɸɳɢɦ ɢ ɜɹɠɭɳɢɦ ɞɟɣɫɬɜɢɟɦ ɩɪɢɪɨɞɧɨɝɨ ɰɟɨɥɢɬɚ ɦɨɬɨɪɧɚɹ ɞɟɹɬɟɥɶɧɨɫɬɶ ɜ ɬɟɱɟɧɢɟ ɫɭɬɨɤ ɜɨɫɫɬɚɧɚɜɥɢɜɚɟɬɫɹ ɞɨ ɢɫɯɨɞɧɨɝɨ ɭɪɨɜɧɹ. Ɂɚ
24 ɱɚɫɚ ɩɨɫɥɟ ɞɚɱɢ ɩɪɢɪɨɞɧɨɝɨ ɰɟɨɥɢɬɚ ɫɭɳɟɫɬɜɟɧɧɵɯ ɢɡɦɟɧɟɧɢɣ ɜ ɫɟɤɪɟɬɨɪɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ
ɠɟɥɭɞɤɚ ɧɟ ɩɪɨɢɫɯɨɞɢɬ. ɑɟɪɟɡ 48 ɱɚɫɨɜ ɩɨɫɥɟ ɩɪɢɟɦɚ ɰɟɨɥɢɬɚ ɨɛɳɚɹ ɤɢɫɥɨɬɧɨɫɬɶ ɩɨɧɢɠɚɥɚɫɶ ɧɚ
5–7 % ɩɪɢ ɨɞɧɨɜɪɟɦɟɧɧɨɦ ɪɨɫɬɟ ɩɟɪɟɜɚɪɢɜɚɸɳɟɣ ɫɢɥɵ ɫɨɞɟɪɠɢɦɨɝɨ ɠɟɥɭɞɤɚ (0,3-0,5 ɦɦ).
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɩɪɢɦɟɧɟɧɢɟ ɩɪɢɪɨɞɧɨɝɨ ɰɟɨɥɢɬɚ ɩɨɧɢɠɚɟɬ ɜ ɬɟɱɟɧɢɟ ɫɭɬɨɤ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɢɟ
ɩɨɬɟɧɰɢɚɥɵ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ, ɩɨɱɬɢ ɧɟɢɡɦɟɧɹɹ ɩɨɤɚɡɚɬɟɥɟɣ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ.
ɉɨɷɬɨɦɭ ɩɪɢɪɨɞɧɵɟ ɰɟɨɥɢɬɵɦɨɝɭɬ ɛɵɬɶ ɩɪɢɦɟɧɟɧɵ ɩɪɢ ɩɪɨɮɢɥɚɤɬɢɤɟ ɢ ɥɟɱɟɧɢɢ ɞɢɚɪɟɢ, ɝɚɫɬɪɨɷɧɬɟɪɢɬɨɜ ɢ ɩɪɢ ɨɫɬɪɨɦ ɪɚɫɲɢɪɟɧɢɢ ɠɟɥɭɞɤɚ ɥɨɲɚɞɟɣ, ɩɪɢ ɧɚɪɭɲɟɧɢɹɯ ɭ ɧɢɯ ɫɟɤɪɟɬɨɪɧɨ-ɦɨɬɨɪɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ.
Ⱥɤɬɢɜɢɡɚɰɢɹ ɢɧɬɟɧɫɢɜɧɨɫɬɢ ɨɤɢɫɥɢɬɟɥɶɧɵɯ ɩɪɨɰɟɫɫɨɜ ɜɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɦ ɬɪɚɤɬɟ ɥɨɲɚɞɟɣ, ɩɨɥɭɱɚɜɲɢɯ ɫ ɤɨɪɦɨɦ ɩɪɢɪɨɞɧɵɣ ɰɟɨɥɢɬ ɩɪɢɜɨɞɢɬ ɤ ɧɨɪɦɚɥɢɡɚɰɢɢ ɛɟɥɤɨɜɨɝɨ, ɭɝɥɟɜɨɞɧɨɝɨ ɢ
ɠɢɪɨɜɨɝɨ ɨɛɦɟɧɨɜ, ɧɚɪɭɲɟɧɧɵɯ ɜɫɥɟɞɫɬɜɢɢ ɢɧɬɨɤɫɢɤɚɰɢɢ ɨɪɝɚɧɢɡɦɚ.
ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɷɥɟɤɬɪɨɮɢɡɢɨɥɨɝɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ ɢɫɫɥɟɞɨɜɚɧɢɹ, ɧɚɪɹɞɭ ɫ ɩɚɬɨɦɨɪɮɨɥɨɝɢɱɟɫɤɢɦɢ ɞɚɧɧɵɦɢ, ɩɨɡɜɨɥɢɥɨ ɜɵɹɜɢɬɶ ɪɚɡɧɢɰɭ ɜ ɭɪɨɜɧɹɯ ɩɨɤɚɡɚɬɟɥɟɣ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ
ɠɟɥɭɞɤɚ ɢ ɤɢɲɟɱɧɢɤɚ ɠɢɜɨɬɧɵɯ ɤɨɧɬɪɨɥɶɧɨɣ ɢ ɨɩɵɬɧɨɣ ɝɪɭɩɩ. ɉɨɥɭɱɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɨ ɬɨɦ, ɱɬɨ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɚɹ ɚɤɬɢɜɧɨɫɬɶ ɠɟɥɭɞɤɚ ɥɨɲɚɞɟɣ ɩɪɢ ɨɫɬɪɨɦ ɪɚɫɲɢɪɟɧɢɢ
ɧɚɯɨɞɢɬɫɹ ɞɥɢɬɟɥɶɧɨɟ ɜɪɟɦɹ ɜ ɫɨɫɬɨɹɧɢɢ ɫɢɥɶɧɨɝɨ ɭɝɧɟɬɟɧɢɹ. ɉɪɢ ɩɪɢɦɟɧɟɧɢɢ ɜ ɤɚɱɟɫɬɜɟ ɥɟɱɟɛɧɨɝɨ ɫɪɟɞɫɬɜɚ ɩɪɢɪɨɞɧɨɝɨ ɰɟɨɥɢɬɚ ɭ ɥɨɲɚɞɟɣ ɩɪɨɢɫɯɨɞɢɬ ɛɨɥɟɟ ɭɫɤɨɪɟɧɧɨɟɜɨɫɫɬɚɧɨɜɥɟɧɢɟ ɪɚɧɟɟ
ɭɝɧɟɬɟɧɧɨɣ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ ɠɟɥɭɞɤɚ ɢ ɞɜɟɧɚɞɰɚɬɢɩɟɪɫɬɧɨɣ ɤɢɲɤɢ.
ɂɡɜɟɫɬɧɨ, ɱɬɨ ɫ ɩɨɦɨɳɶɸ ɷɥɟɤɬɪɨɮɢɡɢɨɥɨɝɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ (ɷɥɟɤɬɪɨɝɚɫɬɪɨɝɪɚɮɢɢ, ɷɥɟɤɬɪɨɷɧɬɟɪɨɝɪɚɮɢɢ, ɷɥɟɤɬɪɨɯɨɥɟɰɢɫɬɨɝɪɚɮɢɢ ɢ ɞɪ.) ɭɞɚɟɬɫɹ ɞɨɫɬɚɬɨɱɧɨ ɫ ɜɵɫɨɤɨɣ ɬɨɱɧɨɫɬɶɸ ɨɛɴɟɤɬɢɜɧɨ
ɨɰɟɧɢɜɚɬɶ ɢ ɨɛɧɚɪɭɠɢɜɚɬɶ ɪɚɡɥɢɱɧɵɟ ɪɚɫɫɬɪɨɣɫɬɜɚ ɦɨɬɨɪɢɤɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ ɩɪɢ
ɡɚɛɨɥɟɜɚɧɢɹɯ ɨɪɝɚɧɨɜ ɩɢɳɟɜɚɪɟɧɢɹ. ɗɬɢ ɦɟɬɨɞɵ ɩɨɡɜɨɥɹɸɬ ɜɵɹɜɢɬɶ ɬɨɧɤɢɟ ɦɟɯɚɧɢɡɦɵ ɞɟɣɫɬɜɢɹ
ɧɚ ɦɨɬɨɪɢɤɭ ɜɧɭɬɪɟɧɧɢɯ ɩɨɥɨɫɬɧɵɯ ɨɪɝɚɧɨɜ ɧɟɣɪɨɝɭɦɨɪɚɥɶɧɵɯ ɮɚɤɬɨɪɨɜ, ɚɞɟɤɜɚɬɧɵɯ ɢ ɧɟɚɞɟɤɜɚɬɧɵɯ ɪɚɡɞɪɚɠɢɬɟɥɟɣ, ɛɨɥɟɜɨɝɨ ɢ ɩɫɢɯɨɥɨɝɢɱɟɫɤɨɝɨ ɫɬɪɟɫɫɨɜ, ɮɚɪɦɚɤɨɥɨɝɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ.
ɋ ɷɬɨɣ ɩɨɡɢɰɢɢ ɦɨɬɨɪɢɤɭ ɨɪɝɚɧɨɜ ɩɢɳɟɜɚɪɟɧɢɹ ɦɨɠɧɨ ɪɚɫɫɦɚɬɪɢɜɚɬɶ ɤɚɤ ɦɟɯɚɧɢɡɦ ɨɛɳɟɣ
ɚɞɚɩɬɚɰɢɢ ɨɪɝɚɧɢɡɦɚ ɤ ɜɧɟɲɧɢɦ ɢ ɜɧɭɬɪɟɧɧɢɦ ɜɨɡɞɟɣɫɬɜɢɹɦ, ɩɪɢɡɜɚɧɧɨɣ ɧɚɪɹɞɭ ɫ ɞɪɭɝɢɦɢ ɫɢɫɬɟɦɚɦɢ ɩɨɞɞɟɪɠɢɜɚɬɶ ɝɨɦɟɨɫɬɚɡ.
253
ɉɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɡɦɟɧɟɧɢɹ, ɩɪɨɢɫɯɨɞɹɳɢɟ ɯɨɬɹ ɛɵ ɜ ɨɞɧɨɦ ɨɪɝɚɧɟ,ɭɱɚɫɬɜɭɸɳɟɦ ɜ ɩɢɳɟɜɚɪɟɧɢɢ, ɩɪɢɜɨɞɹɬ ɤ ɧɚɪɭɲɟɧɢɸ ɧɨɪɦɚɥɶɧɵɯ ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ ɜɡɚɢɦɨɨɬɧɨɲɟɧɢɣ ɨɪɝɚɧɨɜ ɩɢɳɟɜɚɪɢɬɟɥɶɧɨɣ ɫɢɫɬɟɦɵ ɜ ɰɟɥɨɦ. Ɍɟɫɧɵɟ ɜɡɚɢɦɨɨɬɧɨɲɟɧɢɹ ɦɟɠɞɭ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɦ ɬɪɚɤɬɨɦ ɢ
ɝɟɩɚɬɨɛɢɥɢɚɪɧɨɣ ɫɢɫɬɟɦɨɣ ɢɦɟɸɬ ɜɚɠɧɨɟ ɡɧɚɱɟɧɢɟ ɜ ɩɢɳɟɜɚɪɟɧɢɢ ɧɨɪɦɚɥɶɧɵɯ ɢ ɩɚɬɨɥɨɝɢɱɟɫɤɢɯ
ɫɨɫɬɨɹɧɢɹɯ ɨɪɝɚɧɢɡɦɚ. ɂɡɭɱɟɧɢɸ ɮɭɧɤɰɢɨɧɚɥɶɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɩɪɢ ɡɚɛɨɥɟɜɚɧɢɹɯ ɠɟɥɭɞɤɚ ɢ ɤɢɲɟɱɧɢɤɚ ɭɞɟɥɹɥɨɫɶ ɢ ɭɞɟɥɹɟɬɫɹ ɛɨɥɶɲɨɟ ɜɧɢɦɚɧɢɟ ɫɨ ɫɬɨɪɨɧɵ ɤɚɤ ɤɥɢɧɢɰɢɫɬɨɜ, ɬɚɤ ɢ ɭɱɟɧɵɯɷɤɫɩɟɪɢɦɟɧɬɚɬɨɪɨɜ. ɇɚ ɨɫɧɨɜɚɧɢɢ ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ ɢ ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɭ ɛɨɥɶɧɵɯ
ɥɨɲɚɞɟɣ ɫ ɩɚɬɨɥɨɝɢɟɣ ɜɵɹɜɥɟɧɵ ɫɬɪɭɤɬɭɪɧɵɟ ɢɡɦɟɧɟɧɢɹ ɜ ɫɥɢɡɢɫɬɨɣ ɨɛɨɥɨɱɤɟ ɠɟɥɭɞɤɚ ɢ ɞɜɟɧɚɞɰɚɬɢɩɟɪɫɬɧɨɣ ɤɢɲɤɢ ɩɨ ɬɢɩɭ ɨɫɬɪɨɝɨ ɷɧɞɨɝɟɧɧɨɝɨ ɝɚɫɬɪɨɷɧɬɟɪɢɬɚ, ɧɚɪɭɲɟɧɢɟ ɩɪɨɰɟɫɫɨɜ ɜɫɚɫɵɜɚɧɢɹ, ɮɟɪɦɟɧɬɨɨɛɪɚɡɨɜɚɧɢɹ, ɭɫɢɥɟɧɢɟ ɫɟɤɪɟɰɢɢ ɫɨɥɹɧɨɣ ɤɢɫɥɨɬɵ, ɨɛɭɫɥɨɜɥɟɧɧɵɟ ɧɚɪɭɲɟɧɢɟɦ
ɧɟɣɪɨɝɭɦɨɪɚɥɶɧɵɯ ɦɟɯɚɧɢɡɦɨɜ ɪɟɝɭɥɹɰɢɢ ɠɟɥɭɞɨɱɧɵɯ ɠɟɥɟɡ.
ȼɡɚɢɦɨɫɜɹɡɶ ɦɟɠɞɭ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɦ ɬɪɚɤɬɨɦ ɢɝɟɩɚɬɨɛɢɥɢɚɪɧɨɣ ɫɢɫɬɟɦɨɣ ɫɜɨɞɢɬɫɹ ɤ
ɬɨɦɭ, ɱɬɨ ɩɚɬɨɥɨɝɢɱɟɫɤɢɣ ɩɪɨɰɟɫɫ ɜ ɩɨɫɥɟɞɧɟɣ ɫɨɩɪɨɜɨɠɞɚɟɬɫɹ, ɩɨ ɞɚɧɧɵɦ ɷɥɟɤɬɪɨɝɚɫɬɪɨ- ɢ ɷɧɬɟɪɨɝɪɚɮɢɢ, ɧɚɪɭɲɟɧɢɟɦ ɦɨɬɨɪɧɨɣ ɮɭɧɤɰɢɢ ɠɟɥɭɞɤɚ ɢ ɤɢɲɟɱɧɢɤɚ. ȼ ɱɚɫɬɧɨɫɬɢ, ɜɵɹɜɥɟɧɨ ɪɟɡɤɨɟɭɝɧɟɬɟɧɢɟ ɞɜɢɝɚɬɟɥɶɧɨɣ ɚɤɬɢɜɧɨɫɬɢ ɠɟɥɭɞɤɚ ɢ ɞɜɟɧɚɞɰɚɬɢɩɟɪɫɬɧɨɣ ɤɢɲɤɢ ɭ ɥɨɲɚɞɟɣ.
ɉɨɥɨɠɢɬɟɥɶɧɨɟ ɜɥɢɹɧɢɟ ɩɪɢɪɨɞɧɨɝɨ ɰɟɨɥɢɬɚ ɧɚ ɬɟɱɟɧɢɟ ɜɨɫɫɬɚɧɨɜɢɬɟɥɶɧɵɯ ɩɪɨɰɟɫɫɨɜ ɜ ɠɟɥɭɞɤɟ, ɩɨɫɥɟ ɨɫɬɪɨɣ ɢɧɬɨɤɫɢɤɚɰɢɢ, ɜ ɧɚɲɢɯ ɨɩɵɬɚɯ ɧɟɨɛɯɨɞɢɦɨ ɫɜɹɡɵɜɚɬɶ ɫ ɧɨɪɦɚɥɢɡɚɰɢɟɣ ɭɝɧɟɬɟɧɧɵɯ ɦɨɬɨɪɧɨ-ɷɜɚɤɭɚɬɨɪɧɵɯ ɮɭɧɤɰɢɣ ɠɟɥɭɞɤɚ ɢ ɤɢɲɟɱɧɢɤɚ. ȼɨɫɫɬɚɧɨɜɥɟɧɢɟ ɭɪɨɜɧɹ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ ɩɟɪɟɱɢɫɥɟɧɧɵɯ ɨɪɝɚɧɨɜ ɤɚɤ ɩɨɤɚɡɚɬɟɥɟɣ ɢɯ ɞɜɢɝɚɬɟɥɶɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨ ɫɜɹɡɚɧɨ ɫ ɜɵɫɨɤɢɦ ɚɞɫɨɪɛɰɢɨɧɧɵɦ, ɢɨɧɨɨɛɦɟɧɧɵɦ ɢ ɛɢɨɤɚɬɚɥɢɱɟɫɤɢɦ ɫɜɨɣɫɬɜɨɦ
ɩɪɢɪɨɞɧɵɯ ɰɟɨɥɢɬɨɜ, ɤɨɬɨɪɵɟ ɚɤɬɢɜɧɨ ɪɟɚɥɢɡɭɸɬɫɹ ɜ ɭɫɥɨɜɢɹɯ ɫɪɟɞɵ ɠɟɥɭɞɤɚ ɢ ɤɢɲɟɱɧɢɤɚ.
ɂɡɦɟɧɟɧɢɟ ɤɢɫɥɨɬɧɨɫɬɢ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ ɜ ɫɬɨɪɨɧɭ ɟɝɨ ɫɧɢɠɟɧɢɹ ɧɚ ɮɨɧɟ ɩɚɬɨɥɨɝɢɢ
ɨɬɪɚɠɚɟɬɫɹ ɧɚ ɮɭɧɤɰɢɨɧɚɥɶɧɨɦ ɫɨɫɬɨɹɧɢɢ ɠɟɥɭɞɤɚ ɢ ɩɢɳɟɜɚɪɢɬɟɥɶɧɨɣ ɫɢɫɬɟɦɵ ɜ ɰɟɥɨɦ. ȼ ɩɟɪɜɭɸ
ɨɱɟɪɟɞɶ, ɚɤɬɢɜɢɡɚɰɢɹ ɦɨɬɨɪɢɤɢ ɠɟɥɭɞɤɚ ɥɨɲɚɞɟɣ ɛɥɚɝɨɞɚɪɹ ɫɭɳɟɫɬɜɟɧɧɨɣ ɨɛɪɚɬɧɨɣ ɡɚɜɢɫɢɦɨɫɬɢ
ɦɟɠɞɭ ɦɨɬɨɪɢɤɨɣ ɢ ɤɢɫɥɨɬɧɨɫɬɶɸ ɟɝɨ ɫɪɟɞɵ, ɱɬɨ ɜ ɧɚɲɢɯ ɨɩɵɬɚɯ ɛɵɥɨ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɨ ɩɪɢ ɩɨɦɨɳɢ ɦɟɬɨɞɚ ɷɥɟɤɬɪɨɝɚɫɬɪɨɝɪɚɮɢɢ. Ʉɪɨɦɟ ɬɨɝɨ, ɭɫɢɥɟɧɢɟ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ ɝɥɚɞɤɢɯ
ɦɵɲɰ ɠɟɥɭɞɤɚ ɦɨɠɟɬ ɩɪɨɢɫɯɨɞɢɬɶ ɜɫɥɟɞɫɬɜɢɟ ɩɨɜɵɲɟɧɢɹ ɤɨɧɰɟɧɬɪɚɰɢɢ ɢ ɜɫɚɫɵɜɚɟɦɨɫɬɢ ɢɨɧɨɜ
ɫɜɨɛɨɞɧɨɝɨ ɤɚɥɶɰɢɹ. ɉɨɷɬɨɦɭ ɪɚɧɟɟ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɧɨɟ ɧɚɦɢ ɪɟɡɤɨɟ ɭɝɧɟɬɟɧɢɟ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɨɣ
ɚɤɬɢɜɧɨɫɬɢ ɠɟɥɭɞɤɚ ɥɨɲɚɞɟɣ ɦɨɠɧɨ ɨɛɴɹɫɧɢɬɶ ɧɚɪɭɲɟɧɢɟɦ ɤɨɧɰɟɧɬɪɚɰɢɢ ɧɟɨɛɯɨɞɢɦɵɯ ɞɥɹ ɫɨɤɪɚɳɟɧɢɹ ɫɜɨɛɨɞɧɵɯ ɤɚɬɢɨɧɨɜ.
ɉɨɜɵɲɟɧɢɟ ɡɧɚɱɟɧɢɣ ɪɇ ɠɟɥɭɞɤɚ ɫɩɨɫɨɛɫɬɜɭɟɬ ɭɜɟɥɢɱɟɧɢɸ ɫɨɞɟɪɠɚɧɢɹ ɫɵɜɨɪɨɬɨɱɧɨɝɨ ɝɚɫɬɪɢɧɚ ɜ ɤɪɨɜɢ, ɨɬɬɟɤɚɸɳɟɣ ɨɬ ɠɟɥɭɞɤɚ. ɗɬɨɬ ɝɨɪɦɨɧ ɡɧɚɱɢɬɟɥɶɧɨ ɭɫɢɥɢɜɚɟɬ ɦɨɬɨɪɢɤɭ ɠɟɥɭɞɤɚ ɢ
ɤɢɲɟɱɧɢɤɚ, ɦɨɠɟɬ ɢɝɪɚɬɶ ɜɚɠɧɭɸ ɪɨɥɶ ɜ ɜɨɫɫɬɚɧɨɜɥɟɧɢɢ ɭɝɧɟɬɟɧɧɨɣ ɞɜɢɝɚɬɟɥɶɧɨɣ ɚɤɬɢɜɧɨɫɬɢ
ɝɥɚɞɤɨɦɵɲɟɱɧɵɯ ɜɧɭɬɪɟɧɧɢɯ ɨɪɝɚɧɨɜ ɭ ɥɨɲɚɞɟɣ.
ɗɮɮɟɤɬɢɜɧɨɫɬɶ ɮɚɪɦɚɤɨɬɟɪɚɩɢɢ ɩɪɢɪɨɞɧɵɦ ɰɟɨɥɢɬɨɦ ɩɪɢ ɨɫɬɪɨɦ ɪɚɫɲɢɪɟɧɢɢ ɠɟɥɭɞɤɚ ɥɨɲɚɞɟɣ, ɫɜɨɞɢɜɲɚɹɫɹ ɤ ɩɪɨɬɢɜɨɨɬɟɱɧɨɦɭ ɢ ɚɧɬɢɨɤɫɢɞɚɧɬɧɨɦɭ ɜɥɢɹɧɢɸɢ ɜ ɰɟɥɨɦ ɛɨɥɟɟ ɭɫɤɨɪɟɧɧɨɣ,
ɱɟɦ ɜ ɤɨɧɬɪɨɥɟ ɧɨɪɦɚɥɢɡɚɰɢɢ ɦɨɪɮɨɮɭɧɤɰɢɨɧɚɥɶɧɨɝɨ ɫɨɫɬɨɹɧɢɹ ɠɟɥɭɞɤɚ, ɩɨɤɚɡɚɬɟɥɟɣ ɛɢɨɷɥɟɤɬɪɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ, ɨɛɭɫɥɨɜɥɟɧɚ ɚɞɫɨɪɛɰɢɨɧɧɵɦɢ, ɢɨɧɨɨɛɦɟɧɧɵɦɢ ɢ ɛɢɨɤɚɬɚɥɢɱɟɫɤɢɦɢ ɫɜɨɣɫɬɜɚɦɢ.
ɊȿɁɍɅɖɌȺɌɕ ɂɋɋɅȿȾɈȼȺɇɂə ɂɇȾɂɄȺɇȺ ȼ ɆɈɑȿ
ɍ ɁȾɈɊɈȼɕɏ ɂ ȻɈɅɖɇɕɏ ɉɊɂ ɈɋɌɊɈɆ ɊȺɋɒɂɊȿɇɂɂ
ɀȿɅɍȾɄȺɆɈɇȽɈɅɖɋɄɂɏ ɅɈɒȺȾȿɃ
ɅɏȺɆɋȺɃɁɆȺȺ Ⱦ.1, ɌȺɊɇɍȿȼ Ⱥ.ɋ.2,
1Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ,
ɇɂɂ ɜɟɬɟɪɢɧɚɪɧɵɣ ɦɟɞɢɰɢɧɵ, ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ
2ɎȽȻɈɍ ȼɉɈ “Ȼɭɪɹɬɫɤɚɹ ɝɨɫɭɞɚɪɫɬɜɟɧɧɚɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ ɚɤɚɞɟɦɢɹ
ɢɦ. ȼ.Ɋ. Ɏɢɥɢɩɩɨɜɚ”, ɍɥɚɧ-ɍɞɷ, Ɋɨɫɫɢɹ, e-mail: Lkham7704@gmail.com
ȼ ɦɟɞɢɰɢɧɟ ɢ ɜɟɬɟɪɢɧɚɪɢɢ ɢɧɞɢɤɚɧɨɦ ɩɪɢɧɹɬɨ ɧɚɡɵɜɚɬɶ ɤɚɥɢɟɜɭɸ ɫɨɥɶ ɩɚɪɧɨɣ ɷɮɢɪɨɫɟɪɧɨɣ
ɤɢɫɥɨɬɵ ɢɧɞɨɤɫɢɥɚ, ɬɚɤ ɧɚɡɵɜɚɟɦɵɣ «ɦɨɱɟɜɨɣ ɢɧɞɢɤɚɧ» ɢɥɢ ɢɧɞɢɤɚɧ «ɤɪɨɜɢ».
ɂɧɞɨɤɫɢɥ ɨɛɪɚɡɭɟɬɫɹ ɡɚ ɫɱɟɬ ɚɦɢɧɨɤɢɫɥɨɬɵ ɬɪɢɩɬɨɮɚɧɚ (ɩɪɨɞɭɤɬɚ ɬɪɢɩɬɢɱɟɫɤɨɝɨ ɩɟɪɟɜɚɪɢɜɚɧɢɹ ɛɟɥɤɨɜ), ɞɚɸɳɟɝɨ ɜ ɤɢɲɟɱɧɢɤɟ ɠɢɜɨɬɧɵɯ ɢɧɞɨɥ ɢ ɫɤɚɬɨɥ ɩɨɞ ɞɟɣɫɬɜɢɟɦ ɩɪɨɰɟɫɫɨɜ ɝɧɢɟɧɢɹ.
ȼ ɧɨɪɦɟ ɨɛɪɚɡɨɜɚɧɢɟ ɢɧɞɨɥɚ ɩɪɨɢɫɯɨɞɢɬ ɜ ɬɨɥɫɬɨɣ ɤɢɲɤɟ ɡɚ ɫɱɟɬ ɧɟɛɨɥɶɲɨɝɨ ɤɨɥɢɱɟɫɬɜɚ ɚɦɢɧɨɤɢɫɥɨɬ, ɭɫɤɨɥɶɡɚɸɳɢɯ ɨɬ ɜɫɚɫɵɜɚɧɢɹ ɜ ɜɟɪɯɧɟɦ ɨɬɞɟɥɟ ɤɢɲɟɱɧɢɤɚ, ɚ ɩɪɢ ɩɚɬɨɥɨɝɢɱɟɫɤɢɯ ɭɫɥɨɜɢɹɯ
ɨɛɪɚɡɨɜɚɧɢɟ ɢɧɞɨɥɚ ɩɨɜɵɲɚɟɬɫɹ, ɨɫɨɛɟɧɧɨ ɩɪɢ ɤɚɪɞɢɨɩɢɥɨɪɨɫɩɚɡɦɚɯ ɠɟɥɭɞɤɚ ɢ ɯɢɦɨɫɬɚɡɚɯ ɤɢ254
ɲɟɱɧɢɤɚ. ȼɫɨɫɚɜɲɢɣɫɹ ɢɡ ɤɢɲɟɱɧɢɤɚ ɢɧɞɨɥ ɨɤɢɫɥɹɟɬɫɹ ɜ ɨɪɝɚɧɢɡɦɟ ɜ ɢɧɞɨɤɫɢɥ ɢ ɡɚɞɟɪɠɢɜɚɟɬɫɹ ɜ
ɩɟɱɟɧɢ, ɤɨɬɨɪɚɹ ɱɚɫɬɶɸ ɪɚɡɪɭɲɚɟɬ ɟɝɨ, ɱɚɫɬɶɸ ɨɛɪɚɡɭɟɬ ɩɚɪɧɨɟ ɫɨɟɞɢɧɟɧɢɟ ɫ ɫɟɪɧɨɣ ɤɢɫɥɨɬɨɣ ɢ ɜ
ɦɟɧɶɲɟɦ ɤɨɥɢɱɟɫɬɜɟ – ɫ ɝɥɸɤɭɪɨɧɨɜɨɣ ɤɢɫɥɨɬɨɣ. Ɍɨɥɶɤɨ ɜ ɜɢɞɟ ɷɬɢɯ ɩɚɪɧɵɯ ɫɨɟɞɢɧɟɧɢɣ ɢɧɞɨɤɫɢɥ
ɢ ɰɢɪɤɭɥɢɪɭɟɬ ɜ ɩɟɪɢɮɟɪɢɱɟɫɤɨɣ ɤɪɨɜɢ (ɢɧɞɢɤɚɧ ɤɪɨɜɢ) ɢ ɜɵɞɟɥɹɟɬɫɹ ɩɨɱɤɚɦɢ (ɦɨɱɟɜɨɣ ɢɧɞɢɤɚɧ). ɏɢɦɢɱɟɫɤɢɟ ɪɟɚɤɰɢɢ ɧɚ ɢɧɞɢɤɚɧ ɨɫɧɨɜɚɧɵ ɧɚ ɪɚɫɲɢɪɟɧɢɢ ɩɚɪɧɨɝɨ ɫɨɟɞɢɧɟɧɢɹ ɤɪɟɩɤɢɦɢ
ɤɢɫɥɨɬɚɦɢ ɢ ɨɤɢɫɥɟɧɢɟɦ ɢɧɞɨɤɫɢɥɚ ɜ ɫɢɧɟɟ ɢɧɞɢɝɨ ɢɥɢ ɧɚ ɨɛɪɚɡɨɜɚɧɢɟ ɤɪɚɫɧɨɝɨ ɢɧɞɢɝɨ.
ɍɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɦɨɱɚ ɬɪɚɜɨɹɞɧɵɯ ɠɢɜɨɬɧɵɯ ɫɨɞɟɪɠɢɬ ɡɧɚɱɢɬɟɥɶɧɨ ɛɨɥɶɲɟ ɢɧɞɢɤɚɧɚ, ɱɟɦ ɦɨɱɚ
ɱɟɥɨɜɟɤɚ; ɨɫɨɛɟɧɧɨ ɦɧɨɝɨ ɟɝɨ ɜ ɦɨɱɟ ɥɨɲɚɞɢ. Ʌɨɲɚɞɶ ɜɵɞɟɥɹɟɬ ɜ ɫɭɬɤɢ ɨɬ 0,78 ɞɨ 2,0 ɢɧɞɢɤɚɧɚ.
ɂɧɞɨɤɫɢɥ ɜɵɞɟɥɹɟɬɫɹ ɜ ɦɨɱɟ ɬɨɥɶɤɨ ɜ ɫɜɹɡɚɧɧɨɦ ɫɨɫɬɨɹɧɢɢ, ɝɥɚɜɧɵɦ ɨɛɪɚɡɨɦ, ɫ ɫɟɪɧɨɣ, ɜ ɦɟɧɶɲɟɣ ɫɬɟɩɟɧɢ ɫ ɝɥɸɤɭɪɨɧɨɜɨɣ ɤɢɫɥɨɬɨɣ; ɩɨɫɥɟɞɧɹɹ ɤɨɦɛɢɧɚɰɢɹ ɧɟɫɬɨɣɤɚ ɢ ɥɟɝɤɨ ɪɚɡɪɭɲɚɟɬɫɹ ɛɚɤɬɟɪɢɹɦɢ ɝɧɢɟɧɢɹ, ɩɨɷɬɨɦɭ ɩɪɢ ɢɡɛɵɬɤɟ ɜɵɞɟɥɟɧɢɹ ɝɥɸɤɭɪɨɧɨɜɨɝɨ ɫɨɟɞɢɧɟɧɢɹ ɦɨɱɚ ɜ ɨɬɞɟɥɶɧɵɯ
ɫɥɭɱɚɹɯ ɦɨɠɟɬ ɫɚɦɨɩɪɨɢɡɜɨɥɶɧɨ ɩɪɢ ɫɬɨɹɧɢɢ ɧɚ ɜɨɡɞɭɯɟ ɩɪɢɧɹɬɶ ɫɢɧɢɣ ɨɬɬɟɧɨɤ ɡɚ ɫɱɟɬ ɨɛɪɚɡɨɜɚɧɢɹ ɫɢɧɟɝɨ ɢɧɞɢɝɨ. ɉɚɬɨɥɨɝɢɱɟɫɤɚɹ ɝɢɩɟɪɢɧɞɢɤɚɧɭɪɢɹ ɧɚɛɥɸɞɚɟɬɫɹ ɩɪɢ ɜɫɟɜɨɡɦɨɠɧɵɯ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɵɯ ɧɟɩɪɨɯɨɞɢɦɨɫɬɹɯ.
Ƚɢɩɟɪɢɧɞɢɤɚɧɭɪɢɹ ɧɚɛɥɸɞɚɟɬɫɹ ɬɚɤɠɟ ɩɪɢ ɡɚɛɨɥɟɜɚɧɢɹɯ ɩɟɱɟɧɢ ɤɚɤ ɩɪɨɹɜɥɟɧɢɢ ɟɟ ɮɭɧɤɰɢɨɧɚɥɶɧɨɣ ɧɟɞɨɫɬɚɬɨɱɧɨɫɬɢ (ɰɢɪɪɨɡ, ɠɢɪɨɜɨɟ ɩɟɪɟɪɨɠɞɟɧɢɟ ɩɟɱɟɧɢ ɢ ɞɪ.).
Ɉɞɧɚɤɨ ɫɥɟɞɭɟɬ ɩɪɢɡɧɚɬɶ, ɱɬɨ ɭɫɥɨɜɢɹ ɜɵɞɟɥɟɧɢɹ ɢɧɞɢɤɚɧɚ ɧɟɞɨɫɬɚɬɨɱɧɨ ɢɡɭɱɟɧɵ. Ɋɟɚɤɰɢɢ
ɢɧɞɢɤɚɧɚ ɜ ɦɨɱɟ ɨɫɧɨɜɚɧɵ ɧɚ ɨɛɪɚɡɨɜɚɧɢɢ ɩɨɞ ɞɟɣɫɬɜɢɟɦ ɪɟɚɤɰɢɢ Ɉɛɟɪɦɟɣɪɚ, ɫɢɧɟɝɨ ɢɧɞɢɝɨ ɢ
ɢɡɜɥɟɱɟɧɢɢ ɟɝɨ ɯɥɨɪɨɮɨɪɦɨɦ – ɤɚɱɟɫɬɜɟɧɧɚɹ ɩɪɨɛɚ; ɤɨɥɢɱɟɫɬɜɟɧɧɨɟ ɨɩɪɟɞɟɥɟɧɢɟ ɨɫɧɨɜɚɧɨ ɧɚ ɩɟɪɟɜɟɞɟɧɢɢ ɢɧɞɢɤɚɧɚ ɫɧɚɱɚɥɚ ɜ ɢɧɞɢɝɨ, ɚ ɩɨɬɨɦ ɧɚ ɨɛɪɚɡɨɜɚɧɢɢ ɢɧɞɢɝɨɪɚɬɚ ɢ ɤɨɥɨɦɟɬɪɢɱɟɫɤɢɦ
ɨɩɪɟɞɟɥɟɧɢɟɦ ɟɝɨ.
Ⱦɢɧɚɦɢɤɚ ɩɨɤɚɡɚɬɟɥɟɣ ɫɨɞɟɪɠɚɧɢɹ ɢɧɞɢɤɚɧɚ ɜ ɦɨɱɟ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɟɣ ɢ ɩɪɢ
ɤɨɥɢɤɚɯ, ɩɪɟɞɫɬɚɜɥɟɧɚ ɜ ɬɚɛɥɢɰɟ 1.
Ɍɚɛɥɢɰɚ 1
ɉɨɤɚɡɚɬɟɥɢ ɫɨɞɟɪɠɚɧɢɹ ɢɧɞɢɤɚɧɚ ɜ ɦɨɱɟ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɟɣ ɢ ɩɪɢ ɤɨɥɢɤɚɯ (Ɇ±m) ɦɝ %
Ƚɪɭɩɩɚ ɠɢɜɨɬɧɵɯ
ɑɢɫɥɨ ɨɛɫɥɟɞɨɜɚɧɧɵɯ
ɠɢɜɨɬɧɵɯ (n)
12
Ʉɨɥɢɱɟɫɬɜɨ ɢɧɞɢɤɚɧɚ
ɦɝ %
10,6±0,24
Ʉɥɢɧɢɱɟɫɤɢɡɞɨɪɨɜɵɟɥɨɲɚɞɢ
Ȼɨɥɶɧɵɟ ɥɨɲɚɞɢ ɩɪɢ ɤɨɥɢɤɚɯ ɫ ɯɚɪɚɤɬɟɪɧɵɦɢ ɤɥɢɧɢɱɟɫɤɢɦɢ ɩɪɢɡɧɚɤɚɦɢ
9
28,1±0,13***
ɉɪɢɦɟɱɚɧɢɟ: ɡɧɚɱɟɧɢɹ ɞɨɫɬɨɜɟɪɧɵ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɦɢ ɥɨɲɚɞɶɦɢ: *** – ɩɪɢ Ɋ ” 0,001.
Ⱥɧɚɥɢɡɢɪɭɹ ɞɚɧɧɵɟ, ɩɪɟɞɫɬɚɜɥɟɧɧɵɟ ɜ ɬɚɛɥɢɰɟ 1, ɞɟɥɚɟɦ ɜɵɜɨɞ, ɱɬɨ ɫɨɞɟɪɠɚɧɢɟ ɢɧɞɢɤɚɧɚ ɜ
ɦɨɱɟ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɟɣ ɫɨɫɬɚɜɥɹɟɬ ɜ ɫɪɟɞɧɟɦ 10,6±0,24 ɦɝ %, ɭ ɛɨɥɶɧɵɯ ɠɢɜɨɬɧɵɯ
ɩɪɢ ɤɨɥɢɤɚɯ ɜ ɫɬɚɞɢɢ ɪɟɡɤɨɝɨ ɨɛɨɫɬɪɟɧɢɹ ɤɨɥɢɱɟɫɬɜɨ ɢɧɞɢɤɚɧɚ ɪɟɡɤɨ ɭɜɟɥɢɱɟɧɨ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ
ɧɨɪɦɨɣ ɢ ɫɨɫɬɚɜɥɹɟɬ ɜ ɫɪɟɞɧɟɦ 28,1±0,13ɦɝ % ɩɪɢ Ɋ<0,001.
Ɍɚɤɢɟ ɢɡɦɟɧɟɧɢɹ ɨɛɴɹɫɧɹɸɬɫɹ ɡɚ ɫɱɟɬ ɧɟɞɨɫɬɚɬɨɱɧɨɫɬɢ ɩɨɱɟɤ, ɜɫɥɟɞɫɬɜɢɟ ɛɪɨɞɢɥɶɧɵɯ ɩɪɨɰɟɫɫɨɜ ɢ ɢɧɬɨɤɫɢɤɚɰɢɢ ɫɨ ɫɬɨɪɨɧɵ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
Ⱦ.Ʌɯɚɦɫɚɣɡɦɚɚ ɗɬɢɨɩɚɬɨɝɟɧɟɡ, ɫɢɦɩɬɨɦɵ ɢ ɥɟɱɟɧɢɟ ɨɫɬɪɨɝɨ ɪɚɫɲɢɪɟɧɢɹ ɠɟɥɭɞɤɚ ɦɨɧɝɨɥɶɫɤɨɣ ɥɨɲɚɞɢ: Ⱦɢɫɫɟɪɬɚɰɢɹɧɚɫɨɢɫɤɚɧɢɟɭɱɟɧɨɣɫɬɟɩɟɧɢɞɨɤɬɨɪɚ ɜɟɬɟɪɢɧɚɪɧɵɯɧɚɭɤ/ -ɍɥɚɧ-ɍɞɷ., 2014. -193ɫ.
Ʉɨɧɞɪɚɯɢɧ ɂ.ɉ. Ʉɥɢɧɢɱɟɫɤɚɹ ɥɚɛɨɪɚɬɨɪɧɚɹ ɞɢɚɝɧɨɫɬɢɤɚ ɜ ɜɟɬɟɪɢɧɚɪɢɢ. Ɇ., 1985. -161ɫ.
ɎɂɁɂɄɈ-ɏɂɆɂɑȿɋɄɂȿ ɋȼɈɃɋɌȼȺ ɀȿɅɍȾɈɑɇɈȽɈ ɋɈɄȺ
ɍ ɄɅɂɇɂɑȿɋɄɂ ɁȾɈɊɈȼɕɏ ɂ ɉɊɂ ɈɋɌɊɈɆ ɊȺɋɒɂɊȿɇɂɂ
ɀȿɅɍȾɄȺɆɈɇȽɈɅɖɋɄɂɏ ɅɈɒȺȾȿɃ
ɅɏȺɆɋȺɃɁɆȺȺ Ⱦ.1, ɌȺɊɇɍȿȼ Ⱥ.ɋ.2,
1Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ,
ɇɂɂ ɜɟɬɟɪɢɧɚɪɧɵɣ ɦɟɞɢɰɢɧɵ, ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ
2ɎȽȻɈɍ ȼɉɈ “Ȼɭɪɹɬɫɤɚɹ ɝɨɫɭɞɚɪɫɬɜɟɧɧɚɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ ɚɤɚɞɟɦɢɹ
ɢɦ. ȼ.Ɋ. Ɏɢɥɢɩɩɨɜɚ”, ɍɥɚɧ-ɍɞɷ, Ɋɨɫɫɢɹ, e-mail: Lkham7704@gmail.com
Ɇɟɬɨɞɵ ɢɡɜɥɟɱɟɧɢɹ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ ɜɟɫɶɦɚ ɦɧɨɝɨɱɢɫɥɟɧɧɵ. ɇɚɢɛɨɥɟɟ ɭɞɨɛɧɵɦ ɹɜɥɹɟɬɫɹ ɦɟɬɨɞ ɧɟɩɪɟɪɵɜɧɨɝɨ ɢɡɜɥɟɱɟɧɢɹ ɫɨɞɟɪɠɢɦɨɝɨ ɫ ɪɚɡɞɟɥɟɧɢɟɦ ɟɝɨ ɧɚ 15-ɦɢɧɭɬɧɵɟ ɮɪɚɤɰɢɢ
ɜ ɬɟɱɟɧɢɟ ɨɞɧɨɝɨ ɱɚɫɚ ɩɪɢ ɫɬɢɦɭɥɢɪɨɜɚɧɧɨɣ ɫɟɤɪɟɰɢɢ.
255
Ɋɚɡɞɟɥɟɧɢɟ ɨɬɤɚɱɢɜɚɟɦɨɝɨ ɢɡ ɠɟɥɭɞɤɚ ɫɨɞɟɪɠɢɦɨɝɨ ɧɚ ɨɬɞɟɥɶɧɵɟ 15-ɦɢɧɭɬɧɵɟ ɩɨɪɰɢɢ ɩɨɡɜɨɥɢɥɨ ɨɫɭɳɟɫɬɜɢɬɶ ɛɨɥɟɟ ɬɳɚɬɟɥɶɧɵɣ ɚɧɚɥɢɡ ɩɨɤɚɡɚɬɟɥɟɣ ɤɚɤ ɜ ɦɟɠɩɢɳɟɜɚɪɢɬɟɥɶɧɨɦ ɩɟɪɢɨɞɟ ɢɥɢ
ɧɚɬɨɳɚɤɨɜɨɣ ɩɨɪɰɢɢ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ ɛɚɡɚɥɶɧɨɣ ɫɟɤɪɟɰɢɢ, ɬɚɤ ɢ ɩɨɫɥɟ ɷɧɬɟɪɚɥɶɧɨɝɨ
ɢɥɢ ɩɚɪɟɧɬɟɪɚɥɶɧɨɝɨ ɪɚɡɞɪɚɠɢɬɟɥɹ ɠɟɥɟɡ ɠɟɥɭɞɤɚ ɩɪɢ ɫɬɢɦɭɥɢɪɨɜɚɧɧɨɣ ɫɟɤɪɟɰɢɢ.
Ɇɵ ɩɨɥɶɡɨɜɚɥɢɫɶ ɧɨɫɨɩɢɳɟɜɨɞɧɵɦ ɡɨɧɞɨɦ ɞɥɹ ɜɫɟɫɬɨɪɨɧɧɟɝɨ ɢɡɭɱɟɧɢɹ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ
ɭ ɡɞɨɪɨɜɵɯ ɢ ɛɨɥɶɧɵɯ ɥɨɲɚɞɟɣ.
ɀɟɥɭɞɨɱɧɨɟ ɫɨɞɟɪɠɢɦɨɟ ɩɨɥɭɱɚɥɢ ɧɚɬɨɳɚɤ ɢ ɮɪɚɤɰɢɨɧɧɨ ɩɨɫɥɟ ɞɚɱɢ ɩɪɨɛɧɨɝɨ ɷɧɬɟɪɚɥɶɧɨɝɨ
ɪɚɡɞɪɚɠɢɬɟɥɹ 5 %-ɧɨɝɨ ɫɩɢɪɬɨɜɨɝɨ ɪɚɫɬɜɨɪɚ ɜ ɤɨɥɢɱɟɫɬɜɟ ɨɞɧɨɝɨ ɥɢɬɪɚ, ɱɬɨɛɵ ɢɦɟɬɶ ɩɪɟɞɫɬɚɜɥɟɧɢɟ ɨ ɫɬɢɦɭɥɢɪɨɜɚɧɧɨɣ ɫɟɤɪɟɰɢɢ ɩɪɢ ɱɚɫɨɜɨɦ ɧɚɩɪɹɠɟɧɢɢ.
ɍɫɬɚɧɨɜɥɟɧɧɵɟ ɩɨɤɚɡɚɬɟɥɢ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɨɣ ɮɭɧɤɰɢɢ ɠɟɥɭɞɤɚ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ
ɥɨɲɚɞɟɣ ɫɥɭɠɢɥɢ ɤɨɧɬɪɨɥɟɦ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ ɛɨɥɶɧɵɦ ɩɪɢ ɈɊɀ.
ɋɪɟɞɧɢɟ ɩɨɤɚɡɚɬɟɥɢ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɨɣ ɮɭɧɤɰɢɢ ɠɟɥɟɡ ɠɟɥɭɞɤɚ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ
ɥɨɲɚɞɟɣ ɜ ɦɟɠɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ ɢ ɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ ɩɟɪɢɨɞɵ ɩɪɢɜɟɞɟɧɵ ɜ ɬɚɛɥɢɰɟ 1.
ɂɡ ɬɚɛɥɢɰɵ ɜɢɞɧɨ, ɱɬɨ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɟɣ ɩɨɫɥɟ ɞɟɣɫɬɜɢɹ 5 %-ɧɨɝɨ ɫɩɢɪɬɨɜɨɝɨ
ɪɚɫɬɜɨɪɚ ɠɟɥɭɞɨɱɧɚɹ ɫɟɤɪɟɰɢɹ ɭɫɢɥɢɜɚɟɬɫɹ. Ɍɚɤ, ɜ ɫɬɢɦɭɥɢɪɨɜɚɧɧɨɦ ɠɟɥɭɞɨɱɧɨɦ ɫɨɞɟɪɠɢɦɨɦ ɜ
ɩɨɪɰɢɹɯ ɩɪɢ ɱɚɫɨɜɨɦ ɧɚɩɪɹɠɟɧɢɢ ɨɛɴɟɦ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ ɭɜɟɥɢɱɢɜɚɟɬɫɹ ɜ ɩɟɪɜɨɣ ɢ ɜɬɨɪɨɣ
ɩɨɪɰɢɹɯ, ɚ ɜ ɬɪɟɬɶɟɣ ɢ ɜ ɱɟɬɜɟɪɬɨɣ ɩɨɪɰɢɹɯ ɡɧɚɱɢɬɟɥɶɧɨ ɭɦɟɧɶɲɚɟɬɫɹ ɢ ɧɚɯɨɞɢɬɫɹ ɧɢɠɟ, ɱɟɦ ɨɛɴɟɦ ɫɟɤɪɟɰɢɢ ɧɚɬɨɳɚɤ (Ɋ<0,001).
ɋɪɚɜɧɢɜɚɹ ɪɟɡɭɥɶɬɚɬɵ ɨɛɴɟɦɚ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ ɩɪɢ ɱɚɫɨɜɨɦ ɧɚɩɪɹɠɟɧɢɢ ɫ ɨɛɴɟɦɨɦ ɧɚɬɨɳɚɤɨɜɵɯ ɩɨɪɰɢɣ, ɫɥɟɞɭɟɬ ɫɤɚɡɚɬɶ, ɱɬɨ ɜɵɪɚɛɨɬɤɚ ɠɟɥɭɞɨɱɧɨɝɨ ɫɟɤɪɟɬɚ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ
ɥɨɲɚɞɟɣ ɭɜɟɥɢɱɢɥɚɫɶ ɜ 2,4-3 ɪɚɡɚ.
Ɍɚɛɥɢɰɚ 1
ɉɨɤɚɡɚɬɟɥɢ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɨɣ ɮɭɧɤɰɢɢ ɠɟɥɭɞɤɚ ɜ ɦɟɠɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ
ɢ ɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ ɩɟɪɢɨɞɵ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɟɣ (Ɇ±m ; n=11)
ɉɟɪɢɨɞɫɟɤɪɟɰɢɢ
ɉɨɫɥɟ ɞɚɱɢ ɷɧɬɟɪɚɥɶɧɨɝɨ ɪɚɡɞɪɚɠɢɬɟɥɹ ɜ ɩɨɪɰɢɹɯ
ɩɪɢ ɱɚɫɨɜɨɦ ɧɚɩɪɹɠɟɧɢɢ
ɍ ɡɞɨɪɨɜɵɯ
ɠɢɜɨɬɧɵɯ ɛɟɡ
ɷɧɬɟɪɚɥɶɧɨɝɨ
ɪɚɡɞɪɚɠɢɬɟɥɹ
1
2
3
4
Ɉɛɴɟɦ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ, ɦɥ
758±21,2
1459±22,3***
806±20,4
343±19,6***
202±21,9***
ɉɨɤɚɡɚɬɟɥɶ ɪɇ, ɟɞ.
3,7±0,21
2,1±0,14***
2,6±0,47*
4,2±0,32
5,3±0,21***
ɋɜɨɛɨɞɧɚɹ ɯɥɨɪɢɫɬɨ ɜɨɞɨɪɨɞɧɚɹ ɤɢɫɥɨɬɚ, ɦɦɨɥɶ/ɥ
12,4±0,74
51,9±0,47***
45,5±0,47***
21,9±0,62***
1,77±0,31***
ɋɜɹɡɚɧɧɚɹ ɯɥɨɪɢɫɬɨɜɨɞɨɪɨɞɧɚɹ ɤɢɫɥɨɬɚ, ɦɦɨɥɶ/ɥ
22,3±1,28
15,3±0,52***
5,6±0,79***
39,8±0,71***
19,4±1,16
Ɉɛɳɚɹ ɤɢɫɥɨɬɧɨɫɬɶ,
ɦɦɨɥɶ/ɥ
41,2±2,41
71,9±4,51***
71,5±0,68***
65,5±5,38**
21,9±2,19***
31,9±4,14
105,8±21,41**
58,9±4,39**
22,7±1,14
5,8±1,11***
ɉɨɤɚɡɚɬɟɥɶ
Ʉɢɫɥɨɬɧɚɹ ɩɪɨɞɭɤɰɢɹ,
ɦɨɥɶ/ɱɚɫ
ȼɫɟɝɨ ɩɨɫɥɟ ɫɬɢɦɭɥɹɰɢɢ 193,8±7,26
ɉɪɢɦɟɱɚɧɢɟ: – ɡɧɚɱɟɧɢɹ ɞɨɫɬɨɜɟɪɧɵ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫɨ ɡɧɚɱɟɧɢɟɦ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ ɛɟɡ ɷɧɬɟɪɚɥɶɧɨɝɨ ɪɚɡɞɪɚɠɢɬɟɥɹ: * – ɩɪɢ Ɋ <0,05; ** – ɩɪɢ Ɋ <0,01; *** – ɩɪɢ Ɋ <0,001.
ɉɪɢ ɫɬɢɦɭɥɢɪɨɜɚɧɢɢ ɫɟɤɪɟɰɢɢ 5 %-ɧɵɦ ɫɩɢɪɬɨɜɵɦ ɪɚɫɬɜɨɪɨɦ ɜ ɠɟɥɭɞɨɱɧɨɦ ɫɨɞɟɪɠɢɦɨɦ ɭ
ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɥɨɲɚɞɟɣ ɩɨɤɚɡɚɬɟɥɢ ɫɜɨɛɨɞɧɨɣ ɇɋl ɜ ɩɟɪɜɨɣ ɩɨɪɰɢɢ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ ɫɟɤɪɟɰɢɢ ɜ ɦɟɠɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ ɩɟɪɢɨɞ ɭɜɟɥɢɱɢɥɢɫɶ ɜ 4 ɪɚɡɚ, ɜɨ ɜɬɨɪɨɣ ɜ 3,5 ɪɚɡɚ, ɜ ɬɪɟɬɶɟɣ ɜ 1,5
ɪɚɡɚ, ɚ ɜ ɱɟɬɜɟɪɬɨɣ ɨɧɚ ɩɨɱɬɢ ɩɨɥɧɨɫɬɶɸ ɨɬɫɭɬɫɬɜɭɟɬ. ɗɬɨ ɫɜɹɡɚɧɨ ɫ ɭɫɢɥɟɧɢɟɦ ɮɚɤɬɨɪɚ ɡɚɳɢɬɵ
ɩɢɳɟɜɚɪɢɬɟɥɶɧɨɣ ɫɢɫɬɟɦɵ ɧɚɞ ɮɚɤɬɨɪɨɦ ɚɝɪɟɫɫɢɢ ɩɪɢ ɩɨɜɵɲɟɧɢɢ ɤɨɧɰɟɧɬɪɚɰɢɢ ɫɜɨɛɨɞɧɨɣ ɇɋl
ɢ, ɜɨɡɦɨɠɧɨ, ɫ ɨɤɨɧɱɚɧɢɟɦ ɚɤɬɢɜɧɨɝɨ ɞɟɣɫɬɜɢɹ ɫɟɤɪɟɬɨɝɟɧɚ.
ɉɨɤɚɡɚɬɟɥɢ ɧɚɥɢɱɢɹ ɫɜɹɡɚɧɧɨɣ ɫɨɥɹɧɨɣ ɤɢɫɥɨɬɵ ɩɪɢ ɱɚɫɨɜɨɦ ɧɚɩɪɹɠɟɧɢɢ ɩɨɫɥɟ ɫɬɢɦɭɥɹɰɢɢ
5 %-ɧɵɦ ɫɩɢɪɬɨɜɵɦ ɪɚɫɬɜɨɪɨɦ, ɤɚɤ ɩɪɚɜɢɥɨ, ɢɡɦɟɧɹɟɬɫɹ, ɨɞɧɨɜɪɟɦɟɧɧɨ ɫɨ ɫɜɨɛɨɞɧɨɣ ɇɋl ɭɜɟɥɢɱɢɜɚɟɬɫɹ ɫɜɹɡɚɧɧɚɹ ɇɋl ɢ ɧɚɨɛɨɪɨɬ.
ɉɨɤɚɡɚɬɟɥɢ, ɯɚɪɚɤɬɟɪɢɡɭɸɳɢɟ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɭɸ ɮɭɧɤɰɢɸ ɠɟɥɟɡ ɠɟɥɭɞɤɚ ɭ ɫɩɨɧɬɚɧɧɨ
ɛɨɥɶɧɵɯ ɩɪɢ ɤɨɥɢɤɚɯ ɥɨɲɚɞɟɣ, ɩɪɟɞɫɬɚɜɥɟɧɵ ɜ ɬɚɛɥɢɰɟ 2.
256
Ɍɚɛɥɢɰɚ 2
ɉɨɤɚɡɚɬɟɥɢ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɨɣ ɮɭɧɤɰɢɢ ɠɟɥɭɞɤɚ ɜ ɦɟɠɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ
ɢ ɩɢɳɟɜɚɪɢɬɟɥɶɧɵɣ ɩɟɪɢɨɞɵ ɩɪɢ ɨɫɬɪɨɦ ɪɚɫɲɢɪɟɧɢɢ ɠɟɥɭɞɤɚ ɭ ɥɨɲɚɞɟɣ (Ɇ±m; n=9)
ɉɟɪɢɨɞɫɟɤɪɟɰɢɢ
ɇɚɬɨɳɚɤ
ɉɨɫɥɟ ɞɚɱɢ ɷɧɬɟɪɚɥɶɧɨɝɨ ɪɚɡɞɪɚɠɢɬɟɥɹ ɜ ɩɨɪɰɢɹɯ ɩɪɢ ɱɚɫɨɜɨɦ
ɧɚɩɪɹɠɟɧɢɢ
1
2
3
4
Ɉɛɴɟɦ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ, ɦɥ
1879±2,6
1545±2.2***
1235±2,5***
889±2,7***
361±1,41***
ɉɨɤɚɡɚɬɟɥɶ ɪɇ, ɟɞ.
2,2±0,11
2,1±0,11
1,9±0,14
2,4±0,26
3,2±0,17**
ɋɜɨɛɨɞɧɚɹ ɯɥɨɪɢɫɬɨɜɨɞɨɪɨɞɧɚɹ ɤɢɫɥɨɬɚ, ɦɦɨɥɶ/ɥ
23,2±0,10
38,9±2,09***
38,8±2,01***
38,6±2,17***
14,3±1,13***
ɉɨɤɚɡɚɬɟɥɶ
ɋɜɹɡɚɧɧɚɹ ɯɥɨɪɢɫɬɨɜɨɞɨɪɨɞɧɚɹ ɤɢɫɥɨɬɚ, ɦɦɨɥɶ/ɥ
46,5±2,21
82,3±8,18
169,7±24,2
53,9±2,14*
49,2±3,07
48,8±2,19
45,5±1,18
Ɉɛɳɚɹ ɤɢɫɥɨɬɧɨɫɬɶ, ɦɦɨɥɶ/ɥ
116,1±5,04**
95,1±8,02
90,1±7,26
62,7±5,7
165,3±23,7
122,1±12,4
85,6±9,01**
26,8±1,01***
Ʉɢɫɥɨɬɧɚɹ ɩɪɨɞɭɤɰɢɹ, ɦɨɥɶ/ɱɚɫ
ȼɫɟɝɨɩɨɫɥɟɫɬɢɦɭɥɹɰɢɢ 398,7±10,17
ɉɪɢɦɟɱɚɧɢɟ: ɡɧɚɱɟɧɢɹ ɞɨɫɬɨɜɟɪɧɵ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫɨ ɡɧɚɱɟɧɢɟɦ ɧɚɬɨɳɚɤ: * – ɩɪɢ Ɋ < 0,05; ** – ɩɪɢ Ɋ < 0,01; *** – ɩɪɢ
Ɋ < 0,001
ɂɡ ɚɧɚɥɢɡɚ ɞɚɧɧɨɣ ɬɚɛɥɢɰɵ ɯɨɪɨɲɨ ɜɢɞɧɨ, ɱɬɨ ɨɛɴɟɦ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ ɩɨɫɥɟ ɫɬɢɦɭɥɢɪɨɜɚɧɢɹ 5 %-ɧɵɦ ɫɩɢɪɬɨɜɵɦ ɪɚɫɬɜɨɪɨɦ ɜ ɩɨɪɰɢɹɯ ɛɨɥɶɧɵɯ ɥɨɲɚɞɟɣ ɩɪɢ ɱɚɫɨɜɨɦ ɧɚɩɪɹɠɟɧɢɢ
ɛɨɥɶɲɟ, ɱɟɦ ɭ ɤɨɧɬɪɨɥɶɧɵɯ ɠɢɜɨɬɧɵɯ. Ɋɚɡɧɢɰɚ ɫɬɚɬɢɫɬɢɱɟɫɤɢ ɞɨɫɬɨɜɟɪɧɚ (Ɋ < 0,001).
ȼɦɟɫɬɟ ɫ ɬɟɦ ɨɛɴɟɦ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ ɜ ɩɟɪɜɨɣ ɮɪɚɤɰɢɢ ɭ ɛɨɥɶɧɵɯ ɥɨɲɚɞɟɣ ɩɨɫɥɟ ɫɬɢɦɭɥɹɰɢɢ 5 %-ɧɵɦ ɫɩɢɪɬɨɜɵɦ ɪɚɫɬɜɨɪɨɦ ɭɦɟɧɶɲɢɥɫɹ ɩɪɢɦɟɪɧɨ ɧɚ 10 % ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ ɧɚɬɨɳɚɤɨɜɨɣ
ɮɪɚɤɰɢɢ, ɬɨɝɞɚ ɤɚɤ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ ɨɛɴɟɦ ɫɨɞɟɪɠɢɦɨɝɨ ɭɜɟɥɢɱɢɥɫɹ ɜ 1,2 ɪɚɡɚ.
ɍ ɥɨɲɚɞɟɣ ɩɪɢ ɈɊɀ ɠɟɥɟɡɢɫɬɵɣ ɚɩɩɚɪɚɬ ɠɟɥɭɞɤɚ ɧɚɯɨɞɢɬɫɹ ɜ ɜɨɡɛɭɠɞɟɧɧɨɦ ɫɨɫɬɨɹɧɢɢ, ɚ ɭ
ɡɞɨɪɨɜɵɯ – ɜ ɢɧɟɪɬɧɨɦ, ɱɬɨ ɭɤɚɡɵɜɚɟɬ ɧɚ ɩɪɚɤɬɢɱɟɫɤɭɸ ɰɟɧɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ 5 %-ɧɨɝɨ ɫɩɢɪɬɨɜɨɝɨ ɪɚɫɬɜɨɪɚ ɜ ɤɚɱɟɫɬɜɟ ɷɧɬɟɪɚɥɶɧɨɝɨ ɪɚɡɞɪɚɠɢɬɟɥɹ ɠɟɥɭɞɨɱɧɨɣ ɫɟɤɪɟɰɢɢ.
ɉɪɢ ɫɬɢɦɭɥɢɪɨɜɚɧɢɢ ɫɟɤɪɟɰɢɢ ɩɨɤɚɡɚɬɟɥɶ ɪɇ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ ɭ ɥɨɲɚɞɟɣ ɩɪɢ ɈɊɀ
ɩɨɱɬɢ ɜɨ ɜɫɟɯ ɩɨɪɰɢɹɯ ɧɚɯɨɞɢɬɫɹ ɧɚ ɧɢɡɤɨɦ ɭɪɨɜɧɟ. ɗɬɨ ɭɤɚɡɵɜɚɟɬ ɧɚ ɭɫɢɥɟɧɧɭɸ ɫɟɤɪɟɰɢɸ ɇɋl.
Ɉɛɳɚɹ ɤɢɫɥɨɬɧɨɫɬɶ ɠɟɥɭɞɨɱɧɨɝɨ ɫɨɞɟɪɠɢɦɨɝɨ ɩɪɢ ɈɊɀ ɜ 3 ɪɚɡɚ ɜɵɲɟ, ɱɟɦ ɭ ɠɢɜɨɬɧɵɯ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ (Ɋ < 0,01). ɉɪɢ ɤɨɥɢɤɚɯ ɭ ɛɨɥɶɧɵɯ ɥɨɲɚɞɟɣ ɩɨɤɚɡɚɬɟɥɢ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɨɣ
ɮɭɧɤɰɢɢ ɡɧɚɱɢɬɟɥɶɧɨ ɩɪɟɜɵɲɚɸɬ ɢɫɯɨɞɧɵɟ ɞɚɧɧɵɟ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ.
ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɷɧɬɟɪɚɥɶɧɨɝɨ 5 %-ɧɨɝɨ ɫɩɢɪɬɨɜɨɝɨ ɪɚɫɬɜɨɪɚ ɤɚɤ ɫɬɢɦɭɥɹɬɨɪɚ ɜ ɤɥɢɧɢɱɟɫɤɢɯ ɥɚɛɨɪɚɬɨɪɢɹɯ ɞɚɟɬ ɜɨɡɦɨɠɧɨɫɬɶ ɪɟɲɢɬɶ ɞɜɟ ɨɫɧɨɜɧɵɟ ɡɚɞɚɱɢ:
1) ɨɩɪɟɞɟɥɢɬɶ ɦɚɤɫɢɦɚɥɶɧɭɸ ɤɢɫɥɨɬɨɜɵɞɟɥɢɬɟɥɶɧɭɸ ɫɩɨɫɨɛɧɨɫɬɶ ɦɚɫɫɵ ɨɛɤɥɚɞɨɱɧɵɯ ɤɥɟɬɨɤ
ɠɟɥɭɞɤɚ;
2) ɩɨɥɭɱɢɬɶ ɛɨɥɟɟ ɢɥɢ ɦɟɧɟɟ ɱɢɫɬɨɟ, ɛɟɡ ɩɪɢɦɟɫɟɣ, ɠɟɥɭɞɨɱɧɨɟ ɫɨɞɟɪɠɢɦɨɟ ɞɥɹ ɢɫɫɥɟɞɨɜɚɧɢɹ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
Ⱦ. Ʌɯɚɦɫɚɣɡɦɚɚ ɗɬɢɨɩɚɬɨɝɟɧɟɡ, ɫɢɦɩɬɨɦɵ ɢ ɥɟɱɟɧɢɟ ɨɫɬɪɨɝɨ ɪɚɫɲɢɪɟɧɢɹ ɠɟɥɭɞɤɚ ɦɨɧɝɨɥɶɫɤɨɣ ɥɨɲɚɞɢ: Ⱦɢɫɫɟɪɬɚɰɢɹ ɧɚ ɫɨɢɫɤɚɧɢɟ ɭɱɟɧɨɣ ɫɬɟɩɟɧɢ ɞɨɤɬɨɪɚ ɜɟɬɟɪɢɧɚɪɧɵɯ ɧɚɭɤ/ -ɍɥɚɧ-ɍɞɷ., 2014. – 193 ɫ.
ɂɆɆɍɇɈɌɊɈɉɇȺə ȺɄɌɂȼɇɈɋɌɖ ɉɊȿɉȺɊȺɌȺ
“ɆɈɇȽȺɋɌɊɍɆ”
ɅɏȺɆɋȺɃɁɆȺȺ Ⱦ., ɍɇȾȺɊɆȺȺ Ɍ.,
Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ, ɇɂɂ ɜɟɬɟɪɢɧɚɪɧɵɣ ɦɟɞɢɰɢɧɵ,
ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ, e-mail: Lkham7704@gmail.com
ɗɤɫɩɟɪɢɦɟɧɬɵ ɩɨ ɢɡɭɱɟɧɢɸ ɩɪɹɦɨɣ ɢɦɦɭɧɨɬɪɨɩɧɨɣ ɚɤɬɢɜɧɨɫɬɢ ɩɪɟɩɚɪɚɬɚ “Ɇɨɧɝɚɫɬɪɭɦ” ɛɵɥɢ
ɩɪɨɜɟɞɟɧɵ ɧɚ 60 ɛɟɥɵɯ ɦɵɲɚɯBALB/c ɦɚɫɫɨɣ 20–22 ɝ.
ɉɪɹɦɚɹ ɢɦɦɭɧɨɬɪɨɩɧɚɹ ɚɤɬɢɜɧɨɫɬɶ ɨɰɟɧɢɜɚɥɚɫɶ ɩɨ ɤɨɥɢɱɟɫɬɜɭ ɫɩɥɟɧɨɰɢɬɨɜ ɢ ɩɨ ɢɧɞɟɤɫɭ ɫɟɥɟɡɟɧɤɢ, ɥɢɦɮɨɰɢɬɨɜ,ɩɨɤɚɡɚɬɟɥɹɦ ɫɵɜɨɪɨɬɨɱɧɵɯ ɢɦɦɭɧɨɝɥɨɛɭɥɢɧɨɜ Ɇ, G, Ⱥ ɢ ɤɥɟɬɨɱɧɨɣ ɩɨɩɭɥɹɰɢɢ CD4+T, CD8+T (ɬɚɛɥ. 1).
257
Ɍɚɛɥɢɰɚ 1
ɉɪɹɦɚɹ ɢɦɦɭɧɨɬɪɨɩɧɚɹ ɚɤɬɢɜɧɨɫɬɶ ɩɪɟɩɚɪɚɬɚ “Ɇɨɧɝɚɫɬɪɭɦ” (M±m)(n=5)
ɉɨɤɚɡɚɬɟɥɢ
Ƚɪɭɩɩɵ ɠɢɜɨɬɧɵɯ ɫ ɜɜɟɞɟɧɢɟɦ:
ɂɧɬɚɤɬɧɚɹ
Ʉɨɧɬɪɨɥɶɧɚɹ
(ɗȻ+ɜɨɞɵ)
(ɗȻ+ɋɚɥɢɦɨɧ)
Ɉɩɵɬɧɚɹ
(ɗȻ+Ɇɨɧɝɚɫɬɪɭɦ)
31.2±1.83
36.3±1.74
51.2±2.12
48.5±1.93
1565±59
2062±47
4122±32
3242±69
CD4+T ɤɥ./ɦɤɥ
148±5.6
386±3.9
589±7.8
405±8.9
CD8+T ɤɥ./ɦɤɥ
102±8.7
248±6.8
283±8.1
232±7.5
CD4/CD8
1.45±0.21
1.55±0.34
2.08±0.42
1.74±0.31
Ig M ɦɝ/ɞɥ
17.6±0.5
17.8±0.8
24.2±0.4
22.6±0.6
Ig G ɦɝ/ɞɥ
37.2±2.1
42.1±3.5
58.6±2.2
54.3±2.8
Ig A ɦɝ/ɞɥ
5.8±0.2
6.2±0.5
8.6±0.1
7.8±0.2
ɑɢɫɥɨ ɫɩɥɟɧɨɰɢɬɨɜ (106
ɤɥɟɬɤɚ/ɦɥ)
Ʌɢɦɮɨɰɢɬ ɤɥ./ɦɤɥ
ɉɪɢ ɨɩɪɟɞɟɥɟɧɢɢ ɨɫɧɨɜɧɵɯ ɩɨɤɚɡɚɬɟɥɟɣ ɤɥɟɬɨɱɧɨɝɨ ɢ ɝɭɦɨɪɚɥɶɧɨɝɨ ɢɦɦɭɧɢɬɟɬɚ ɱɟɪɟɡ 5 ɞɧɟɣ
ɩɨɫɥɟ ɢɦɦɭɧɢɡɚɰɢɢ 10 % – 0,2 ɦɥ ɷɪɢɬɪɨɰɢɬɚɦɢ ɛɚɪɚɧɚ (ɗȻ) ɧɚɛɥɸɞɚɥɚɫɶ ɫɥɟɞɭɸɳɚɹ ɤɚɪɬɢɧɚ
ɢɦɦɭɧɨɬɪɨɩɧɨɝɨ ɞɟɣɫɬɜɢɹ.
ɉɨɞ ɜɥɢɹɧɢɟɦ Ɇɨɧɝɚɫɬɪɭɦɚ ɦɚɫɫɚ ɫɟɥɟɡɟɧɤɢ ɢ ɤɨɥɢɱɟɫɬɜɨ ɫɩɥɟɧɨɰɢɬɨɜ ɭɜɟɥɢɱɢɥɢɫɶ ɧɚ 1,1
ɪɚɡɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɜ ɬɨ ɠɟ ɜɪɟɦɹ ɩɟɪɨɪɚɥɶɧɨɟ ɜɜɟɞɟɧɢɟ ɷɬɢɯ ɩɪɟɩɚɪɚɬɨɜ ɫɨɩɪɨɜɨɠɞɚɥɨɫɶ ɜ 0,6
ɪɚɡɨɜɵɦ ɭɜɟɥɢɱɟɧɢɟɦ ɤɨɥɢɱɟɫɬɜɚ ɥɢɦɮɨɰɢɬɚ.
Ɋɟɡɭɥɶɬɚɬɵ, ɩɨɥɭɱɟɧɧɵɟ ɜ ɯɨɞɟ ɞɚɧɧɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨɤɚɡɵɜɚɸɬ, ɱɬɨ Ɇɨɧɝɚɫɬɪɭɦ ɜ ɞɨɡɚɯ
50ɦɝ/ɤɝ ɨɛɥɚɞɚɟɬ ɜɵɪɚɠɟɧɧɵɦ ɢɦɦɭɧɨɬɪɨɩɧɵɦ ɞɟɣɫɬɜɢɟɦ.
ɍȾɄ 636.294.619:616.9–036.22
ɊɈɅɖ ȾȿɁɂɇɎȿɄɐɂɂ ɉɊɂ ɌɍȻȿɊɄɍɅȿɁȿ ɆȺɊȺɅɈȼ
ɆȺɄɈȽɈɇ Ⱥ.Ⱥ.,
ȼɫɟɪɨɫɫɢɣɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ,
ɝ. Ȼɚɪɧɚɭɥ, Ɋɨɫɫɢɣɫɤɚɹ ɮɟɞɟɪɚɰɢɹ, e-mail: wniipo@rambler.ru
Ɍɭɛɟɪɤɭɥɟɡ ɢɡɜɟɫɬɟɧ ɫ ɞɪɟɜɧɟɣɲɢɯ ɜɪɟɦɟɧ. Ʉɥɢɧɢɱɟɫɤɢɟ ɩɪɢɡɧɚɤɢ ɛɨɥɟɡɧɢ ɭ ɱɟɥɨɜɟɤɚ ɛɵɥɢ
ɨɩɢɫɚɧɵ Ƚɢɩɩɨɤɪɚɬɨɦ ɜ IV ɜ. ɞɨ ɧ. ɷ. [1]. Ɍɟɪɦɢɧ «ɬɭɛɟɪɤɭɥɟɡ» ɜɩɟɪɜɵɟ ɭɩɨɬɪɟɛɢɥ ɮɪɚɧɰɭɡɫɤɢɣ ɜɪɚɱ Ʌɚɷɧɧɟɤ (1819), ɚ ɡɚɪɚɡɢɬɟɥɶɧɨɫɬɶ ɛɨɥɟɡɧɢ ɞɨɤɚɡɚɥ ȼɢɥɥɟɦɟɧ ɀ. Ⱥ. (1865). ȼɨɡɛɭɞɢɬɟɥɹ
ɬɭɛɟɪɤɭɥɟɡɚ ɨɬɤɪɵɥ Ɋ. Ʉɨɯ (1882), ɨɧ ɠɟ ɢɡɝɨɬɨɜɢɥ ɜ 1890 ɝ. ɬɭɛɟɪɤɭɥɢɧ. Ɋɭɫɫɤɢɣ ɢɫɫɥɟɞɨɜɚɬɟɥɶ
Ƚɟɥɶɦɚɧ ɏ. ɂ. ɩɪɟɞɥɨɠɢɥ ɬɭɛɟɪɤɭɥɢɧ ɜ 1888 ɝ., ɧɨ ɨɩɭɛɥɢɤɨɜɚɥ ɪɚɛɨɬɭ ɥɢɲɶ ɜ 1892 ɝ. ȼ 1924 ɝ.
Ʉɚɥɶɦɟɬɬ ɢ Ƚɟɪɟɧ ɢɡɝɨɬɨɜɢɥɢ ɜɚɤɰɢɧɭ Ȼɐɀ ɞɥɹ ɩɪɨɮɢɥɚɤɬɢɤɢ ɬɭɛɟɪɤɭɥɟɡɚ [2]. Ʉ ɬɭɛɟɪɤɭɥɟɡɭ ɜɨɫɩɪɢɢɦɱɢɜɵ ɦɧɨɝɢɟ ɜɢɞɵ ɞɨɦɚɲɧɢɯ ɢ ɞɢɤɢɯ ɠɢɜɨɬɧɵɯ, ɜ ɬɨɦ ɱɢɫɥɟ ɩɪɨɦɵɫɥɨɜɵɟ ɡɜɟɪɢ ɢ ɩɬɢɰɵ
(ɛɨɥɟɟ 55 ɜɢɞɨɜ ɦɥɟɤɨɩɢɬɚɸɳɢɯ ɠɢɜɨɬɧɵɯ ɢ ɨɤɨɥɨ 25 ɜɢɞɨɜ ɩɬɢɰ). ɇɚɢɛɨɥɟɟ ɱɚɫɬɨ ɷɬɭ ɛɨɥɟɡɧɶ
ɪɟɝɢɫɬɪɢɪɭɸɬ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɫɜɢɧɟɣ, ɧɨɪɨɤ ɢ ɤɭɪ; ɪɟɠɟ ɭ ɤɨɡ, ɫɨɛɚɤ, ɭɬɨɤ ɢ ɝɭɫɟɣ;
ɨɱɟɧɶ ɪɟɞɤɨ ɭ ɨɜɟɰ, ɥɨɲɚɞɟɣ ɢ ɤɨɲɟɤ. ȼɵɫɨɤɨɱɭɜɫɬɜɢɬɟɥɶɧɵ ɤ ɬɭɛɟɪɤɭɥɟɡɭ ɨɛɟɡɶɹɧɵ. ɋɪɟɞɢ ɞɢɤɢɯ
ɤɨɩɵɬɧɵɯ ɱɚɳɟ ɛɨɥɟɸɬ ɦɚɪɚɥɵ. Ɍɭɛɟɪɤɭɥɟɡ ɠɢɜɨɬɧɵɯ ɪɚɫɩɪɨɫɬɪɚɧɹɟɬɫɹ ɫɪɚɜɧɢɬɟɥɶɧɨ ɦɟɞɥɟɧɧɨ.
ɗɬɨ ɨɛɴɹɫɧɹɟɬɫɹ ɞɥɢɬɟɥɶɧɨɫɬɶɸ ɢɧɤɭɛɚɰɢɨɧɧɨɝɨ ɩɟɪɢɨɞɚ ɛɨɥɟɡɧɢ (ɞɨ 45 ɞɧɟɣ). ɇɟɩɨɥɧɨɰɟɧɧɨɟ
ɤɨɪɦɥɟɧɢɟ, ɧɟɭɞɨɜɥɟɬɜɨɪɢɬɟɥɶɧɵɟ ɭɫɥɨɜɢɹ ɫɨɞɟɪɠɚɧɢɹ ɢ ɞɪɭɝɢɟ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɟ ɮɚɤɬɨɪɵ ɫɧɢɠɚɸɬ ɨɛɳɭɸ ɪɟɡɢɫɬɟɧɬɧɨɫɬɶ ɨɪɝɚɧɢɡɦɚ ɠɢɜɨɬɧɵɯ ɢ ɫɩɨɫɨɛɫɬɜɭɸɬ ɛɵɫɬɪɨɦɭ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɸ
ɛɨɥɟɡɧɢ. Ɉɩɪɟɞɟɥɟɧɧɨɣ ɫɟɡɨɧɧɨɫɬɢ ɜ ɩɪɨɹɜɥɟɧɢɢ ɷɩɢɡɨɨɬɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ ɩɪɢ ɬɭɛɟɪɤɭɥɟɡɟ ɧɟ
ɧɚɛɥɸɞɚɟɬɫɹ. Ȼɚɧɬ (1892) ɜɩɟɪɜɵɟ ɩɪɟɞɥɨɠɢɥ ɦɟɪɵ ɛɨɪɶɛɵ ɫ ɬɭɛɟɪɤɭɥɟɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɩɪɟɞɭɫɦɚɬɪɢɜɚɸɳɢɣ ɭɛɨɣ ɤɥɢɧɢɱɟɫɤɢ ɛɨɥɶɧɵɯ ɠɢɜɨɬɧɵɯ ɫ ɢɡɨɥɹɰɢɟɣ ɪɟɚɝɢɪɭɸɳɢɯ ɢ ɢɡɨɥɢɪɨɜɚɧɧɨɟ ɜɵɪɚɳɢɜɚɧɢɟ ɦɨɥɨɞɧɹɤɚ. ɗɬɨɬ ɦɟɬɨɞ ɫ ɩɟɪɟɦɟɧɧɵɦ ɭɫɩɟɯɨɦ ɩɪɢɦɟɧɹɥɢ ɜɨ ɦɧɨɝɢɯ
ɫɬɪɚɧɚɯ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɜ ɧɚɲɟɣ ɫɬɪɚɧɟ ɞɟɣɫɬɜɭɟɬ ɞɜɚ ɦɟɬɨɞɚ ɨɡɞɨɪɨɜɥɟɧɢɹ: ɫɢɫɬɟɦɚɬɢɱɟɫɤɨɟ
ɢɫɫɥɟɞɨɜɚɧɢɟ ɬɭɛɟɪɤɭɥɢɧɨɦ ɠɢɜɨɬɧɵɯ ɫ ɭɛɨɟɦ ɪɟɚɝɢɪɭɸɳɢɯ ɢ ɟɞɢɧɨɜɪɟɦɟɧɧɚɹ ɡɚɦɟɧɚ ɧɟɛɥɚɝɨɩɨɥɭɱɧɨɝɨ ɩɨɝɨɥɨɜɶɹ ɡɞɨɪɨɜɵɦɢ ɠɢɜɨɬɧɵɦɢ. ȼɫɬɪɟɱɚɸɬɫɹ ɫɥɭɱɚɢ ɩɨɜɬɨɪɧɨɣ ɜɫɩɵɲɤɢ ɛɨɥɟɡɧɢ
258
ɱɟɪɟɡ 3-5 ɥɟɬ. ɗɬɨ ɨɛɴɹɫɧɹɟɬɫɹ ɥɚɬɟɧɬɧɵɦ ɧɨɫɢɬɟɥɶɫɬɜɨɦ ɜɨɡɛɭɞɢɬɟɥɹ ɬɭɛɟɪɤɭɥɟɡɚ ɦɨɥɨɞɧɹɤɨɦ,
ɩɨɥɭɱɟɧɧɵɦ ɨɬ ɭɫɥɨɜɧɨ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ. Ɍɚɤ ɠɟ ɧɟ ɢɫɤɥɸɱɚɟɬɫɹ ɧɚɯɨɠɞɟɧɢɟ ɜ ɫɬɚɞɟ ɚɧɟɪɝɢɱɧɵɯ ɤ ɬɭɛɟɪɤɭɥɢɧɭ ɠɢɜɨɬɧɵɯ ɢ ɜɨɡɦɨɠɧɨɫɬɶɸ ɫɨɯɪɚɧɟɧɢɹ ɜɨɡɛɭɞɢɬɟɥɹ ɬɭɛɟɪɤɭɥɟɡɚ ɜ Ʌ-ɮɨɪɦɟ
[3]. ɉɨɥɹɤɨɜ Ⱥ.Ⱥ (1966) ɢ Ʉɨɥɵɱɟɜ ɇ.Ɇ (1992) ɫɱɢɬɚɸɬ, ɱɬɨ ɫɤɨɥɶɤɨ ɛɵ ɪɚɡ ɧɢ ɫɦɟɧɹɥɢ ɛɨɥɶɧɵɯ
ɠɢɜɨɬɧɵɯ ɡɞɨɪɨɜɵɦɢ, ɟɫɥɢ ɨɛɴɟɤɬɵ ɫɪɟɞɵ ɨɛɢɬɚɧɢɹ ɢɯ ɨɫɬɚɧɭɬɫɹ ɧɟɨɛɟɡɡɚɪɚɠɟɧɧɵɦɢ, ɜɧɨɜɶ ɪɚɡɦɟɳɟɧɧɵɟ ɠɢɜɨɬɧɵɟ ɜ ɬɚɤɢɯ ɭɫɥɨɜɢɹɯ, ɪɚɧɨ ɢɥɢ ɩɨɡɞɧɨ, ɡɚɛɨɥɟɜɚɸɬ ɬɭɛɟɪɤɭɥɟɡɨɦ.
ɋɨɝɥɚɫɧɨ Ʌɭɧɢɰɵɧɭ ȼ.Ƚ. ɩɪɨɢɫɯɨɠɞɟɧɢɟ ɢ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɬɭɛɟɪɤɭɥɟɡɚ ɦɚɪɚɥɨɜ ɛɟɪɟɬ ɫɜɨɟ
ɧɚɱɚɥɨ ɜɨ ɜɪɟɦɟɧɚ ɱɚɫɬɧɨɫɨɛɫɬɜɟɧɧɢɱɟɫɤɨɝɨ ɦɚɪɚɥɨɜɨɞɫɬɜɚ, ɤɨɝɞɚ ɦɚɪɚɥɵ ɫɨɞɟɪɠɚɥɢɫɶ ɫɨɜɦɟɫɬɧɨ
ɫ ɤɪɭɩɧɵɦ ɪɨɝɚɬɵɦ ɫɤɨɬɨɦ, ɫɪɟɞɢ ɤɨɬɨɪɨɝɨ ɬɭɛɟɪɤɭɥɟɡ ɢɦɟɥ ɲɢɪɨɤɨɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ [4].
ɇɚ ɪɨɥɶ ɞɟɡɢɧɮɟɤɰɢɢ ɜ ɛɨɪɶɛɟ ɫ ɬɭɛɟɪɤɭɥɟɡɨɦ ɭɤɚɡɵɜɚɥ ɟɳɟ Ɋ. Ʉɨɯ [5]. ɉɨɡɞɧɟɟ ɩɨɢɫɤɚɦɢ ɯɢɦɢɱɟɫɤɢɯ ɜɟɳɟɫɬɜ, ɫɩɨɫɨɛɧɵɯ ɨɛɟɡɜɪɟɞɢɬɶ ɦɢɤɨɛɚɤɬɟɪɢɢ ɬɭɛɟɪɤɭɥɟɡɚ, ɡɚɧɢɦɚɥɢɫɶ ɦɧɨɝɢɟ ɭɱɟɧɵɟ. Ɉɞɧɚɤɨ ɥɢɲɶ ɧɟɡɧɚɱɢɬɟɥɶɧɚɹ ɱɚɫɬɶ ɢɡɭɱɟɧɧɵɯ ɞɟɡɢɧɮɟɤɬɚɧɬɨɜ ɨɤɚɡɚɥɚɫɶ ɩɪɢɝɨɞɧɨɣ ɞɥɹ
ɨɛɟɡɜɪɟɠɢɜɚɧɢɹ ɜɨɡɛɭɞɢɬɟɥɹ ɬɭɛɟɪɤɭɥɟɡɚ. ɗɬɨ ɨɛɭɫɥɨɜɥɟɧɨ ɤɢɫɥɨɬɨɭɫɬɨɣɱɢɜɨɫɬɶɸ ɦɢɤɨɛɚɤɬɟɪɢɣ. ɇɚ ɬɨɬ ɦɨɦɟɧɬ ɬɨɥɶɤɨ ɚɝɪɟɫɫɢɜɧɵɟ ɤ ɜɧɟɲɧɟɣ ɫɪɟɞɟ ɞɟɡɢɧɮɟɤɬɚɧɬɵ ɛɵɥɢ ɫɩɨɫɨɛɧɵ ɨɛɟɡɜɪɟɞɢɬɶ ɦɢɤɨɛɚɤɬɟɪɢɢ ɬɭɛɟɪɤɭɥɟɡɚ. Ʉɥɢɦɦɟɪ Ɇ. (1931) ɭɫɬɚɧɨɜɢɥ, ɱɬɨ ɩɨɥɭɧɚɫɵɳɟɧɧɵɣ ɪɚɫɬɜɨɪ
ɤɪɟɡɨɥɚ ɭɛɢɜɚɟɬ ɦɢɤɨɛɚɤɬɟɪɢɢ ɜ ɬɟɱɟɧɢɟ 4-6 ɱɚɫɨɜ. Ɏɟɧɨɥ, ɤɪɟɡɨɥ ɢ ɢɯ ɩɪɨɢɡɜɨɞɧɵɟ ɩɨɜɪɟɠɞɚɸɬ
ɤɥɟɬɨɱɧɭɸ ɫɬɟɧɤɭ, ɚ ɡɚɬɟɦ ɢ ɛɟɥɤɢ ɦɢɤɪɨɛɧɨɣ ɤɥɟɬɤɢ. ɉɪɢ ɜɫɟɦ ɷɬɨɦ ɨɧɢ ɢɦɟɸɬ ɪɟɡɤɢɣ ɡɚɩɚɯ
ɢ ɹɜɥɹɸɬɫɹ ɹɞɨɜɢɬɵɦɢ ɜɟɳɟɫɬɜɚɦɢ, ɱɬɨ ɫɬɚɜɢɬ ɩɨɞ ɜɨɩɪɨɫ ɢɯ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɟ.
ɂɫɫɥɟɞɨɜɚɧɢɹ ȼɪɚɧɱɚɧ Ɂ.ɗ. (1957) ɞɨɤɚɡɚɥɢ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɫɦɟɫɢ 3 % ɮɨɪɦɚɥɶɞɟɝɢɞɚ ɫ 3 % ɟɞɤɢɦ
ɧɚɬɪɨɦ. Ⱦɚɧɧɚɹ ɫɦɟɫɶ ɩɪɢ ɪɚɫɯɨɞɟ 1 ɥ/ɦ2 ɜ ɬɟɱɟɧɢɟ 3 ɱɚɫɨɜ ɭɛɢɜɚɟɬ ɦɢɤɨɛɚɤɬɟɪɢɢ ɬɭɛɟɪɤɭɥɟɡɚ. ɗɬɨ
ɨɛɭɫɥɨɜɥɟɧɨ ɫɩɨɫɨɛɧɨɫɬɶɸ ɮɨɪɦɚɥɶɞɟɝɢɞɚ ɩɪɢɫɨɟɞɢɧɹɬɶɫɹ ɤ ɚɦɢɧɨɝɪɭɩɩɚɦ ɛɟɥɤɨɜ ɢ ɜɵɡɵɜɚɬɶ ɢɯ
ɞɟɧɚɬɭɪɚɰɢɸ[6].
Ⱦɪɭɝɨɣ ɫɩɨɫɨɛ ɞɟɡɢɧɮɟɤɰɢɢ ɩɨɱɜɵ ɷɬɨ ɩɟɪɟɤɚɩɵɜɚɧɢɟ ɟɟ ɫ ɯɥɨɪɧɨɣ ɢɡɜɟɫɬɶɸ. ɏɥɨɪɧɚɹ ɢɡɜɟɫɬɶ
– ɫɭɯɨɣ ɛɟɥɵɣ ɩɨɪɨɲɨɤ ɫ ɪɟɡɤɢɦ ɡɚɩɚɯɨɦ ɢ ɫɨɞɟɪɠɚɧɢɟɦ ɯɥɨɪɚ ɞɨ 28–38 %, ɛɵɫɬɪɨ ɬɟɪɹɸɳɢɣ
ɚɤɬɢɜɧɨɫɬɶ ɩɪɢ ɯɪɚɧɟɧɢɢ ɧɚ ɫɜɟɬɭ, ɜɨɡɞɭɯɟ ɢ ɜ ɩɪɢɫɭɬɫɬɜɢɢ ɜɥɚɝɢ. ɏɥɨɪɧɭɸ ɢɡɜɟɫɬɶ ɫɥɟɞɭɟɬ ɯɪɚɧɢɬɶ ɜ ɫɭɯɨɦ ɩɨɦɟɳɟɧɢɢ ɛɟɡ ɞɨɫɬɭɩɚ ɫɜɟɬɚ ɜ ɯɨɪɨɲɨ ɡɚɤɪɵɬɨɣ ɬɚɪɟ, ɚ ɪɚɫɬɜɨɪɵ – ɬɨɥɶɤɨ ɜ ɬɟɦɧɨɣ
ɛɭɬɵɥɢ. ɇɨ ɞɚɠɟ ɩɪɢ ɩɪɚɜɢɥɶɧɨɦ ɯɪɚɧɟɧɢɢ ɯɥɨɪɧɚɹ ɢɡɜɟɫɬɶ ɬɟɪɹɟɬ ɡɚ ɦɟɫɹɰ 1–3 % ɚɤɬɢɜɧɨɝɨ ɯɥɨɪɚ. ɏɥɨɪɧɚɹ ɢɡɜɟɫɬɶ, ɫɨɞɟɪɠɚɳɚɹ ɚɤɬɢɜɧɨɝɨ ɯɥɨɪɚ ɦɟɧɟɟ 15 %, ɧɟɩɪɢɝɨɞɧɚ ɞɥɹ ɩɪɨɜɟɞɟɧɢɹ ɞɟɡɢɧɮɟɤɰɢɢ. Ⱦɥɹ ɩɪɨɜɟɞɟɧɢɹ ɞɟɡɢɧɮɟɤɰɢɢ ɝɨɬɨɜɹɬ 10 %-ɧɵɣ ɨɫɜɟɬɥɟɧɧɵɣ ɪɚɫɬɜɨɪ ɯɥɨɪɧɨɣ ɢɡɜɟɫɬɢ.
Ⱦɥɹ ɷɬɨɝɨ ɤ 1 ɤɝ ɩɪɟɩɚɪɚɬɚ ɞɨɛɚɜɥɹɸɬ ɧɟɛɨɥɶɲɨɟ ɤɨɥɢɱɟɫɬɜɨ ɬɟɩɥɨɣ ɜɨɞɵ, ɪɚɡɦɟɲɢɜɚɸɬ ɞɟɪɟɜɹɧɧɨɣ ɥɨɩɚɬɤɨɣ ɢ ɞɨɜɨɞɹɬ ɜɨɞɨɣ ɞɨ ɨɛɴɟɦɚ 10 ɥ, ɡɚɤɪɵɜɚɸɬ ɢ ɨɫɬɚɜɥɹɸɬ ɧɚ ɫɭɬɤɢ ɜ ɬɟɦɧɨɦ ɦɟɫɬɟ.
Ɉɬɫɬɨɹɜɲɭɸɫɹ ɠɢɞɤɨɫɬɶ ɫɥɢɜɚɸɬ ɜ ɛɭɬɵɥɶ ɢɡ ɬɟɦɧɨɝɨ ɫɬɟɤɥɚ, ɤɨɬɨɪɭɸ ɭɤɭɩɨɪɢɜɚɸɬ ɞɟɪɟɜɹɧɧɨɣ
ɢɥɢ ɤɨɪɤɨɜɨɣ ɩɪɨɛɤɨɣ. ɉɨɥɭɱɟɧɧɵɣ ɬɚɤɢɦ ɨɛɪɚɡɨɦ 10 %-ɧɵɣ ɨɫɜɟɬɥɟɧɧɵɣ ɪɚɫɬɜɨɪ ɦɨɠɧɨ ɯɪɚɧɢɬɶ ɧɟ ɛɨɥɟɟ 5–6 ɞɧɟɣ. Ⱦɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɪɚɛɨɱɢɯ ɪɚɫɬɜɨɪɨɜ ɧɟɨɛɯɨɞɢɦɨɟ ɤɨɥɢɱɟɫɬɜɨ 10 %-ɧɨɝɨ
ɪɚɫɬɜɨɪɚ ɪɚɡɛɚɜɥɹɸɬ ɜɨɞɨɣ. ɇɚɩɪɢɦɟɪ, ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ 0,2 %-ɧɨɝɨ ɪɚɫɬɜɨɪɚ ɛɟɪɭɬ 200 ɦɥ 10 %ɧɨɝɨ ɪɚɫɬɜɨɪɚ ɯɥɨɪɧɨɣ ɢɡɜɟɫɬɢ ɢ ɫɦɟɲɢɜɚɸɬ ɫ 10 ɥ ɜɨɞɵ. Ɇɟɬɨɞɢɱɟɫɤɢɟ ɭɤɚɡɚɧɢɹ ɪɚɡɪɚɛɨɬɚɧɵ ɜɨ
ȼɫɟɫɨɸɡɧɨɦ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɨɦ ɢɧɫɬɢɬɭɬɟ ɞɟɡɢɧɮɟɤɰɢɢ ɢ ɫɬɟɪɢɥɢɡɚɰɢɢ [7].
Ɉɩɢɫɚɧɧɵɟ ɜɵɲɟ ɫɩɨɫɨɛɵ ɩɪɢɦɟɧɹɸɬɫɹ ɢ ɩɨ ɫɟɣ ɞɟɧɶ. ɗɬɨ ɨɛɭɫɥɨɜɥɟɧɨ ɢɯ ɩɪɨɫɬɨɬɨɣ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɢ ɞɟɲɟɜɢɡɧɨɣ ɦɚɬɟɪɢɚɥɚ, ɨɞɧɚɤɨ ɞɚɧɧɵɟ ɫɩɨɫɨɛɵ ɹɜɥɹɸɬɫɹ ɧɟ ɛɟɡɨɩɚɫɧɵɦɢ ɞɥɹ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ, ɬɚɤ ɤɚɤ ɮɟɧɨɥ, ɤɪɟɡɨɥ, ɟɞɤɢɣ ɧɚɬɪ ɢ ɯɥɨɪɧɚɹ ɢɡɜɟɫɬɶ ɹɜɥɹɸɬɫɹ ɹɞɨɜɢɬɵɦɢ ɜɟɳɟɫɬɜɚɦɢ ɞɥɹ ɠɢɜɨɬɧɵɯ ɢ ɪɚɫɬɟɧɢɣ, ɨɧɢ ɫɩɨɫɨɛɧɵ ɧɚɤɚɩɥɢɜɚɬɶɫɹ ɜ ɩɨɱɜɟ. Ʌɭɧɢɰɵɧ ȼ.Ƚ. ɨɛɨɫɧɨɜɚɥ
ɧɟɜɨɡɦɨɠɧɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ɫɯɟɦ ɞɟɡɢɧɮɟɤɰɢɢ ɩɪɢ ɬɭɛɟɪɤɭɥɟɡɟ ɦɚɪɚɥɨɜ, ɪɚɡɪɚɛɨɬɚɧɧɵɟ ɞɥɹ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. ɗɬɨ ɨɛɭɫɥɨɜɥɟɧɨ ɨɫɨɛɟɧɧɨɫɬɹɦɢ ɦɚɪɚɥɨɜɨɞɫɬɜɚ. Ɏɢɡɢɱɟɫɤɢ ɧɟɥɶɡɹ ɨɛɪɚɛɨɬɚɬɶ ɜɫɸ ɩɥɨɳɚɞɶ ɡɢɦɧɢɤɨɜ, ɪɚɡɛɢɜɨɱɧɵɯ ɞɜɨɪɨɜ ɢ ɩɚɪɤɨɜ. Ɍɚɤ ɠɟ ɧɚ ɞɚɧɧɵɣ ɦɨɦɟɧɬ ɷɬɨ ɹɜɥɹɟɬɫɹ
ɷɤɨɥɨɝɢɱɟɫɤɢ ɧɟ ɛɟɡɨɩɚɫɧɨ. Ȼɨɪɚɧɛɚɟɜ Ⱥ.ȼ. ɜ ɫɜɨɟɣ ɪɚɛɨɬɟ ɨɩɢɫɵɜɚɟɬ ɫɪɟɞɫɬɜɚ ɞɟɡɢɧɮɟɤɰɢɢ ɩɨɱɜ
ɡɢɦɧɢɤɨɜ, ɢɧɜɟɧɬɚɪɹ ɢ ɪɚɡɛɢɜɨɱɧɵɯ ɞɜɨɪɨɜ ɦɚɪɚɥɨɮɟɪɦ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɛɟɡɨɩɚɫɧɵɯ ɜ ɷɤɨɥɨɝɢɱɟɫɤɨɦ ɨɬɧɨɲɟɧɢɢ ɞɟɡɢɧɮɟɤɬɚɧɬɨɜ [8].
ȼ ɩɪɨɞɨɥɠɟɧɢɟ ɭɤɚɡɚɧɧɨɣ ɪɚɛɨɬɵ ɧɚɦɢ ɩɪɨɜɨɞɢɬɫɹ ɚɩɪɨɛɚɰɢɹ ɫɨɜɪɟɦɟɧɧɵɯ ɞɟɡɢɧɮɟɤɬɚɧɬɨɜ. ɂɡɭɱɟɧ ɤɨɥɥɨɢɞɧɵɣ ɪɚɫɬɜɨɪ ɫɟɪɟɛɪɚ «ɇɚɧɨɫɟɪɟɛɪɨ». ɇɚɧɨɫɟɪɟɛɪɨ–ɚɧɬɢɫɟɩɬɢɤ ɤ ɤɨɬɨɪɨɦɭ
ɧɟɬ ɩɪɢɜɵɤɚɧɢɹ ɢ ɧɟɬ ɨɬɪɢɰɚɬɟɥɶɧɨɝɨ ɞɟɣɫɬɜɢɹ ɧɚ ɠɢɜɨɣ ɨɪɝɚɧɢɡɦ. Ⱦɥɹ ɢɫɩɵɬɚɧɢɹ ɤɨɥɥɨɢɞɧɨɝɨ
ɪɚɫɬɜɨɪɚ ɫɟɪɟɛɪɚ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ M.bovis ɢɫɩɨɥɶɡɨɜɚɥɢ ɟɝɨ ɪɚɫɬɜɨɪɵ ɫ ɤɨɧɰɟɧɬɪɚɰɢɟɣ 2, 5, 10
ɦɝ/ɥ. Ⱦɚɧɧɵɦ ɪɚɫɬɜɨɪɨɦ ɨɫɭɳɟɫɬɜɢɥɢ ɫɦɵɜ, ɡɚɪɚɧɟɟ ɤɭɥɶɬɢɜɢɪɨɜɚɧɧɵɯ, ɦɢɤɨɛɚɤɬɟɪɢɣ ɜɵɞɟɥɟɧɧɵɯ ɢɡ ɛɢɨɦɚɬɟɪɢɚɥɚ ɨɬ ɦɚɪɚɥɨɜ. Ʉɨɧɰɟɧɬɪɚɰɢɹ M.bovis ɜ ɫɦɵɜɚɯ ɫɨɫɬɚɜɥɹɥɚ 2 ɦɥɪɞ ɤɨɥɢɱɟɫɬɜɨ ɨɩɪɟɞɟɥɹɥɢ ɩɨ ɫɬɚɧɞɚɪɬɭ ɦɭɬɧɨɫɬɢ (ɈɋɈ 42–28–85-04) ȽɂɋɄ ɢɦ. Ʌ.Ⱥ. Ɍɚɪɚɫɟɜɢɱɚ ɧɚ 10 ɟɞ.
ɗɤɫɩɨɡɢɰɢɹ ɜɨɡɞɟɣɫɬɜɢɹ ɢɫɫɥɟɞɭɟɦɵɦ ɜɟɳɟɫɬɜɨɦ ɫɨɫɬɚɜɥɹɥɚ 1, 2, 4 ɱɚɫɚ. Ɋɚɛɨɬɭ ɩɪɨɜɨɞɢɥɢ ɫɨɝɥɚɫɧɨ «ɇɚɫɬɚɜɥɟɧɢɟ ɩɨ ɞɢɚɝɧɨɫɬɢɤɟ ɬɭɛɟɪɤɭɥɟɡɚ ɠɢɜɨɬɧɵɯ» [9].
ɉɨ ɦɚɬɟɪɢɚɥɚɦ ɩɪɨɜɟɞɟɧɧɵɯ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɜɵɹɫɧɢɥɢ, ɱɬɨ ɤɨɥɥɨɢɞɧɵɣ
ɪɚɫɬɜɨɪ ɫɟɪɟɛɪɚ ɫ ɤɨɧɰɟɧɬɪɚɰɢɟɣ 2, 5, 10 ɦɝ/ɥ ɢ ɷɤɫɩɨɡɢɰɢɟɣ 1, 2, 4 ɱɚɫɚ ɧɟ ɨɤɚɡɚɥ ɝɭɛɢɬɟɥɶɧɨɝɨ
ɞɟɣɫɬɜɢɹ ɧɚ M.bovis ɜɵɞɟɥɟɧɧɵɟ ɢɡ ɛɢɨɦɚɬɟɪɢɚɥɚ ɨɬ ɦɚɪɚɥɨɜ.
259
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɤɨɥɥɨɢɞɧɵɣ ɪɚɫɬɜɨɪ ɫɟɪɟɛɪɚ ɫ ɤɨɧɰɟɧɬɪɚɰɢɟɣ 2, 5, 10 ɦɝ/ɥ ɢ ɷɤɫɩɨɡɢɰɢɟɣ 1, 2,
4 ɱɚɫɚ ɧɟ ɨɛɥɚɞɚɟɬ ɞɟɡɢɧɮɢɰɢɪɭɸɳɢɦɢ ɫɜɨɣɫɬɜɚɦɢ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ M.bovis – ɨɫɬɚɸɬɫɹ ɠɢɡɧɟɫɩɨɫɨɛɧɵɦɢ ɢ ɜɢɪɭɥɟɧɬɧɵɦɢ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɢɞɟɬ ɧɚɪɚɳɢɜɚɧɢɟ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɨɣ ɦɚɫɫɵ
ɩɨɥɭɱɟɧɧɨɣ ɢɡ ɛɢɨɦɚɬɟɪɢɚɥɚ ɫ ɦɚɪɚɥɨɮɟɪɦ ɞɥɹ ɡɚɤɥɚɞɤɢ ɨɩɵɬɚ ɩɨ ɢɫɫɥɟɞɨɜɚɧɢɸ ɞɟɡɢɧɮɟɤɬɚɧɬɨɜ.
«Ɉɩɬɢɦɚɤɫ» ɜ ɤɚɱɟɫɬɜɟ ɨɫɧɨɜɧɨɝɨ ɞɟɣɫɬɜɭɸɳɟɝɨ ɜɟɳɟɫɬɜɚ ɫɨɞɟɪɠɚɳɟɝɨ N,N-ɛɢɫ(3-ɚɦɢɧɨɩɪɨɩɢɥ)
ɞɨɞɟɰɢɥɚɦɢɧ 5 % ɢ «ɋɟɩɬɭɫɬɟɪɢɥ» ɫ ɞɟɣɫɬɜɭɸɳɢɦ ɜɟɳɟɫɬɜɨɦ ɩɟɪɨɤɫɢɞ ɜɨɞɨɪɨɞɚ 11, % ɢ ɤɨɦɩɥɟɤɫɨɦ ɤɢɫɥɨɬ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
ɀɭɚɤɚ ɀ. «Ƚɢɩɩɨɤɪɚɬ». Ɋɨɫɬɨɜ-ɧɚ-Ⱦɨɧɭ, 1997 ɝ.
ɉɟɪɟɥɶɦɚɧ Ɇ.ɂ., Ʉɨɪɹɤɢɧ ȼ.Ⱥ., ɉɪɨɬɨɩɨɩɨɜɚ ɇ.Ɇ. «Ɍɭɛɟɪɤɭɥɟɡ». Ɇɨɫɤɜɚ, 1990 ɝ.
Ʌɭɧɢɰɢɧ ȼ.Ƚ., Ⱦɨɧɱɟɧɤɨ Ⱥ.ɋ. «Ɍɭɛɟɪɤɭɥɟɡ ɩɚɧɬɨɜɵɯ ɨɥɟɧɟɣ». Ȼɚɪɧɚɭɥ, 1994 ɝ.
Ʌɭɧɢɰɵɧ ȼ.Ƚ., Ȼɨɪɢɫɨɜ ɇ.ɉ. «ɉɚɧɬɨɜɨɟ ɨɥɟɧɟɜɨɞɫɬɜɨ Ɋɨɫɫɢɢ», Ȼɚɪɧɚɭɥ, 2012 ɝ.
ɋɚɦɢɧ Ⱦ.Ʉ. «100 ɜɟɥɢɤɢɯ ɧɚɭɱɧɵɯ ɨɬɤɪɵɬɢɣ». Ɇɨɫɤɜɚ, 2002 ɝ.
Ʉɨɥɵɱɟɜ ɇ.Ɇ. «ɂɧɞɢɤɚɰɢɹ ɢ ɨɛɟɡɜɪɟɠɢɜɚɧɢɟ ɦɢɤɨɛɚɤɬɟɪɢɣ ɬɭɛɟɪɤɭɥɟɡɚ ɜɨ ɜɧɟɲɧɟɣ ɫɪɟɞɟ». Ɉɦɫɤ,
1992 ɝ.
«Ɇɟɬɨɞɢɱɟɫɤɢɟ ɭɤɚɡɚɧɢɹ ɩɨ ɩɪɢɦɟɧɟɧɢɸ ɯɥɨɪɧɨɣ ɢɡɜɟɫɬɢ ɞɥɹ ɰɟɥɟɣ ɞɟɡɢɧɮɟɤɰɢɢ» 1975 ɝ.
Ȼɨɪɚɧɛɚɟɜ Ⱥ.ȼ., «Ɉɫɨɛɟɧɧɨɫɬɢ ɷɩɢɡɨɨɬɨɥɨɝɢɢ ɢ ɩɪɨɮɢɥɚɤɬɢɤɢ ɬɭɛɟɪɤɭɥɟɡɚ ɢ ɩɚɪɚɡɢɬɨɡɨɜ ɦɚɪɚɥɨɜ ɜ
Ƚɨɪɧɨɦ Ⱥɥɬɚɟ», ɇɨɜɨɫɢɛɢɪɫɤ, 2013 ɝ.
«ɇɚɫɬɚɜɥɟɧɢɟ ɩɨ ɞɢɚɝɧɨɫɬɢɤɟ ɬɭɛɟɪɤɭɥɟɡɚ ɠɢɜɨɬɧɵɯ» 2002 ɝ.
1.
2.
3.
4.
5.
6.
7.
8.
9.
ɍȾɄ 619:616.995.1
ȽȿɅɖɆɂɇɌɈɁɕ ɄɊɍɉɇɈȽɈ ɊɈȽȺɌɈȽɈ ɋɄɈɌȺ
ȼ ɏɈɁəɃɋɌȼȺɏ ȽɈɊɇɈȽɈ ȺɅɌȺə
*ɆȺɊɑȿɇɄɈ ȼ.Ⱥ., ** ȿɎɊȿɆɈȼȺ ȿ.Ⱥ.,
*Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɛɸɞɠɟɬɧɨɟ ɧɚɭɱɧɨɟ ɭɱɪɟɠɞɟɧɢɟ «Ƚɨɪɧɨ-Ⱥɥɬɚɣɫɤɢɣ
ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ» Ɋɟɫɩɭɛɥɢɤɚ Ⱥɥɬɚɣ,
ɫ. Ɇɚɣɦɚ, Ɋɨɫɫɢɹ. E-mail: oestrus@mail.ru
** Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɛɸɞɠɟɬɧɨɟ ɧɚɭɱɧɨɟ ɭɱɪɟɠɞɟɧɢɟ
«ɂɧɫɬɢɬɭɬ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɣ ɜɟɬɟɪɢɧɚɪɢɢ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɝɨ ȼɨɫɬɨɤɚ»,
ɇɨɜɨɫɢɛɢɪɫɤɚɹ ɨɛɥ., ɩ. Ʉɪɚɫɧɨɨɛɫɤ, Ɋɨɫɫɢɹ. E-mail: alfa_parazit@mail.ru
ȼ Ƚɨɪɧɨɦ Ⱥɥɬɚɟ ɫɤɨɬɨɜɨɞɫɬɜɨ ɹɜɥɹɟɬɫɹ ɨɞɧɨɣ ɢɡ ɨɫɧɨɜɧɵɯ ɨɬɪɚɫɥɟɣ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ, ɤɨɬɨɪɚɹ ɨɩɪɟɞɟɥɹɟɬ ɮɢɧɚɧɫɨɜɨ-ɷɤɨɧɨɦɢɱɟɫɤɨɟ ɫɨɫɬɨɹɧɢɟ ɢ ɫɬɪɭɤɬɭɪɭ ɡɚɧɹɬɨɫɬɢ ɨɫɧɨɜɧɨɣ ɱɚɫɬɢ ɧɚɫɟɥɟɧɢɹ. ɂɡ ɮɚɤɬɨɪɨɜ, ɩɪɟɩɹɬɫɬɜɭɸɳɢɯ ɭɫɩɟɲɧɨɦɭ ɪɚɡɜɢɬɢɸ ɨɬɪɚɫɥɢ, ɫɭɳɟɫɬɜɟɧɧɚɹ ɪɨɥɶ ɩɪɢɧɚɞɥɟɠɢɬ ɪɚɡɥɢɱɧɵɦ ɡɚɛɨɥɟɜɚɧɢɹɦ, ɜ ɬɨɦ ɱɢɫɥɟ ɩɚɪɚɡɢɬɚɪɧɨɣ ɷɬɢɨɥɨɝɢɢ.
Ɂɨɨɩɚɪɚɡɢɬɨɡɵ ɧɚ ɬɟɪɪɢɬɨɪɢɢ Ɋɟɫɩɭɛɥɢɤɢ Ⱥɥɬɚɣ ɪɟɝɢɫɬɪɢɪɭɸɬɫɹ ɭ ɜɫɟɯ ɜɢɞɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ [Ɍɟɬɟɪɢɧ., Ʉɨɫɬɹɟɜɚ, 1973, Ɇɚɪɱɟɧɤɨ ɢ ɞɪ, 2008]. Ɋɚɡɧɨɨɛɪɚɡɢɟ ɩɪɢɪɨɞɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɣ, ɲɢɪɨɤɢɣ ɤɪɭɝ ɜɢɞɨɜ ɞɨɦɚɲɧɢɯ ɠɢɜɨɬɧɵɯ ɢ ɞɢɤɨɣ ɮɚɭɧɵ ɜɨ ɦɧɨɝɨɦ ɨɩɪɟɞɟɥɹɸɬ ɪɚɡɧɨɨɛɪɚɡɢɟ ɢ ɜɵɫɨɤɭɸ ɱɢɫɥɟɧɧɨɫɬɶ ɩɚɪɚɡɢɬɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ. ɇɟɫɦɨɬɪɹ
ɧɚ ɡɧɚɱɢɬɟɥɶɧɵɟ ɭɫɢɥɢɹ ɩɨ ɥɢɤɜɢɞɚɰɢɢ ɧɚɢɛɨɥɟɟ ɨɩɚɫɧɵɯ ɩɚɪɚɡɢɬɚɪɧɵɯ ɡɨɨɧɨɡɨɜ, ɷɬɢ ɛɨɥɟɡɧɢ
ɩɨ-ɩɪɟɠɧɟɦɭ ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧɵ ɢ ɩɪɢɱɢɧɹɸɬ ɡɧɚɱɢɬɟɥɶɧɵɣ ɭɳɟɪɛ ɷɤɨɧɨɦɢɤɟ ɨɬɪɚɫɥɢ. ȼɫɟ
ɷɬɨ ɚɤɬɭɚɥɢɡɢɪɭɟɬ ɡɧɚɱɢɦɨɫɬɶ ɢɧɜɚɡɢɨɧɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ ɜ Ɋɟɫɩɭɛɥɢɤɟ, ɤɚɤ ɧɢ ɜ ɤɚɤɨɦ ɞɪɭɝɨɦ ɪɟɝɢɨɧɟ ɋɢɛɢɪɢ.
Ⱦɥɹ ɢɡɭɱɟɧɢɹ ɡɚɪɚɠɟɧɧɨɫɬɢ ɠɢɜɨɬɧɵɯ ɝɟɥɶɦɢɧɬɚɦɢ ɛɵɥɢ ɢɫɩɨɥɶɡɨɜɚɧɵ ɨɛɳɟɩɪɢɧɹɬɵɟ ɜ
ɝɟɥɶɦɢɧɬɨɥɨɝɢɢ ɦɟɬɨɞɢɤɢ – ɝɟɥɶɦɢɧɬɨɨɜɨɫɤɨɩɢɹ ɩɨ Ʉɨɬɟɥɶɧɢɤɨɜɭ-ɏɪɟɧɨɜɭ (1974) ɢ ɝɟɥɶɦɢɧɬɨɥɹɪɜɨɫɤɨɩɢɢ ɩɨ Ȼɟɪɦɚɧɭ-Ɉɪɥɨɜɭ. ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ ɢɫɫɥɟɞɨɜɚɧɢɣ ɜɵɜɨɞɢɥɢɫɶ ɩɨɤɚɡɚɬɟɥɢ ɗɂ ɢ
ɍɁ (ɭɪɨɜɟɧɶ ɡɚɪɚɠɟɧɧɨɫɬɢ – ɫɪɟɞɧɟɟ ɡɧɚɱɟɧɢɟ ɩɨɤɚɡɚɬɟɥɟɣ ɗɂ). ɂɫɫɥɟɞɨɜɚɧɨ ɛɨɥɟɟ 1300 ɩɪɨɛɵ
ɮɟɤɚɥɢɣ ɨɬ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɪɚɡɥɢɱɧɵɯ ɩɨɪɨɞ ɢɡ ɯɨɡɹɣɫɬɜ 5 ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɯ ɪɚɣɨɧɨɜ
Ɋɟɫɩɭɛɥɢɤɢ – ɒɟɛɚɥɢɧɫɤɢɣ, Ɉɧɝɭɞɚɣɫɤɢɣ, ɍɫɬɶ-Ʉɚɧɫɤɢɣ, ɑɨɣɫɤɢɣ, Ɇɚɣɦɢɧɫɤɢɣ, Ɍɭɪɨɱɚɤɫɤɢɣ.
ȼ ɛɨɥɶɲɢɧɫɬɜɟ ɫɥɭɱɚɟɜ ɞɥɹ ɯɚɪɚɤɬɟɪɢɫɬɢɤɢ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ ɩɨ ɝɟɥɶɦɢɧɬɨɡɚɦ ɞɨɫɬɚɬɨɱɧɨ ɨɩɢɫɚɧɢɹ ɜɨɡɛɭɞɢɬɟɥɟɣ ɧɚ ɪɨɞɨɜɨɦ ɭɪɨɜɧɟ. ɉɪɢ ɢɡɭɱɟɧɢɢ ɫɬɪɭɤɬɭɪɵ ɝɟɥɶɦɢɧɬɨɰɟɧɨɡɚ ɢɫɩɨɥɶɡɨɜɚɥɢ ɦɟɬɨɞɢɤɭ, ɩɪɟɞɥɨɠɟɧɧɭɸ Ɇɚɪɱɟɧɤɨ ɫ ɫɨɚɜɬɨɪɚɦɢ [2007], ɫ ɜɵɜɟɞɟɧɢɟɦ ɫɥɟɞɭɸɳɢɯ
ɩɨɤɚɡɚɬɟɥɟɣ – ɢɧɞɟɤɫ ɡɚɪɚɠɺɧɧɨɫɬɢ (ɂɁ) ɢ ɢɧɞɟɤɫ ɩɚɪɚɡɢɬɨɤɨɦɩɥɟɤɫɚ (ɂɉ), ɤɨɬɨɪɵɟ ɨɬɨɛɪɚɠɚɸɬ
ɜɟɫ ɤɚɤɨɝɨ ɥɢɛɨ ɬɚɤɫɨɧɚ ɜ ɫɬɪɭɤɬɭɪɟ ɩɚɪɚɡɢɬɨɰɟɧɨɡɚ.
260
ɉɪɢ ɢɡɭɱɟɧɢɢ ɜɟɬɟɪɢɧɚɪɧɨɣ ɨɬɱɟɬɧɨɫɬɢ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɡɚɪɚɠɟɧɧɨɫɬɶ ɠɢɜɨɬɧɵɯ ɮɚɫɰɢɨɥɚɦɢ
ɜɚɪɶɢɪɨɜɚɥɚ ɨɬ 0.3±0.1 ɞɨ 33.2±5.7 % ɢ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɚ 3.0±1.0 %. ȼɵɫɨɤɚɹ ɷɤɫɬɟɧɫɢɜɧɨɫɬɶ
ɢɧɜɚɡɢɢ (ɗɂ) ɠɢɜɨɬɧɵɯ ɮɚɫɰɢɨɥɚɦɢ ɧɚɛɥɸɞɚɥɚɫɶ ɜ ɑɨɣɫɤɨɦ ɢ Ɍɭɪɨɱɚɤɫɤɨɦ ɪɚɣɨɧɚɯ ɢ ɫɨɫɬɚɜɢɥɚ
ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 33.2±5.7 ɢ 31.3±4.9 %.
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɧɵɯ ɧɚɦɢ ɤɨɩɪɨɨɜɨɫɤɨɩɢɱɟɫɤɢɯ ɨɛɫɥɟɞɨɜɚɧɢɣ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɬɪɟɦɚɬɨɞɨɡɵ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧɵ ɧɚ ɬɟɪɪɢɬɨɪɢɢ ɋɟɜɟɪɧɨɝɨ Ⱥɥɬɚɹ. ȼ ɯɨɡɹɣɫɬɜɚɯ ɞɚɧɧɨɣ ɩɪɨɜɢɧɰɢɢ ɤɪɭɩɧɵɣ ɪɨɝɚɬɵɣ ɫɤɨɬ ɡɚɪɚɠɟɧ ɬɪɟɦɚɬɨɞɚɦɢ, ɨɬɧɨɫɹɳɢɦɢɫɹ ɤ ɪɨɞɚɦ
Fasciola, Dicrocoelium ɢ ɩɨɞɨɬɪɹɞɭ Paramphistomata. ɂɧɜɚɡɢɹ ɠɢɜɨɬɧɵɯ ɬɪɟɦɚɬɨɞɚɦɢ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɚ ɜ 12 ɧɚɫɟɥɟɧɧɵɯ ɩɭɧɤɬɚɯ ɢɡ 14 ɨɛɫɥɟɞɨɜɚɧɧɵɯ. ɋɪɟɞɧɹɹ ɡɚɪɚɠɟɧɧɨɫɬɶ ɠɢɜɨɬɧɵɯ ɬɪɟɦɚɬɨɞɚɦɢ ɜ ɫɟɜɟɪɧɵɯ ɪɚɣɨɧɚɯ ɪɟɫɩɭɛɥɢɤɢ ɫɨɫɬɚɜɢɥɚ 24.4±1.9 %.
Ɏɚɫɰɢɨɥɟɡ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧ ɜ 11 ɧɚɫɟɥɟɧɧɵɯ ɩɭɧɤɬɚɯ ɢɡ 14 ɨɛɫɥɟɞɨɜɚɧɧɵɯ ɫ ɤɨɥɟɛɚɧɢɹɦɢ ɩɨɤɚɡɚɬɟɥɹ ɗɂ ɨɬ 5.0 ɞɨ 32.9 %, ɤɨɬɨɪɵɣ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥ 15.0±1.1 %.
Ɂɚɪɚɠɟɧɧɨɫɬɶ ɠɢɜɨɬɧɵɯ ɩɚɪɚɦɮɢɫɬɨɦɚɬɚɦɢ, ɜɵɹɜɥɟɧɧɚɹ ɜ 7 ɧɚɫɟɥɟɧɧɵɯ ɩɭɧɤɬɚɯ, ɜɚɪɶɢɪɨɜɚɥɚ ɜ
ɩɪɟɞɟɥɚɯ 6.0–26.9 % ɢ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɚ 8.9±0.7 %. ɂɧɜɚɡɢɪɨɜɚɧɧɨɫɬɶ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɞɢɤɪɨɰɟɥɢɹɦɢ, ɭɫɬɚɧɨɜɥɟɧɧɚɹ ɜ 7 ɩɭɧɤɬɚɯ, ɤɨɥɟɛɚɥɚɫɶ ɨɬ 5.4 ɞɨ 25.0 % ɢ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɚ
4.5±0.3.
ɍ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɯɨɡɹɣɫɬɜɚɯ ɋɟɜɟɪɧɨɝɨ Ⱥɥɬɚɹ ɭɫɬɚɧɨɜɥɟɧɚ ɫɦɟɲɚɧɧɚɹ ɢɧɜɚɡɢɹ ɬɪɟɦɚɬɨɞɚɦɢ. ɇɚɢɛɨɥɟɟ ɱɚɫɬɨ ɧɚɛɥɸɞɚɥɚɫɶ ɢɧɜɚɡɢɹ, ɜɵɡɜɚɧɧɚɹ ɫɨɜɦɟɫɬɧɵɦ ɩɚɪɚɡɢɬɢɪɨɜɚɧɢɟɦ ɮɚɫɰɢɨɥ ɢ ɩɚɪɚɦɮɢɫɬɨɦɚɬ (3.0±0.2 %). ȼ ɦɟɧɶɲɟɣ ɫɬɟɩɟɧɢ ɪɚɫɩɪɨɫɬɪɚɧɟɧɚ ɢɧɜɚɡɢɹ, ɜɵɡɜɚɧɧɚɹ ɨɞɧɨɜɪɟɦɟɧɧɨ ɮɚɫɰɢɨɥɚɦɢ ɢ ɞɢɤɪɨɰɟɥɢɹɦɢ (0.4±0 %). ɂɧɜɚɡɢɪɨɜɚɧɧɨɫɬɶ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ɨɞɧɨɜɪɟɦɟɧɧɨ ɩɚɪɚɦɮɢɫɬɨɦɚɬɚɦɢ ɢ ɞɢɤɪɨɰɟɥɢɹɦɢ ɬɚɤɠɟ ɫɨɫɬɚɜɢɥɚ ɬɨɥɶɤɨ 0.4±0 %.
Ʉɪɭɩɧɵɣ ɪɨɝɚɬɵɣ ɫɤɨɬ ɜ ɯɨɡɹɣɫɬɜɚɯ ɋɟɜɟɪɧɨɝɨ Ⱥɥɬɚɹ ɡɚɪɚɠɟɧ ɝɟɥɶɦɢɧɬɚɦɢ, ɨɬɧɨɫɹɳɢɦɢɫɹ ɤ
ɤɥɚɫɫɚɦ Trematoda, Nematoda ɢ Cestoda. Ʉɚɤ ɭɩɨɦɢɧɚɥɨɫɶ ɜɵɲɟ, ɤɥɚɫɫ Trematoda ɩɪɟɞɫɬɚɜɥɟɧ
ɝɟɥɶɦɢɧɬɚɦɢ ɪɨɞɨɜ Fasciola, Dicrocoelium ɢ ɩɨɞɨɬɪɹɞɚ Paramphistomata. ɂɡ ɧɟɦɚɬɨɞ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɵ ɩɪɟɞɫɬɚɜɢɬɟɥɢ ɩɨɞɨɬɪɹɞɚ Strongylata, ɜ ɬɨɦ ɱɢɫɥɟ ɪɨɞɚ
Nematodirus, ɚ ɬɚɤɠɟ ɩɪɟɞɫɬɚɜɢɬɟɥɢ ɪɨɞɚ Trichocephalus. ɂɦɚɝɢɧɚɥɶɧɵɟ ɰɟɫɬɨɞɨɡɵ ɩɪɟɞɫɬɚɜɥɟɧɵ
ɪɨɞɨɦ Moniezia.
ɂɡ ɩɪɟɞɫɬɚɜɢɬɟɥɟɣ ɤɥɚɫɫɚ Trematoda ɞɨɦɢɧɢɪɭɸɬ ɮɚɫɰɢɨɥɵ ɩɪɢ ɡɧɚɱɟɧɢɢ ɪɨɞɨɜɨɝɨ ɢɧɞɟɤɫɚ
ɩɚɪɚɡɢɬɨɤɨɦɩɥɟɤɫɚ (Ɋɂɉ) 14.4±1.0, ɜ ɬɨ ɜɪɟɦɹ ɤɚɤ ɩɚɪɚɦɮɢɫɬɨɦɚɬɵ ɢ ɞɢɤɪɨɰɟɥɢɢ ɡɚɧɢɦɚɸɬ ɜɬɨɪɨɫɬɟɩɟɧɧɨɟ ɩɨɥɨɠɟɧɢɟ (Ɋɂɉ=8.5±0.6 ɢ 3.6±0.2).
ȼ ɤɥɚɫɫɟ Nematoda ɩɪɟɜɚɥɢɪɭɸɬ ɩɪɟɞɫɬɚɜɢɬɟɥɢ ɩɨɞɨɬɪɹɞɚ Strongylata. ɂɧɞɟɤɫ ɩɚɪɚɡɢɬɨɤɨɦɩɥɟɤɫɚ (ɂɉ) ɧɟɦɚɬɨɞɢɪ ɢ ɞɪɭɝɢɯ ɫɬɪɨɧɝɢɥɹɬ ɫɨɫɬɚɜɢɥ 4.5±0.3 ɢ 36.9±2.9, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ. ɂɉ ɩɪɟɞɫɬɚɜɢɬɟɥɟɣ ɪɨɞɚ Trichocephalus ɫɨɫɬɚɜɢɥ ɥɢɲɶ 0.4±0 (ɬɚɛɥ. 1).
Ɍɚɛɥɢɰɚ 1
ɋɬɪɭɤɬɭɪɚ ɩɚɪɚɡɢɬɨɰɟɧɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ȼɨɡɛɭɞɢɬɟɥɶ
ɉɨɤɚɡɚɬɟɥɶ
ɗɂ, %
Ɋɂɉ
ɂɫɫɥ. ɩɪɨɛ
585
-
Fasc.
14.4±1.0
19.8±1.5
Trematoda
Param.
8.5±0.6
11.5±0.9
Dicr.
3.6±0.2
4.9±0.3
Str.
36.9±2.9
47.3±3.7
Nematoda
Nem.
4.5±0.3
5.8±0.4
Tr.
0.4±0
0.2±0
Cestoda
Mon.
7.6±0.6
10.4±0.8
ɋɭɦɦɚɪɧɵɟ ɂɉ ɬɪɟɦɚɬɨɞ, ɧɟɦɚɬɨɞ ɢ ɰɟɫɬɨɞ ɫɨɫɬɚɜɥɹɸɬ 36.2, 53.3 ɢ 10.4, ɚ ɤɨɥɢɱɟɫɬɜɟɧɧɨɟ ɨɬɧɨɲɟɧɢɟ ɝɟɥɶɦɢɧɬɨɜ ɞɚɧɧɵɯ ɫɢɫɬɟɦɚɬɢɱɟɫɤɢɯ ɝɪɭɩɩ ɦɨɠɧɨ ɜɵɪɚɡɢɬɶ ɤɚɤ 3:6:1 (Ɋɢɫ.).
Ɋɢɫ. ȼɟɫ ɬɚɤɫɨɧɨɜ ɝɟɥɶɦɢɧɬɨɜ ɪɚɡɥɢɱɧɵɯ ɫɢɫɬɟɦɚɬɢɱɟɫɤɢɯ ɝɪɭɩɩ
ɜ ɫɬɪɭɤɬɭɪɟ ɩɚɪɚɡɢɬɨɤɨɦɩɥɟɤɫɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɋɟɜɟɪɧɨɝɨ Ⱥɥɬɚɹ
261
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɜ ɫɬɪɭɤɬɭɪɟ ɝɟɥɶɦɢɧɬɨɰɟɧɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɋɟɜɟɪɧɨɝɨ ɢ ɐɟɧɬɪɚɥɶɧɨɝɨ
Ⱥɥɬɚɹ ɞɨɦɢɧɢɪɭɸɬ ɩɪɟɞɫɬɚɜɢɬɟɥɢ ɤɥɚɫɫɨɜ Nematoda ɢ Trematoda.
Ɉɛɫɥɟɞɨɜɚɧɢɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɦɹɫɧɵɯ ɩɨɪɨɞ ɧɚ ɝɟɥɶɦɢɧɬɨɡɵ ɩɪɨɜɟɥɢ ɜ ɯɨɡɹɣɫɬɜɚɯ
ɒɟɛɚɥɢɧɫɤɨɝɨ (Ⱥɗɋɏ, ɝɚɥɥɨɜɟɣɫɤɚɹ ɩɨɪɨɞɚ; ɫ.Ȼɚɪɚɝɚɲ, ɚɛɟɪɞɢɧɨ-ɚɧɝɭɫɫɤɚɹ ɩɨɪɨɞɚ), Ɉɧɝɭɞɚɣɫɤɨɝɨ
(ɋɉɄ «ɉɥɟɦɯɨɡ Ɍɟɧɝɢɧɫɤɢɣ», ɤɚɡɚɯɫɤɚɹ ɛɟɥɨɝɨɥɨɜɚɹ; ɤ\ɯ «ɇɚɞɟɠɞɚ», ɝɟɪɟɮɨɪɞɵ), Ɇɚɣɦɢɧɫɤɨɝɨ
(Ɉɉɏ «ɑɭɣɫɤɨɟ», ɫɢɦɦɟɧɬɚɥɶɫɤɚɹ ɩɨɪɨɞɚ), ɍɫɬɶ-Ʉɚɧɫɤɨɝɨ (ɤɚɡɚɯɫɤɚɹ ɛɟɥɨɝɨɥɨɜɚɹ) ɪɚɣɨɧɨɜ.
Ɋɟɡɭɥɶɬɚɬɵ ɨɜɨɫɤɨɩɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɨɛ ɮɟɤɚɥɢɣ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɫɤɨɬɨɜɨɞɱɟɫɤɢɯ ɯɨɡɹɣɫɬɜɚɯ ɦɹɫɧɨɝɨ ɧɚɩɪɚɜɥɟɧɢɹ ɐɟɧɬɪɚɥɶɧɨɝɨ Ⱥɥɬɚɹ ɩɨɞɬɜɟɪɠɞɚɸɬ, ɱɬɨ ɝɟɥɶɦɢɧɬɨɡɵ
ɢɦɟɸɬ ɲɢɪɨɤɨɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ. ȼɫɟ ɨɛɫɥɟɞɨɜɚɧɧɵɟ ɯɨɡɹɣɫɬɜɚ ɐɟɧɬɪɚɥɶɧɨɝɨ Ⱥɥɬɚɹ ɧɟɛɥɚɝɨɩɨɥɭɱɧɵ ɩɨ ɧɟɦɚɬɨɞɨɡɚɦ ɢ ɰɟɫɬɨɞɨɡɚɦ ɫ ɪɚɡɥɢɱɧɵɦɢ ɩɨɤɚɡɚɬɟɥɹɦɢ ɢɧɜɚɡɢɪɨɜɚɧɧɨɫɬɢ. ɂɧɜɚɡɢɹ ɠɢɜɨɬɧɵɯ ɧɟɦɚɬɨɞɚɦɢ ɢ ɰɟɫɬɨɞɚɦɢ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɚ ɜ 10 ɧɚɫɟɥɟɧɧɵɯ ɩɭɧɤɬɚɯ ɢɡ 10 ɨɛɫɥɟɞɨɜɚɧɧɵɯ.
ɋɪɟɞɧɹɹ ɡɚɪɚɠɟɧɧɨɫɬɶ ɠɢɜɨɬɧɵɯ ɝɟɥɶɦɢɧɬɚɦɢ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ ɜɚɪɶɢɪɨɜɚɥɚ ɨɬ 7,7 %
ɞɨ 100 %, ɚ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɚ 55,6 %.
ɂɧɜɚɡɢɪɨɜɚɧɧɨɫɬɶ ɫɤɨɬɚ ɦɹɫɧɵɯ ɩɨɪɨɞ ɜ ɯɨɡɹɣɫɬɜɚɯ Ɇɚɣɦɢɧɫɤɨɝɨ, ɒɟɛɚɥɢɧɫɤɨɝɨ, ɍɫɬɶɄɚɧɫɤɨɝɨ ɪɚɣɨɧɨɜ ɫɨɫɬɚɜɢɥɚ 45,0; 61,9; 66,0, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ (Ɍɚɛɥ. 2).
Ɍɚɛɥɢɰɚ 2
Ɂɚɪɚɠɟɧɧɨɫɬɶ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɦɹɫɧɵɯ ɩɨɪɨɞ ɝɟɥɶɦɢɧɬɚɦɢ ɜ ɐɟɧɬɪɚɥɶɧɨɦ Ⱥɥɬɚɟ (ɨɜɨɫɤɨɩɢɹ)
Ɋɚɣɨɧ
ɒɟɛɚɥɢɧɫɤɢɣ
Ɉɧɝɭɞɚɣɫɤɢɣ
Ɇɚɣɦɢɧɫɤɢɣ
ɍɫɬɶ-Ʉɚɧɫɤɢɣ
ɂɬɨɝɨ
Ʉɨɥ-ɜɨ
ɩɪɨɛ
239
32
60
50
381
ɗɂ, %
61,9
12,0
45,0
66,0
55,6
St
58,6
3,1
45,0
62,0
52,2
ɗɤɫɬɟɧɫɢɜɧɨɫɬɶ ɢɧɜɚɡɢɢ, %
Nem
Tr
21,3
2,1
3,1
0
13,3
0
26,0
2,0
19,2
1,6
Mon
3,8
9,4
0
16,0
5,2
ȼ ɝɟɥɶɦɢɧɬɨɤɨɦɩɥɟɤɫɟ ɞɨɦɢɧɢɪɭɸɳɢɦɢ ɷɥɟɦɟɧɬɚɦɢ ɹɜɥɹɸɬɫɹ ɫɬɪɨɧɝɢɥɹɬɵ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ (52,2 %). Ɂɚɪɟɝɢɫɬɪɢɪɨɜɚɧɚ ɡɧɚɱɢɬɟɥɶɧɚɹ ɢɧɜɚɡɢɪɨɜɚɧɧɨɫɬɶ ɫɤɨɬɚ ɧɟɦɚɬɨɞɢɪɚɦɢ
(19,2 %). ɂɧɜɚɡɢɪɨɜɚɧɧɨɫɬɶ ɫɬɪɨɧɝɢɥɹɬɚɦɢ, ɧɟɦɚɬɨɞɢɪɚɦɢ ɢ ɦɨɧɢɟɡɢɹɦɢ ɠɢɜɨɬɧɵɯ ɜ ɒɟɛɚɥɢɧɫɤɨɦ
ɪɚɣɨɧɟ ɫɨɫɬɚɜɢɥɚ 58,6; 21,3 ɢ 3,8 %, ɜ ɍɫɬɶ-Ʉɚɧɫɤɨɦ – 62,0; 26,0 % ɢ 16,0 %, ɜ Ɇɚɣɦɢɧɫɤɨɦ – 45,0;
13,3 ɢ 16,0 %. Ɂɚɪɚɠɟɧɧɨɫɬɶ ɫɤɨɬɚ ɬɪɢɯɨɰɟɮɚɥɚɦɢ ɧɢɡɤɚɹ ɜ ɫɪɟɞɧɟɦ ɪɚɜɧɚ 1,6 %. ɋɪɟɞɧɟɟ ɤɨɥɢɱɟɫɬɜɨ ɹɢɰ ɜɚɪɶɢɪɨɜɚɥɨ ɨɬ 0,9 ɞɨ 236,6 ɧɚ ɝɪɚɦɦ ɮɟɤɚɥɢɣ.
ɉɨɤɚɡɚɬɟɥɢ ɷɤɫɬɟɧɫɢɜɧɨɫɬɢ ɢɧɜɚɡɢɢ (ɗɂ) ɫɤɨɬɚ ɝɚɥɥɚɜɟɣɫɤɨɣ ɩɨɪɨɞɵ ɜ Ⱥɥɬɚɣɫɤɨɦ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɦ ɯɨɡɹɣɫɬɜɟ (ɒɟɛɚɥɢɧɫɤɢɣ ɪɚɣɨɧ) ɤɨɥɟɛɚɥɢɫɶ ɨɬ 9,5 ɞɨ 100 % ɢ ɜ ɫɪɟɞɧɟɦ ɫɨɫɬɚɜɢɥɢ
68,5 %, ɩɪɢ ɫɪɟɞɧɟɦ ɤɨɥɢɱɟɫɬɜɟ ɹɢɰ ɨɬ 7,8 ɞɨ 211,7 ɧɚ ɝɪɚɦɦ ɮɟɤɚɥɢɣ.
Ɇɚɤɫɢɦɚɥɶɧɨɟ ɡɚɪɚɠɟɧɢɟ ɝɟɥɶɦɢɧɬɚɦɢ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɨ ɭ ɬɟɥɹɬ ɬɟɤɭɳɟɝɨ ɝɨɞɚ ɪɨɠɞɟɧɢɹ ɜ
ɥɟɬɧɟ–ɨɫɟɧɧɢɣ ɩɟɪɢɨɞ. ɉɨɤɚɡɚɬɟɥɢ ɗɂ ɫɬɪɨɧɝɢɥɹɬɚɦɢ ɢ ɧɟɦɚɬɨɞɢɪɚɦɢ ɜɚɪɶɢɪɭɸɬ ɨɬ 100 – 92,9 %
ɢ 38,5-35,7 %, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɦɨɧɢɟɡɢɹɦɢ ɨɬ 23,1 % ɜ ɚɜɝɭɫɬɟ ɞɨ 3,6 % ɢ 3,4 % ɜ ɧɨɹɛɪɟ, ɞɟɤɚɛɪɟ.
Ɂɚɪɚɠɟɧɧɨɫɬɶ ɜɡɪɨɫɥɵɯ ɠɢɜɨɬɧɵɯ ɫɬɪɨɧɝɢɥɹɬɨɡɚɦɢ ɜ ɯɨɡɹɣɫɬɜɟ ɤɨɥɟɛɚɥɚɫɶ ɨɬ 33,3 ɞɨ 78,9 %, ɚ
ɧɟɦɚɬɨɞɢɪɨɡɨɦ ɨɬ 9,5 ɞɨ 44,4 %.
ɇɚɢɛɨɥɟɟ ɜɵɫɨɤɢɟ ɡɧɚɱɟɧɢɹ ɡɚɪɚɠɟɧɧɨɫɬɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɦɨɧɢɟɡɢɹɦɢ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɵ ɭ ɠɢɜɨɬɧɵɯ ɯɨɡɹɣɫɬɜ ɍɫɬɶ-Ʉɚɧɫɤɨɝɨ ɪɚɣɨɧɚ – 16 %.
Ⱦɨɫɬɚɬɨɱɧɨ ɜɵɫɨɤɚɹ ɡɚɪɚɠɟɧɧɨɫɬɶ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɝɟɥɶɦɢɧɬɚɦɢ ɩɢɳɟɜɚɪɢɬɟɥɶɧɨɝɨ
ɬɪɚɤɬɚ ɜɵɹɜɥɟɧɚ ɭ ɠɢɜɨɬɧɵɯ ɩɨɪɨɞ ɝɚɥɥɨɜɟɣɫɤɚɹ (68,5 %), ɤɚɡɚɯɫɤɚɹ ɛɟɥɨɝɨɥɨɜɚɹ (66,0 %) ɢ ɫɢɦɦɟɧɬɚɥɶɫɤɚɹ (45 %). Ƚɟɥɶɦɢɧɬɨɮɚɭɧɚ ɩɢɳɟɜɚɪɢɬɟɥɶɧɨɝɨ ɬɪɚɤɬɚ ɩɪɟɞɫɬɚɜɥɟɧɚ ɤɨɨɩɟɪɢɹɦɢ, ɨɫɬɟɪɬɚɝɢɹɦɢ, ɷɡɨɮɚɝɨɫɬɨɦɚɦɢ, ɧɟɦɚɬɨɞɢɪɚɦɢ, ɯɚɛɟɪɬɢɹɦɢ ɩɪɢ ɫɪɟɞɧɟɣ ɢɧɜɚɡɢɪɨɜɚɧɧɨɫɬɢ ɠɢɜɨɬɧɵɯ ɜ
ɯɨɡɹɣɫɬɜɚɯ ɐɟɧɬɪɚɥɶɧɨɝɨ Ⱥɥɬɚɹ 15,8; 27,1; 6,0; 1,5; 3,8 %, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ. Ƚɟɥɶɦɢɧɬɨɡɵ ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ ɩɪɨɬɟɤɚɸɬ ɜ ɮɨɪɦɟ ɦɢɤɫɬ-ɢɧɜɚɡɢɣ, ɫ ɧɚɢɛɨɥɟɟ ɱɚɫɬɵɦ ɫɨɱɟɬɚɧɢɟɦ ɫɬɪɨɧɝɢɥɹɬɵ + ɧɟɦɚɬɨɞɢɪɵ, ɫɬɪɨɧɝɢɥɹɬɵ + ɦɨɧɢɟɡɢɢ, ɫɬɪɨɧɝɢɥɹɬɵ + ɧɟɦɚɬɨɞɢɪɵ + ɦɨɧɢɟɡɢɢ.
Ɂɧɚɧɢɹ ɚɫɫɨɰɢɚɬɢɜɧɨɣ ɫɬɪɭɤɬɭɪɵ ɝɟɥɶɦɢɧɬɨɰɟɧɨɡɚ ɦɨɝɭɬ ɫɭɳɟɫɬɜɟɧɧɨ ɩɨɦɨɱɶ ɜ ɜɵɛɨɪɟ ɬɟɪɚɩɟɜɬɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɩɪɢ ɪɚɡɪɚɛɨɬɤɟ ɪɚɰɢɨɧɚɥɶɧɨɣ ɫɢɫɬɟɦɵ ɥɟɱɟɛɧɨ-ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɦɟɪɨɩɪɢɹɬɢɣ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
262
Ɇɚɪɱɟɧɤɨ ȼ.Ⱥ., ȿɮɪɟɦɨɜɚ ȿ.Ⱥ., ɋɚɢɬɨɜ ȼ.Ɋ. Ʉ ɷɩɢɡɨɨɬɨɥɨɝɢɱɟɫɤɨɣ ɨɰɟɧɤɟ ɩɚɪɚɡɢɬɨɰɟɧɨɡɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ // Ɇɚɬɟɪɢɚɥɵ 2-ɨɣ ɦɟɠɪɟɝɢɨɧɚɥɶɧɨɣ ɧɚɭɱɧɨɣ ɤɨɧɮ./ ɉɚɪɚɡɢɬɨɥɨɝɢɱɟɫɤɢɟ
ɢɫɫɥɟɞɨɜɚɧɢɹ ɜ ɋɢɛɢɪɢ ɢ ɧɚ Ⱦɚɥɶɧɟɦ ȼɨɫɬɨɤɟ. – ɇɨɜɨɫɢɛɢɪɫɤ. 2007. – ɋ.130–132.
Ɇɚɪɱɟɧɤɨ, ȼ.Ⱥ. ɋɬɪɭɤɬɭɪɚ ɝɟɥɶɦɢɧɬɨɰɟɧɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ Ƚɨɪɧɨɝɨ Ⱥɥɬɚɹ / ȼ.Ⱥ. Ɇɚɪɱɟɧɤɨ,
ȿ.Ⱥ. ȿɮɪɟɦɨɜɚ, ȿ.Ⱥ. ȼɚɫɢɥɶɟɜɚ//Ɋɨɫ. ɩɚɪɚɡɢɬɨɥ. ɠɭɪɧɚɥ – 2008.- ʋ3. – ɋ. 6–9.
3.
Ɍɟɬɟɪɢɧ ȼ.ɂ., Ʉɨɫɬɹɟɜɚ Ⱥ.Ɍ., Ȼɟɡɪɭɤɨɜ ȼ.Ⱥ. Ʉ ɢɡɭɱɟɧɢɸ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɝɟɥɶɦɢɧɬɨɜ ɢ ɝɟɥɶɦɢɧɬɨɡɨɜ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ Ƚɨɪɧɨɦ Ⱥɥɬɚɟ. // ɉɪɨɮɢɥɚɤɬɢɤɚ ɡɚɪɚɡɧɵɯ ɢ ɧɟɡɚɪɚɡɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ ɠɢɜɨɬɧɵɯ ɜ ɋɢɛɢɪɢ.- Ɉɦɫɤ, 1973. – ɫ.232–236.
ɍȾɄ 619: 612:. 017
ȽȿɆȺɌɈɅɈȽɂɑȿɋɄɂȿ ɉɈɄȺɁȺɌȿɅɂ ɄɊɈȼɂ
ȽɈɅɒɌɂɇɋɄɈȽɈ ɋɄɈɌȺ ɄȺɇȺȾɋɄɈɃ ɋȿɅȿɄɐɂɂ
ɆɂɇɀȺɋɈȼ Ʉ.ɂ., ȺɍȻȺɄɂɊɈȼȺ Ⱥ.Ʉ., ȺɅɂɆȻȺȿȼ Ɇ.Ʉ.,
ɆɍɏȺɆȿɌɈȼȺ ȼ.Ⱦ., ɌɍəɄɈȼ Ʉ.ɀ.,
ɌɈɈ «ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ», ɚ. Ȼɟɫɤɨɥɶ, Ʉɚɡɚɯɫɬɚɧ, e-mail: sevkaz_agroinnov@inbox.ru
ȼ ɠɢɜɨɦ ɨɪɝɚɧɢɡɦɟ ɤɪɨɜɶ ɢɝɪɚɟɬ ɜɚɠɧɭɸ ɪɨɥɶ. ɉɨɫɪɟɞɫɬɜɨɦ ɤɪɨɜɢ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɜɚɠɧɟɣɲɟɟ
ɫɜɨɣɫɬɜɨ ɠɢɜɨɣ ɦɚɬɟɪɢɢ – ɨɛɦɟɧ ɜɟɳɟɫɬɜ. Ʉɪɨɜɶ ɞɨɫɬɚɜɥɹɟɬ ɤ ɤɥɟɬɤɚɦ ɨɪɝɚɧɨɜ ɬɟɥɚ ɩɢɬɚɬɟɥɶɧɵɟ
ɜɟɳɟɫɬɜɚ ɢ ɤɢɫɥɨɪɨɞ, ɭɞɚɥɹɟɬ ɩɪɨɞɭɤɬɵ ɨɛɦɟɧɚ ɢ ɭɝɥɟɤɢɫɥɨɬɭ. ɑɟɪɟɡ ɤɪɨɜɶ ɨɛɟɫɩɟɱɢɜɚɸɬɫɹ ɝɨɪɦɨɧɚɥɶɧɚɹ ɪɟɝɭɥɹɰɢɹ ɡɚɳɢɬɧɵɯ ɮɭɧɤɰɢɣ, ɪɚɜɧɨɜɟɫɢɟ ɷɥɟɤɬɪɨɥɢɬɨɜ ɜ ɨɪɝɚɧɢɡɦɟ. ɇɟɨɛɯɨɞɢɦɵɦ
ɭɫɥɨɜɢɟɦ ɧɨɪɦɚɥɶɧɨɝɨ ɫɭɳɟɫɬɜɨɜɚɧɢɹ ɨɪɝɚɧɢɡɦɚ, ɟɝɨ ɨɪɝɚɧɨɜ ɢ ɬɤɚɧɟɣ ɹɜɥɹɟɬɫɹ ɩɨɫɬɨɹɧɫɬɜɨ ɫɨɫɬɚɜɚ ɤɪɨɜɢ. ɇɟɫɦɨɬɪɹ ɧɚ ɬɨ, ɱɬɨ ɜ ɤɪɨɜɶ ɧɟɩɪɟɪɵɜɧɨ ɩɨɫɬɭɩɚɸɬ ɫɚɦɵɟ ɪɚɡɥɢɱɧɵɟ ɨɬɯɨɞɵ ɠɢɡɧɟɞɟɹɬɟɥɶɧɨɫɬɢ ɤɥɟɬɨɤ ɢ ɩɪɨɞɭɤɬɵ ɩɢɳɟɜɚɪɟɧɢɹ, ɪɚɡɧɨɨɛɪɚɡɢɟ ɤɨɬɨɪɵɯ ɡɚɜɢɫɢɬ ɨɬ ɭɫɥɨɜɢɣ ɜɧɟɲɧɟɣ
ɫɪɟɞɵ, ɯɚɪɚɤɬɟɪɚ ɮɭɧɤɰɢɢ ɤɥɟɬɨɤ ɢ ɪɨɞɚ ɩɢɳɢ, ɫɨɫɬɚɜ ɤɪɨɜɢ ɜ ɧɨɪɦɟ ɤɨɥɟɛɥɟɬɫɹ ɜ ɨɱɟɧɶ ɨɝɪɚɧɢɱɟɧɧɵɯ ɩɪɟɞɟɥɚɯ. Ⱦɨɫɬɢɝɚɟɬɫɹ ɷɬɢ ɩɪɢ ɩɨɦɨɳɢ ɫɥɨɠɧɵɯ ɧɟɪɜɧɨ-ɪɟɮɥɟɤɬɨɪɧɵɯ ɦɟɯɚɧɢɡɦɨɜ,
ɪɟɝɭɥɢɪɭɸɳɢɯ ɩɨɫɬɨɹɧɫɬɜɨ ɯɢɦɢɱɟɫɤɨɝɨ ɫɨɫɬɚɜɚ ɤɪɨɜɢ ɢ ɟɟ ɮɨɪɦɟɧɧɵɯ ɷɥɟɦɟɧɬɨɜ. Ɋɚɡɥɢɱɧɵɟ ɧɚɪɭɲɟɧɢɹ ɠɢɡɧɟɞɟɹɬɟɥɶɧɨɫɬɢ ɨɪɝɚɧɨɜ ɢ ɬɤɚɧɟɣ ɜɥɢɹɸɬ ɧɚ ɫɨɫɬɚɜ ɤɪɨɜɢ, ɚ ɢɡɦɟɧɟɧɢɟ ɫɨɫɬɚɜɚ ɤɪɨɜɢ,
ɜ ɫɜɨɸ ɨɱɟɪɟɞɶ, ɨɬɪɚɠɚɟɬɫɹ ɧɚ ɠɢɡɧɟɞɟɹɬɟɥɶɧɨɫɬɢ ɨɪɝɚɧɨɜ ɢ ɬɤɚɧɟɣ. ɉɨɷɬɨɦɭ ɤɪɨɜɶ ɱɟɪɟɡɜɵɱɚɣɧɨ
ɬɨɧɤɨ ɪɟɚɝɢɪɭɟɬ ɧɚ ɪɚɡɥɢɱɧɵɟ ɩɚɬɨɥɨɝɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ, ɩɪɨɢɫɯɨɞɹɳɢɟ ɜ ɨɪɝɚɧɢɡɦɟ, ɢ ɧɟɪɟɞɤɨ ɩɨ
ɢɡɦɟɧɟɧɢɸ ɤɨɥɢɱɟɫɬɜɚ ɢ ɫɨɫɬɚɜɧɵɯ ɷɥɟɦɟɧɬɨɜ ɤɪɨɜɢ ɦɨɠɧɨ ɨɩɪɟɞɟɥɢɬɶ ɯɚɪɚɤɬɟɪ ɩɚɬɨɥɨɝɢɱɟɫɤɨɝɨ
ɩɪɨɰɟɫɫɚ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɪɚɡɧɨɫɬɨɪɨɧɧɟɟ ɢɫɫɥɟɞɨɜɚɧɢɟ ɦɨɪɮɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɚɜɚ ɤɪɨɜɢ ɢɦɟɟɬ ɜɚɠɧɨɟ
ɡɧɚɱɟɧɢɟ ɞɥɹ ɪɚɫɩɨɡɧɚɜɚɧɢɹ ɛɨɥɟɡɧɟɣ, ɞɥɹ ɩɨɧɢɦɚɧɢɹ ɫɭɳɟɫɬɜɚ ɜɚɠɧɟɣɲɢɯ ɩɚɬɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ.
Ⱦɥɹ ɢɡɭɱɟɧɢɹ ɦɨɪɮɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɚɜɚ ɤɪɨɜɢ ɝɨɥɲɬɢɧɫɤɨɝɨ ɫɤɨɬɚ ɤɚɧɚɞɫɤɨɣ ɫɟɥɟɤɰɢɢ ɜ ɫɪɚɜɧɟɧɢɢ ɫ ɱɟɪɧɨ-ɩɟɫɬɪɵɦ ɫɤɨɬɨɦ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɩɨɩɭɥɹɰɢɢ, ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɤɥɢɧɢɱɟɫɤɨɣ ɤɚɪɬɢɧɵ ɢ ɬɟɱɟɧɢɹ ɢɧɮɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ ɡɚɛɨɥɟɜɚɧɢɣ ɞɢɫɬɚɥɶɧɨɝɨ ɨɬɞɟɥɚ ɤɨɧɟɱɧɨɫɬɟɣ ɢ ɛɨɥɟɡɧɟɣ
ɪɟɩɪɨɞɭɤɬɢɜɧɵɯ ɨɪɝɚɧɨɜ ɧɚɦɢ ɛɵɥɢ ɡɚɥɨɠɟɧɵ ɨɩɵɬɵ ɧɚ ɛɚɡɟ ɄɌ «Ɂɟɧɱɟɧɤɨ ɢ Ʉ» Ʉɵɡɵɥɠɚɪɫɤɨɝɨ
ɪɚɣɨɧɚ ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɨɣ ɨɛɥɚɫɬɢ.
Ɉɞɧɨɜɪɟɦɟɧɧɨ ɫ ɞɜɭɦɹ ɨɩɵɬɧɵɦɢ ɢ ɨɞɧɨɣ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɚɦɢ, ɩɪɨɜɨɞɢɥɢ ɨɬɛɨɪ ɤɪɨɜɢ ɭ
ɝɢɧɟɤɨɥɨɝɢɱɟɫɤɢ ɛɨɥɶɧɵɯ ɤɨɪɨɜ ɫɪɟɞɢ ɢɦɩɨɪɬɧɨɝɨ ɫɤɨɬɚ ɜ ɤɨɥɢɱɟɫɬɜɟ 10 ɝɨɥɨɜ, ɚ ɬɚɤɠɟ ɞɥɹ ɫɪɚɜɧɟɧɢɹ ɩɨɤɚɡɚɬɟɥɟɣ ɭ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ ɦɟɫɬɧɨɣ ɩɨɩɭɥɹɰɢɢ ɜ ɤɨɥɢɱɟɫɬɜɟ 10 ɝɨɥɨɜ.
ȼɫɟɝɨ ɜ ɷɤɫɩɟɪɢɦɟɧɬɟ ɢɫɩɨɥɶɡɨɜɚɧɨ 50 ɝɨɥɨɜ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ.
Ɋɟɡɭɥɶɬɚɬɵ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɢɡɭɱɟɧɢɸ ɤɚɪɬɢɧɵ ɛɟɥɨɣ ɤɪɨɜɢ ɤɨɪɨɜ ɫɜɟɞɟɧɵ ɜ
ɬɚɛɥ. 1.
ȼ ɯɨɞɟ ɩɪɨɜɟɞɟɧɢɹ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɝɨ ɚɧɚɥɢɡɚ ɩɪɨɛ ɤɪɨɜɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɝɟɦɨɝɪɚɦɦɵ ɤɪɨɜɢ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɡɚɜɟɡɟɧɧɵɯ ɝɨɥɲɬɢɧɫɤɢɯ ɤɨɪɨɜ (III ɤɨɧɬɪɨɥɶɧɚɹ
ɝɪɭɩɩɚ) ɢ ɦɟɫɬɧɵɯ ɱɟɪɧɨ-ɩɟɫɬɪɵɯ ɤɨɪɨɜ ɫɭɳɟɫɬɜɟɧɧɵɯ ɪɚɡɥɢɱɢɣ ɧɟ ɢɦɟɸɬ, ɡɚ ɢɫɤɥɸɱɟɧɢɟɦ ɷɨɡɢɧɨɮɢɥɨɜ, ɸɧɵɯ ɧɟɣɬɪɨɮɢɥɨɜ ɢ ɦɨɧɨɰɢɬɨɜ, ɫɨɞɟɪɠɚɧɢɟ ɤɨɬɨɪɵɯ ɞɨɫɬɨɜɟɪɧɨ ɜɵɲɟ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɧɚ 9,2 %, 1,8 %, 3,2 % ɜ ɤɪɨɜɢ ɤɨɪɨɜ ɦɟɫɬɧɨɣ ɩɨɪɨɞɵ, ɱɟɦ ɬɚɤɨɜɵɟ ɭ ɤɨɪɨɜ ɡɚɪɭɛɟɠɧɨɣ ɫɟɥɟɤɰɢɢ
(Ɋ< 0,05). ɗɨɡɢɧɨɮɢɥɢɹ ɧɚɛɥɸɞɚɟɬɫɹ ɩɪɟɢɦɭɳɟɫɬɜɟɧɧɨ ɩɪɢ ɢɧɜɚɡɢɨɧɧɵɯ ɡɚɛɨɥɟɜɚɧɢɹɯ – ɝɟɥɶɦɢɧɬɨɡɚɯ. ɗɨɡɢɧɨɮɢɥɵ ɨɛɥɚɞɚɸɬ ɚɧɬɢɝɢɫɬɚɦɢɧɧɨɣ ɚɤɬɢɜɧɨɫɬɶɸ, ɩɨɷɬɨɦɭ ɩɪɢɧɢɦɚɸɬ ɭɱɚɫɬɢɟ ɜ
ɚɥɥɟɪɝɢɱɟɫɤɢɯ ɪɟɚɤɰɢɹɯ. ɉɨɹɜɥɟɧɢɟ ɜ ɤɪɨɜɢ ɢɡɛɵɬɤɚ ɧɟɡɪɟɥɵɯ ɮɨɪɦ ɧɟɣɬɪɨɮɢɥɨɜ ɭɤɚɡɵɜɚɟɬ ɧɚ
ɭɫɢɥɟɧɢɟ ɪɟɝɟɧɟɪɚɬɢɜɧɵɯ ɩɪɨɰɟɫɫɨɜ ɜ ɤɪɨɜɟɬɜɨɪɧɵɯ ɨɪɝɚɧɚɯ. ȼɨɡɧɢɤɧɨɜɟɧɢɟ ɦɨɧɨɰɢɬɨɡɚ ɫɜɹɡɚɧɨ ɫ ɩɨɜɵɲɟɧɧɨɣ ɮɭɧɤɰɢɟɣ ɪɟɬɢɤɭɥɨɷɧɞɨɬɟɥɢɚɥɶɧɨɣ ɫɢɫɬɟɦɵ, ɢɡ ɤɥɟɬɨɤ ɤɨɬɨɪɨɣ ɢ ɩɪɨɢɫɯɨɞɹɬ
ɦɨɧɨɰɢɬɵ. Ɉɫɧɨɜɧɚɹ ɮɭɧɤɰɢɹ ɦɨɧɨɰɢɬɨɜ ɫɜɨɞɢɬɫɹ ɤ ɮɚɝɨɰɢɬɨɡɭ ɜɨɡɛɭɞɢɬɟɥɟɣ ɯɪɨɧɢɱɟɫɤɢɯ ɢɧɮɟɤɰɢɣ.
263
Ɍɚɛɥɢɰɚ 1
Ƚɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɤɪɨɜɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ɑɟɪɧɨ-ɩɟɫɬɪɵɣ ɫɤɨɬ
ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɩɨɩɭɥɹɰɢɢ
Ƚɨɥɲɬɢɧɫɤɢɣ ɫɤɨɬ ɤɚɧɚɞɫɤɨɣ ɫɟɥɟɤɰɢɢ
Ƚɢɧɟɤɨɥɨɝɢɱɟɫɤɢɟ ɡɚɛɨɥɟɜɚɧɢɹ
Ȼɨɥɟɡɧɢ ɤɨɧɟɱɧɨɫɬɟɣ
ɉɨɤɚɡɚɬɟɥɢ
III ɤɨɧɬɪɨɥɶI ɨɩɵɬɧɚɹ
II ɨɩɵɬɧɚɹ
ɧɚɹ ɝɪɭɩɩɚ, ɝɪɭɩɩɚ, ɩɪɟɞɜɚɪɢ- ɝɪɭɩɩɚ, ɞɢɚɝɧɨɡ
ɤɥɢɧɢɱɟɫɤɢ ɬɟɥɶɧɵɣ ɞɢɚɝɧɨɡ ɩɪɨɤɨɥɵ, ɹɡɜɵ,
ɡɞɨɪɨɜɵɟ
ɧɟɤɪɨɛɚɤɬɟɪɢɨɡ
ɩɨɞɨɞɟɪɦɚɬɢɬ
(n= 10), Ɇ±m
(n= 10), Ɇ±m
(n= 10), Ɇ±m
ɀɢɜɨɬɧɵɟ
ɫ ɞɢɚɝɧɨɡɨɦ
ɷɧɞɨɦɟɬɪɢɬ
(n= 10), Ɇ±m
Ʌɟɣɤɨɰɢɬɵ, ɬɵɫ.
8,1±0,6
13,6±0,4
11,5±0,7
7,9±0,8
Ȼɚɡɨɮɢɥɵ, %
0,9±0,4
1,0±0,09
1,2±0,2
1,0±0,2
ɗɨɡɢɧɨɮɢɥɵ, %
5,2±0,3
6,3±0,5
7,1±0,03
16±1,0
0,6±0,2
4,6±1,2
4,0±0,7
-
3,8±0,7
15,4±1,6
14,2±0,9
28±2,06
26,2±1,5
43,6±1,6
39,4±1,4
7,4±1,03
Ʌɢɦɮɨɰɢɬɵ, %
59,4±1,03
31,4±1,09
32,4±1,4
53±2,6
Ɇɨɧɨɰɢɬɵ, %
4,6±0,6
2,1±0,3
2,7±0,35
1,5±0,2
ɘɧɵɟ ɧɟɣɬɪɨɮɢɥɵ, %
ɉɚɥɨɱɤɨɹɞɟɪɧɵɟ
ɧɟɣɬɪɨɮɢɥɵ, %
ɋɟɝɦɟɧɬɨɹɞɟɪɧɵɟ
ɧɟɣɬɪɨɮɢɥɵ, %
ɇɨɪɦɚ*
_7,0_
4,5–12,0
_0,1_
0,0–2,0
6,5
5,0–8,0
0,5
0,0–1,0
3,0
2,0–5,0
_28,0
20,0–35,0
_57,5_
40,0–65,0
_3,5_
2,0–7,0
Ʉɥɢɧɢɱɟɫɤɢ
ɡɞɨɪɨɜɵɟ
ɠɢɜɨɬɧɵɟ
(n= 10), Ɇ±m
7,4±0,8
1,2±0,2
14,4±0,7
2,4±0,3
3,0±0,7
27,8±1,3
58,2±1,09
7,8±0,4
ɉɪɢɦɟɱɚɧɢɹ: 1 Ɋ < 0,001
2 * – ɜ ɞɪɨɛɹɯ: ɱɢɫɥɢɬɟɥɶ – ɫɪɟɞɧɢɣ ɩɨɤɚɡɚɬɟɥɶ ɤɨɥɢɱɟɫɬɜɚ ɤɥɟɬɨɤ ɤɪɨɜɢ Ɇ ɢ ɨɲɢɛɤɚ m, ɡɧɚɦɟɧɚɬɟɥɶ – ɞɢɚɩɚɡɨɧ
ɤɨɥɟɛɚɧɢɣ ɞɚɧɧɵɯ ɜɟɥɢɱɢɧ
Ɋɟɡɤɨɟ ɢɡɦɟɧɟɧɢɟ ɤɨɥɢɱɟɫɬɜɚ ɥɟɣɤɨɰɢɬɨɜ, ɧɟɣɬɪɨɮɢɥɨɜ, ɥɢɦɮɨɰɢɬɨɜ ɢ ɦɨɧɨɰɢɬɨɜ ɪɟɝɢɫɬɪɢɪɨɜɚɥɢ ɜ I ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɠɢɜɨɬɧɵɯ, ɫ ɩɪɟɞɜɚɪɢɬɟɥɶɧɵɦ ɞɢɚɝɧɨɡɨɦ ɧɟɤɪɨɛɚɤɬɟɪɢɨɡ. ɑɢɫɥɨ ɥɟɣɤɨɰɢɬɨɜ ɭɜɟɥɢɱɟɧɨ ɜ ɫɪɚɜɧɟɧɢɢ ɫ ɩɨɤɚɡɚɬɟɥɹɦɢ III ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɧɚ 5,5 ɬɵɫ., ɫɭɦɦɚɪɧɵɣ ɩɨɤɚɡɚɬɟɥɶ ɧɟɣɬɪɨɮɢɥɨɜ ɭɜɟɥɢɱɟɧ ɧɚ 33 %, ɬɨɝɞɚ ɤɚɤ ɜɨ II ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ, ɫ ɞɢɚɝɧɨɡɨɦ ɩɨɞɨɞɟɪɦɚɬɢɬ,
ɩɪɨɤɨɥɵ, ɹɡɜɵ ɩɨɞɨɲɜɵ ɢ ɦɹɤɢɲɚ, ɷɬɨɬ ɩɨɤɚɡɚɬɟɥɶ ɭɜɟɥɢɱɟɧ ɧɚ 27 % ɩɪɨɬɢɜ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ. ɉɪɢɱɟɦ ɨɬɦɟɱɟɧɚ ɹɪɤɨ ɜɵɪɚɠɟɧɧɚɹ ɧɟɣɬɪɨɮɢɥɢɹ ɫɨ ɫɞɜɢɝɨɦ ɜ ɫɬɨɪɨɧɭ ɞɨ ɫɟɝɦɟɧɬɨɹɞɟɪɧɵɯ
43,6±1,6 ɢ 39,4±1,4 % (I ɢ II ɝɪɭɩɩɵ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ). ɉɪɢ ɷɬɨɦ ɱɢɫɥɨ ɥɢɦɮɨɰɢɬɨɜ ɢ ɦɨɧɨɰɢɬɨɜ
ɭɦɟɧɶɲɟɧɨ, ɜ ɫɪɟɞɧɟɦ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɧɚ 28 % ɢ 2,5 % (I ɝɪɭɩɩɚ) ɢ ɧɚ 27 % ɢ 1,9 % (II ɝɪɭɩɩɚ).
ɉɨɤɚɡɚɬɟɥɢ ɛɚɡɨɮɢɥɨɜ ɢ ɷɨɡɢɧɨɮɢɥɨɜ ɧɚɯɨɞɢɥɢɫɶ ɜ ɩɪɟɞɟɥɚɯ ɧɨɪɦɵ.
ɇɟɣɬɪɨɮɢɥɶɧɵɣ ɥɟɣɤɨɰɢɬɨɡ (ɧɟɣɪɨɮɢɥɢɹ) ɛɨɥɶɲɟɣ ɱɚɫɬɶɸ ɫɨɩɭɬɫɬɜɭɟɬ ɨɫɬɪɵɦ ɢɧɮɟɤɰɢɨɧɧɵɦ ɡɚɛɨɥɟɜɚɧɢɹɦ ɢ ɞɪɭɝɢɦ ɩɚɬɨɥɨɝɢɱɟɫɤɢɦ ɩɪɨɰɟɫɫɚɦ. Ɇɨɧɨɰɢɬɨɩɟɧɢɹ ɭɦɟɧɶɲɟɧɢɟ ɤɨɥɢɱɟɫɬɜɚ ɦɨɧɨɰɢɬɨɜ, ɧɚɛɥɸɞɟɧɢɹ ɩɪɢ ɨɫɬɪɵɯ ɫɟɩɬɢɱɟɫɤɢɯ ɡɚɛɨɥɟɜɚɧɢɹɯ ɫ ɧɟɣɬɪɨɮɢɥɢɹɦɢ, ɱɬɨ ɤɚɫɚɟɬɫɹ ɤɨɪɨɜ ɫ ɩɚɬɨɥɨɝɢɱɟɫɤɢɦɢ ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɦɢ ɢ ɮɭɧɤɰɢɨɧɚɥɶɧɵɦɢ ɢɡɦɟɧɟɧɢɹɦɢ ɨɪɝɚɧɨɜ ɪɟɩɪɨɞɭɤɬɢɜɧɵɯ ɮɭɧɤɰɢɣ, ɬɨ ɤɚɪɬɢɧɚ ɢɯ ɛɟɥɨɣ ɤɪɨɜɢ ɬɚɤɠɟ ɢɦɟɟɬ ɨɬɤɥɨɧɟɧɢɹ ɨɬ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ
ɧɨɪɦɵ. Ɏɢɤɫɢɪɨɜɚɥɢ ɷɨɡɢɧɨɮɢɥɢɸ – ɱɢɫɥɨ ɷɨɡɢɧɨɮɢɥɨɜ ɭɜɟɥɢɱɟɧɨ ɞɨ 16,0 %±1,0, ɬɨɝɞɚ ɤɚɤ ɭ
ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɢɦɩɨɪɬɧɵɯ ɤɨɪɨɜ ɨɧ ɞɨɫɬɢɝɚɥ 5,2 %±0,03. ɇɟɣɬɪɨɮɢɥɢɹ ɯɚɪɚɤɬɟɪɢɡɨɜɚɥɚɫɶ ɹɞɟɪɧɵɦ ɫɞɜɢɝɨɦ, ɬ.ɟ. ɩɨɜɵɲɟɧɢɟɦ ɩɪɨɰɟɧɬɚ ɧɟɡɪɟɥɵɯ ɩɚɥɨɱɤɨɹɞɟɪɧɵɯ ɧɟɣɬɪɨɮɢɥɨɜ ɧɚ
24,2 %, ɩɪɢ ɨɞɧɨɜɪɟɦɟɧɧɨɦ ɫɧɢɠɟɧɢɢ ɧɚ 18,8 % ɫɟɝɦɟɧɬɨɹɞɟɪɧɵɯ ɧɟɣɬɪɨɮɢɥɨɜ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ
ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɨɣ. ɉɨɤɚɡɚɬɟɥɢ ɥɟɣɤɨɰɢɬɨɜ, ɥɢɦɮɨɰɢɬɨɜ ɢ ɦɨɧɨɰɢɬɨɜ ɧɚɯɨɞɢɥɢɫɶ ɜ ɩɪɟɞɟɥɚɯ
ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ.
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɢɡɭɱɟɧɢɸ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɚɜɚ ɤɪɨɜɢ ɝɨɥɲɬɢɧɫɤɨɝɨ ɫɤɨɬɚ ɤɚɧɚɞɫɤɨɣ ɫɟɥɟɤɰɢɢ ɜ ɫɪɚɜɧɟɧɢɢ ɫ ɱɟɪɧɨ-ɩɟɫɬɪɵɦ ɫɤɨɬɨɦ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɩɨɩɭɥɹɰɢɢ, ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɤɥɢɧɢɱɟɫɤɨɣ ɤɚɪɬɢɧɵ ɢ ɬɟɱɟɧɢɹ ɢɧɮɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ ɡɚɛɨɥɟɜɚɧɢɣ ɤɨɧɟɱɧɨɫɬɟɣ ɜɵɹɜɥɟɧɨ ɱɬɨ, ɝɟɦɨɝɪɚɦɦɵ ɤɪɨɜɢ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɯ ɡɚɜɟɡɟɧɧɵɯ ɝɨɥɲɬɢɧɫɤɢɯ ɤɨɪɨɜ
ɢ ɦɟɫɬɧɵɯ ɱɟɪɧɨ-ɩɟɫɬɪɵɯ ɤɨɪɨɜ ɫɭɳɟɫɬɜɟɧɧɵɯ ɪɚɡɥɢɱɢɣ ɦɟɠɞɭ ɫɨɛɨɣ ɢ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɨɣ
ɧɟ ɢɦɟɸɬ. ɉɨɷɬɨɦɭ ɪɚɧɟɟ ɭɫɬɚɧɨɜɥɟɧɧɵɟ ɧɨɪɦɵ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɚɜɚ ɤɪɨɜɢ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ (Ʉɭɞɪɹɜɰɟɜ Ⱥ.Ⱥ., 1969 ɢ ɞɪ.) ɜɩɨɥɧɟ ɦɨɠɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɜ ɤɚɱɟɫɬɜɟ ɧɨɪɦɚɬɢɜɨɜ ɞɥɹ
ɡɚɜɟɡɟɧɧɨɝɨ ɝɨɥɲɬɢɧɫɤɨɝɨ ɫɤɨɬɚ ɤɚɧɚɞɫɤɨɣ ɫɟɥɟɤɰɢɢ.
264
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
ɗɣɞɪɢɝɟɜɢɱ ȿ.ȼ., Ɋɚɟɜɫɤɚɹ ȼ.ȼ. ɂɧɬɟɪɶɟɪ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ. – Ɇɨɫɤɜɚ: Ʉɨɥɨɫ, 1978.255 ɫ.
ȿɝɨɪɨɜɚ Ⱥ.ɋ. ɢ ɞɪ. Ɍɟɨɪɢɹ ɢ ɩɪɚɤɬɢɤɚ ɢɦɦɭɧɨɮɟɪɦɟɧɬɧɨɝɨ ɚɧɚɥɢɡɚ// – Ɇɨɫɤɜɚ, – 1991. – ɋ. 186.
Ʉɭɞɪɹɜɰɟɜ Ⱥ.Ⱥ., Ʉɭɞɪɹɜɰɟɜɚ Ʌ.Ⱥ., ɉɪɢɜɨɥɶɧɨɜ Ɍ.ɂ. Ƚɟɦɚɬɨɥɨɝɢɹ ɠɢɜɨɬɧɵɯ ɢ ɪɵɛ// – Ɇɨɫɤɜɚ: Ʉɨɥɨɫ, –
1969. – ɋ. 319.
ɍȾɄ 619 : 612 :. 017
ɉɊɂɆȿɇȿɇɂȿ ɉɊȿɉȺɊȺɌȺ ɂɁ ɉɊɂɊɈȾɇɈȽɈ ɋɕɊɖə
ȾɅə Ʌȿɑȿɇɂə ȻɈɅȿɁɇȿɃ ɆɈɅɈɑɇɈɃ ɀȿɅȿɁɕ ɄɈɊɈȼ
ɆɂɇɀȺɋɈȼ Ʉ.ɂ., ȺɍȻȺɄɂɊɈȼȺ Ⱥ.Ʉ., ȺɅɂɆȻȺȿȼ Ɇ.Ʉ.,
ɆɍɏȺɆȿɌɈȼȺ ȼ.Ⱦ., ɌɍəɄɈȼ Ʉ.ɀ.
ɌɈɈ «ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ», ɚ. Ȼɟɫɤɨɥɶ, Ʉɚɡɚɯɫɬɚɧ, e-mail: sevkaz_agroinnov@inbox.ru
Ɇɚɫɬɢɬ ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧ ɫɪɟɞɢ ɦɚɬɨɱɧɨɝɨ ɩɨɝɨɥɨɜɶɹ ɢ ɧɚɧɨɫɢɬ ɡɧɚɱɢɬɟɥɶɧɵɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ, ɧɟɝɚɬɢɜɧɨ ɫɤɚɡɵɜɚɹɫɶ ɤɚɤ ɧɚ ɤɨɥɢɱɟɫɬɜɟ ɩɨɥɭɱɚɟɦɨɝɨ ɨɬ ɤɨɪɨɜ ɦɨɥɨɤɚ, ɬɚɤ ɢ ɧɚ ɟɝɨ
ɤɚɱɟɫɬɜɟ. ȼ ɨɞɧɢɯ ɫɥɭɱɚɹɯ ɨɧ ɩɪɨɹɜɥɹɟɬɫɹ ɤɥɢɧɢɱɟɫɤɢ, ɚ ɜ ɞɪɭɝɢɯ ɩɪɨɬɟɤɚɟɬ ɛɟɡ ɜɵɪɚɠɟɧɧɵɯ ɫɢɦɩɬɨɦɨɜ. ɍ ɠɢɜɨɬɧɵɯ ɪɟɡɤɨ ɫɧɢɠɚɟɬɫɹ ɦɨɥɨɱɧɚɹ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶ, ɭɜɟɥɢɱɢɜɚɟɬɫɹ ɩɪɟɠɞɟɜɪɟɦɟɧɧɚɹ
ɜɵɛɪɚɤɨɜɤɚ ɛɨɥɶɧɵɯ ɨɫɨɛɟɣ, ɜɨɡɪɚɫɬɚɟɬ ɨɛɳɚɹ ɦɢɤɪɨɛɧɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ ɦɨɥɨɤɚ. ɉɨɥɭɱɟɧɧɨɟ
ɢɡ ɩɨɪɚɠɟɧɧɵɯ ɞɨɥɟɣ ɜɵɦɟɧɢ ɦɨɥɨɤɨ ɬɟɪɹɟɬ ɩɢɬɚɬɟɥɶɧɭɸ ɰɟɧɧɨɫɬɶ ɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ,
ɧɟɨɛɯɨɞɢɦɵɟ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ [1,2].
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɧɚɭɱɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨ ɩɪɢɦɟɧɟɧɢɸ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɩɪɟɩɚɪɚɬɨɜ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ ɹɜɥɹɟɬɫɹ ɫɨɜɪɟɦɟɧɧɵɦɢ ɢ ɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɦɢ.
ɉɪɟɩɚɪɚɬɵ ɢɡ ɪɚɫɬɟɧɢɣ, ɜ ɱɚɫɬɧɨɫɬɢ ɛɟɪɟɡɵ ɩɨɜɢɫɥɨɣ, ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɫɢɧɬɟɬɢɱɟɫɤɢɦɢ ɥɟɤɚɪɫɬɜɚɦɢ ɢɦɟɸɬ ɪɹɞ ɩɪɟɢɦɭɳɟɫɬɜ. Ȼɭɞɭɱɢ ɫɥɨɠɧɵɦɢ ɩɨ ɫɨɫɬɚɜɭ, ɨɧɢ ɨɛɥɚɞɚɸɬ ɜɵɫɨɤɨɣ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɶɸ, ɚɧɬɢɦɢɤɪɨɛɧɵɦ, ɩɪɨɬɢɜɨɜɨɫɩɚɥɢɬɟɥɶɧɵɦ, ɨɛɟɡɛɨɥɢɜɚɸɳɢɦ ɞɟɣɫɬɜɢɹɦɢ,
ɫɩɨɫɨɛɧɨɫɬɶɸ ɫɬɢɦɭɥɢɪɨɜɚɬɶ ɢɦɦɭɧɨɥɨɝɢɱɟɫɤɭɸ ɪɟɚɤɬɢɜɧɨɫɬɶ ɨɪɝɚɧɢɡɦɚ. Ʉɪɨɦɟ ɬɨɝɨ, ɩɪɟɩɚɪɚɬɵ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ, ɨɛɥɚɞɚɸɬ ɫɬɨɣɤɢɦ ɬɟɪɚɩɟɜɬɢɱɟɫɤɢɦ ɷɮɮɟɤɬɨɦ, ɦɚɥɨɬɨɤɫɢɱɧɵ
ɢ ɪɟɞɤɨ ɨɤɚɡɵɜɚɸɬ ɩɨɛɨɱɧɨɟ ɞɟɣɫɬɜɢɟ.
ɋɟɪɢɸ ɨɩɵɬɨɜ ɩɨ ɨɩɪɟɞɟɥɟɧɢɸ ɞɨɡɵ ɢ ɢɡɭɱɟɧɢɸ ɬɟɪɚɩɟɜɬɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɪɟɩɚɪɚɬɚ
ɩɪɢɝɨɬɨɜɥɟɧɧɨɝɨ ɧɚɦɢ, ɧɚ ɨɫɧɨɜɟ ɷɤɫɬɪɚɤɬɚ ɩɨɱɟɤ ɢ ɩɨɛɟɝɨɜ ɛɟɪɟɡɵ ɜ ɮɨɪɦɟ ɦɚɡɢ ɞɥɹ ɥɟɱɟɧɢɹ
ɦɨɥɨɱɧɨɣ ɠɟɥɟɡɵ ɤɨɪɨɜ, ɩɪɨɜɨɞɢɥɢ ɜ ɌɈɈ «ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɚɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ ɨɩɵɬɧɚɹ ɫɬɚɧɰɢɹ, ɜ ɨɩɵɬ ɛɵɥɢ ɨɬɨɛɪɚɧɵ ɠɢɜɨɬɧɵɟ ɜ ɤɨɥɢɱɟɫɬɜɟ 60 ɝɨɥɨɜ ɫ ɞɢɚɝɧɨɡɨɦ ɫɭɛɤɥɢɧɢɱɟɫɤɢɣ ɢ ɫɟɪɨɡɧɵɣ ɦɚɫɬɢɬ, ɜ ɬɨɦ ɱɢɫɥɟ 7 ɝɨɥɨɜ ɤɨɪɨɜ ɧɚ ɮɨɧɟ ɷɧɞɨɦɟɬɪɢɬɚ ɢ ɡɚɞɟɪɠɚɧɢɹ ɩɨɫɥɟɞɚ.
Ⱦɢɚɝɧɨɡ ɫɬɚɜɢɥɢ ɧɚ ɨɫɧɨɜɚɧɢɢ ɩɪɢɡɧɚɤɨɜ ɡɚɛɨɥɟɜɚɧɢɣ ɢ ɪɟɡɭɥɶɬɚɬɨɜ ɥɚɛɨɪɚɬɨɪɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ,
ɩɪɨɛ ɫɟɤɪɟɬɚ ɜɨɫɩɚɥɟɧɧɵɯ ɦɨɥɨɱɧɵɯ ɠɟɥɟɡ, ɛɪɨɦɬɢɦɨɥɨɜɨɣ ɩɪɨɛɨɣ, ɩɪɨɛɨɣ ɦɚɫɬɢɞɢɧɚ (ɩɨ ȼ.ɂ.
Ɇɭɬɨɜɢɧɭ) ɫ ɞɨɩɨɥɧɢɬɟɥɶɧɨɣ ɩɪɨɛɨɣ ɨɬɫɬɚɢɜɚɧɢɹ ɢ ɩɨɞɫɱɟɬ ɫɨɦɚɬɢɱɟɫɤɢɯ ɤɥɟɬɨɤ. ɀɢɜɨɬɧɵɯ ɪɚɡɞɟɥɢɥɢ ɧɚ ɬɪɢ ɝɪɭɩɩɵ ɩɨ 20 ɝɨɥɨɜ ɜ ɤɚɠɞɨɣ. ȼ ɩɟɪɜɨɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɞɥɹ ɥɟɱɟɧɢɹ ɩɪɢɦɟɧɹɥɢ ɩɪɟɩɚɪɚɬ ɛɟɪɟɡɵ ɜ ɮɨɪɦɟ ɦɚɡɢ (ɚɤɬɢɜɧɨɟ ɜɟɳɟɫɬɜɨ ɜ ɞɨɡɟ 40 %), ɜɬɢɪɚɹ ɜ ɤɨɠɭ ɩɨɪɚɠɟɧɧɨɣ ɱɟɬɜɟɪɬɢ
ɜɵɦɟɧɢ 2 ɪɚɡɚ ɜ ɫɭɬɤɢ ɜ ɬɟɱɟɧɢɟ 5 ɞɧɟɣ, ɜɨ ɜɬɨɪɨɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɩɪɢɦɟɧɹɥɢ ɩɪɟɩɚɪɚɬ ɛɟɪɟɡɵ ɜ
ɮɨɪɦɟ ɦɚɡɢ (ɚɤɬɢɜɧɨɟ ɜɟɳɟɫɬɜɨ ɜ ɞɨɡɟ 37 %), ɜɬɢɪɚɹ ɜ ɤɨɠɭ ɩɨɪɚɠɟɧɧɨɣ ɱɟɬɜɟɪɬɢ ɜɵɦɟɧɢ 2 ɪɚɡɚ
ɜ ɫɭɬɤɢ ɜ ɬɟɱɟɧɢɟ 5 ɞɧɟɣ.
ȼ ɬɪɟɬɶɟɣ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɩɪɢɦɟɧɹɥɢ ɬɪɚɞɢɰɢɨɧɧɵɣ ɦɟɬɨɞ ɥɟɱɟɧɢɹ, ɜɬɢɪɚɧɢɟ ɜ ɤɨɠɭ ɩɨɪɚɠɟɧɧɨɣ ɱɟɬɜɟɪɬɢ ɜɵɦɟɧɢ ɬɟɬɪɚɰɢɤɥɢɧɨɜɨɣ ɦɚɡɢ 2 ɪɚɡɚ ɜ ɫɭɬɤɢ ɜ ɬɟɱɟɧɢɟ 5 ɞɧɟɣ. Ʌɟɱɟɧɢɟ ɩɪɨɜɨɞɢɥɢ ɩɨɫɥɟ ɞɨɟɧɢɹ ɤɨɪɨɜ, ɜɨ ɜɫɟɯ ɬɪɟɯ ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ ɞɥɹ ɭɫɤɨɪɟɧɢɹ ɪɚɫɫɚɫɵɜɚɧɢɹ ɜɨɫɩɚɥɢɬɟɥɶɧɵɯ ɨɬɟɤɨɜ ɢ ɢɧɮɢɥɶɬɪɚɬɨɜ, ɩɪɢɦɟɧɹɥɢ ɥɟɝɤɢɣ ɦɚɫɫɚɠ ɜɵɦɟɧɢ, ɫɧɢɡɭ ɜɜɟɪɯ, ɬɨ ɟɫɬɶ ɨɬ ɫɨɫɤɨɜ
ɤ ɨɫɧɨɜɚɧɢɸ ɜɵɦɟɧɢ, ɩɨ ɯɨɞɭ ɜɟɧɨɡɧɵɯ ɢ ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɫɨɫɭɞɨɜ 2 ɪɚɡɚ ɜ ɫɭɬɤɢ ɩɨ 15 ɦɢɧɭɬ ɜ
ɬɟɱɟɧɢɟ 5 ɞɧɟɣ, ɨɝɪɚɧɢɱɢɥɢ ɜɨɞɨɩɨɣ ɢ ɞɚɱɭ ɫɨɱɧɵɯ ɤɨɪɦɨɜ, ɠɢɜɨɬɧɵɯ ɩɟɪɟɜɟɥɢ ɧɚ ɫɟɧɨ, ɡɚɬɟɦ ɜ
ɩɪɨɰɟɫɫɟ ɥɟɱɟɧɢɹ, ɟɠɟɞɧɟɜɧɨ ɫɨɱɧɵɟ ɤɨɪɦɚ ɦɚɥɵɦɢ ɩɨɪɰɢɹɦɢ ɞɨɛɚɜɥɹɥɢ ɜ ɪɚɰɢɨɧ. ɋɯɟɦɚ ɨɩɵɬɚ
ɩɪɟɞɫɬɚɜɥɟɧɚ ɜ ɬɚɛɥ. 1.
265
Ɍɚɛɥɢɰɚ 1
ɋɯɟɦɚ ɨɩɵɬɚ ɩɨ ɨɩɪɟɞɟɥɟɧɢɸ ɞɨɡɵ ɢ ɬɟɪɚɩɟɜɬɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɪɟɩɚɪɚɬɚ ɛɟɪɟɡɵ
ɩɪɢ ɜɨɫɩɚɥɟɧɢɢ ɦɨɥɨɱɧɨɣ ɠɟɥɟɡɵ ɤɨɪɨɜ.
Ƚɪɭɩɩɚ
I
ɨɩɵɬɧɚɹ
II
ɨɩɵɬɧɚɹ
III
ɤɨɧɬɪɨɥɶɧɚɹ
Ʉɨɥ-ɜɨ
ɠɢɜɨɬɧɵɯ, ɝɨɥ.
20
20
20
Ʌɟɱɟɧɢɟ
ɜɬɢɪɚɧɢɟ ɜ ɤɨɠɭ ɜɵɦɟɧɢ ɩɪɟɩɚɪɚɬɚ ɛɟɪɟɡɵ ɜ ɮɨɪɦɟ ɦɚɡɢ (ɚɤɬɢɜɧɨɟ
ɜɟɳɟɫɬɜɨ ɜ ɞɨɡɟ 40 %), 2 ɪɚɡɚ ɜ ɫɭɬɤɢ ɜ ɬɟɱɟɧɢɟ 5 ɞɧɟɣ
ɜɬɢɪɚɧɢɟ ɜ ɤɨɠɭ ɜɵɦɟɧɢ ɩɪɟɩɚɪɚɬɚ ɛɟɪɟɡɵ ɜ ɮɨɪɦɟ ɦɚɡɢ (ɚɤɬɢɜɧɨɟ
ɜɟɳɟɫɬɜɨ ɜ ɞɨɡɟ 37 %), 2 ɪɚɡɚ ɜ ɫɭɬɤɢ ɜ ɬɟɱɟɧɢɟ 5 ɞɧɟɣ
ɜɬɢɪɚɧɢɟ ɜ ɤɨɠɭ ɜɵɦɟɧɢ ɬɟɬɪɚɰɢɤɥɢɧɨɜɭɸ ɦɚɡɶ 2 ɪɚɡɚ ɜ ɫɭɬɤɢ ɜ
ɬɟɱɟɧɢɟ 5 ɞɧɟɣ
ɗɮɮɟɤɬɢɜɧɨɫɬɶ ɥɟɱɟɧɢɹ ɨɰɟɧɢɜɚɥɢ ɩɨ ɫɪɨɤɚɦ ɜɵɡɞɨɪɨɜɥɟɧɢɹ ɠɢɜɨɬɧɵɯ ɫ ɧɨɪɦɚɥɢɡɚɰɢɟɣ ɤɚɱɟɫɬɜɚ ɢ ɤɨɥɢɱɟɫɬɜɚ ɭɞɨɟɜ.
ɉɨɫɥɟ ɩɪɨɜɟɞɟɧɧɨɝɨ ɥɟɱɟɧɢɹ ɜ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɭ 7 (35 %) ɝɨɥɨɜ ɢɡ 20, ɫɟɪɨɡɧɵɣ ɦɚɫɬɢɬ
ɩɟɪɟɲɟɥ ɜ ɯɪɨɧɢɱɟɫɤɭɸ ɮɨɪɦɭ. Ɉɫɬɚɥɶɧɵɟ ɠɢɜɨɬɧɵɟ ɜɵɡɞɨɪɨɜɟɥɢ, ɫɟɤɪɟɰɢɹ ɦɨɥɨɤɚ ɜɨɫɫɬɚɧɨɜɢɥɚɫɶ, ɢɫɱɟɡɥɢ ɨɬɟɤɢ, ɦɟɫɬɧɚɹ ɬɟɦɩɟɪɚɬɭɪɚ ɩɪɢɲɥɚ ɜ ɧɨɪɦɭ.
ɍ ɧɟɤɨɬɨɪɵɯ ɠɢɜɨɬɧɵɯ ɧɚ ɜɵɦɟɧɢ ɨɫɬɚɥɢɫɶ ɭɩɥɨɬɧɟɧɢɹ, ɩɨɤɚɡɚɬɟɥɢ ɫɨɦɚɬɢɱɟɫɤɢɯ ɤɥɟɬɨɤ
ɨɩɭɫɬɢɥɢɫɶ ɞɨ ɧɨɪɦɵ, ɛɪɨɦɬɢɦɨɥɨɜɚɹ ɩɪɨɛɚ ɢ ɩɪɨɛɚ ɨɬɫɬɚɢɜɚɧɢɹ ɦɨɥɨɤɚ ɩɨɤɚɡɚɥɚ ɨɬɪɢɰɚɬɟɥɶɧɵɣ
ɪɟɡɭɥɶɬɚɬ. ȼ I ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɠɢɜɨɬɧɵɟ ɜɵɡɞɨɪɨɜɟɥɢ ɜ 100 % ɫɥɭɱɚɟɜ, ɜ II ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɠɢɜɨɬɧɵɟ ɜɵɡɞɨɪɨɜɟɥɢ ɜ 90 % ɫɥɭɱɚɟɜ. ɉɪɢɱɟɦ ɜ ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ ɫɪɨɤɢ ɜɵɡɞɨɪɨɜɥɟɧɢɹ ɫɨɤɪɚɳɟɧɵ ɩɨɱɬɢ ɜɞɜɨɟ (ɫɨɫɬɚɜɢɥɢ 6 ɢ 9 ɞɧɟɣ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ) ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɨɣ (14
ɞɧɟɣ). Ʌɟɱɟɧɢɟ ɠɢɜɨɬɧɵɯ ɩɪɨɞɨɥɠɚɥɢ ɞɨ ɜɵɡɞɨɪɨɜɥɟɧɢɹ.
ɉɨ ɬɟɪɚɩɟɜɬɢɱɟɫɤɨɦɭ ɞɟɣɫɬɜɢɸ ɷɮɮɟɤɬɢɜɧɨɣ ɨɤɚɡɚɥɚɫɶ ɞɨɡɚ ɜ 40 % ɚɤɬɢɜɧɨɝɨ ɜɟɳɟɫɬɜɚ ɦɚɡɢ,
ɩɪɨɹɜɥɹɹ ɜɵɫɨɤɭɸ ɚɧɬɢɦɢɤɪɨɛɧɭɸ ɢ ɩɪɨɬɢɜɨɜɨɫɩɚɥɢɬɟɥɶɧɭɸ ɚɤɬɢɜɧɨɫɬɶ, ɜ 1 ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ
ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɥɟɱɟɧɢɹ ɫɨɫɬɚɜɢɥɚ 6 ɫɭɬɨɤ. ȼɨ II ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ, ɝɞɟ ɩɪɢɦɟɧɹɥɫɹ ɩɪɟɩɚɪɚɬ
ɫ ɞɨɡɢɪɨɜɤɨɣ 37 %, ɫɪɨɤɢ ɥɟɱɟɧɢɹ ɛɵɥɢ ɩɪɨɞɥɟɧɵ ɧɚ 3 ɫɭɬɨɤ ɢ ɫɨɫɬɚɜɢɥɢ 9 ɫɭɬɨɤ, ɜ ɤɨɧɬɪɨɥɶɧɨɣ
ɝɪɭɩɩɟ ɧɚ 14- ɞɟɧɶ. Ɇɨɥɨɤɨ, ɩɨɥɭɱɟɧɧɨɟ ɨɬ ɤɨɪɨɜ ɜ ɩɟɪɜɨɣ ɢ ɜɬɨɪɨɣ ɝɪɭɩɩɚɯ, ɩɨɫɥɟ ɜɵɡɞɨɪɨɜɥɟɧɢɹ
ɢ ɩɨɫɥɟɞɧɟɝɨ ɩɪɢɦɟɧɟɧɢɹ ɩɪɟɩɚɪɚɬɚ ɢɡ ɩɪɢɪɨɞɧɨɝɨ ɫɵɪɶɹ, ɩɨ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɦ ɢ ɥɚɛɨɪɚɬɨɪɧɵɦ
ɩɨɤɚɡɚɬɟɥɹɦ ɫɨɨɬɜɟɬɫɬɜɨɜɚɥɚ ɬɚɤɨɜɨɦɭ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ ɢ ɛɵɥɨ ɩɪɢɝɨɞɧɨ ɤ ɭɩɨɬɪɟɛɥɟɧɢɸ ɜ
ɩɢɳɭ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɩɪɟɩɚɪɚɬɵ ɢɡɝɨɬɨɜɥɟɧɧɵɟ ɧɚɦɢ ɢɡ ɩɨɱɟɤ ɢ ɩɨɛɟɝɨɜ ɛɟɪɟɡɵ ɩɨɜɢɫɥɨɣ, ɯɨɪɨɲɨ
ɩɟɪɟɧɨɫɹɬɫɹ ɠɢɜɨɬɧɵɦɢ, ɦɚɡɶ ɞɥɢɬɟɥɶɧɨ ɡɚɞɟɪɠɢɜɚɹɫɶ ɜ ɬɨɥɳɟ ɤɨɠɢ ɢ ɩɪɨɧɢɤɚɹ ɜ ɩɨɞɤɨɠɧɵɟ
ɫɨɫɭɞɵ, ɭɫɢɥɢɜɚɟɬ ɤɪɨɜɨɫɧɚɛɠɟɧɢɟ, ɨɛɨɫɬɪɹɹ ɜɨɫɩɚɥɢɬɟɥɶɧɵɟ ɩɪɨɰɟɫɫɵ, ɭɥɭɱɲɚɟɬ ɪɚɫɫɚɫɵɜɚɧɢɟ
ɩɪɨɞɭɤɬɨɜ ɜɨɫɩɚɥɟɧɢɹ. Ɉɛɟ ɢɫɩɵɬɭɟɦɵɟ ɞɨɡɵ – 4,0 ɢ 3,7ɝ, ɩɨɤɚɡɚɥɢ ɩɪɚɤɬɢɱɟɫɤɢ ɨɞɢɧɚɤɨɜɭɸ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɨ ɫɪɨɤɚɦ ɜɵɡɞɨɪɨɜɥɟɧɢɹ – 6 ɫɭɬɨɤ, ɫ ɪɚɡɧɢɰɟɣ 3 ɫɭɬɨɤ, ɜ ɩɨɥɶɡɭ ɛɨɥɶɲɟɣ ɞɨɡɢɪɨɜɤɢ.
ȼ ɫɪɚɜɧɟɧɢɢ ɫ ɚɧɚɥɨɝɚɦɢ ɢɡ ɤɨɧɬɪɨɥɹ, ɜ 1 ɢ ɜɨ 2 ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ ɡɚɮɢɤɫɢɪɨɜɚɧɨ ɫɨɤɪɚɳɟɧɢɟ
ɫɪɨɤɨɜ ɜɵɡɞɨɪɨɜɥɟɧɢɹ ɜ 2 ɪɚɡɚ, ɜ 1 ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɜɵɡɞɨɪɨɜɟɥɢ 100 % ɠɢɜɨɬɧɵɯ, ɜɨ 2 ɨɩɵɬɧɨɣ
ɝɪɭɩɩɟ ɜɵɡɞɨɪɨɜɟɥɨ 90 % ɠɢɜɨɬɧɵɯ, ɜ 3 ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɜɵɡɞɨɪɨɜɟɥɨ 65 %, ɨɫɬɚɥɶɧɵɦ ɠɢɜɨɬɧɵɦ, ɤɨɬɨɪɵɟ ɧɟ ɜɵɡɞɨɪɚɜɥɢɜɚɥɢ ɜ ɭɤɚɡɚɧɧɵɣ ɫɪɨɤ ɧɚɡɧɚɱɟɧɨ ɞɨɩɨɥɧɢɬɟɥɶɧɨɟ ɥɟɱɟɧɢɟ.
ȼ ɞɚɥɶɧɟɣɲɟɦ, ɞɥɹ ɜɧɟɞɪɟɧɢɹ ɥɟɱɟɧɢɹ ɫɤɪɵɬɵɯ ɢ ɫɟɪɨɡɧɵɯ ɦɚɫɬɢɬɨɜ, ɩɟɪɫɩɟɤɬɢɜɧɨɣ ɹɜɥɹɟɬɫɹ
ɞɨɡɚ 4,0 ɚɤɬɢɜɧɨɝɨ ɜɟɳɟɫɬɜɚ ɷɤɫɬɪɚɤɬɚ ɢɡ ɩɨɱɟɤ ɢ ɩɨɛɟɝɨɜ ɛɟɪɟɡɵ ɩɨɜɢɫɥɨɣ ɜ ɮɨɪɦɟ ɦɚɡɢ, ɬɚɤ ɤɚɤ
ɬɟɪɚɩɟɜɬɢɱɟɫɤɢɣ ɷɮɮɟɤɬ ɫɤɥɚɞɵɜɚɟɬɫɹ ɢɡ ɫɨɤɪɚɳɟɧɢɹ ɫɪɨɤɨɜ ɜɵɡɞɨɪɨɜɥɟɧɢɹ ɢ ɩɪɢɦɟɧɟɧɢɹ ɥɟɤɚɪɫɬɜɟɧɧɨɝɨ ɩɪɟɩɚɪɚɬɚ.
ȼ ɥɚɤɬɚɰɢɨɧɧɵɣ ɩɟɪɢɨɞ ɥɟɱɟɧɢɟ ɤɨɪɨɜ ɥɭɱɲɟ ɩɪɨɜɨɞɢɬɶ ɩɪɟɩɚɪɚɬɚɦɢ ɧɟ ɫɨɞɟɪɠɚɳɢɦɢ ɚɧɬɢɛɢɨɬɢɤɢ ɬɚɤ ɤɚɤ, ɩɪɢ ɩɪɢɦɟɧɟɧɢɢ ɬɟɬɪɚɰɢɤɥɢɧɨɜɨɣ ɦɚɡɢ ɦɨɥɨɤɨ ɧɟ ɩɪɢɝɨɞɧɨ ɛɵɥɨ ɞɥɹ ɭɩɨɬɪɟɛɥɟɧɢɹ
ɜ ɩɢɳɭ ɥɸɞɟɣ ɜ ɬɟɱɟɧɢɟ ɞɟɫɹɬɢ ɞɧɟɣ, ɱɬɨ ɡɚɜɢɫɢɬ ɨɬ ɞɟɣɫɬɜɭɸɳɟɝɨ ɜɟɳɟɫɬɜɚ ɩɪɟɩɚɪɚɬɚ [3,4].
Ⱦɚɧɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɨ ɬɨɦ, ɱɬɨ ɩɪɢɦɟɧɟɧɢɟ ɩɪɟɩɚɪɚɬɚ ɢɡ ɩɪɢɪɨɞɧɨɝɨ ɫɵɪɶɹ ɜ ɜɢɞɟ ɦɚɡɢ, ɤɨɬɨɪɚɹ ɞɥɢɬɟɥɶɧɨ ɡɚɞɟɪɠɢɜɚɹɫɶ ɜ ɬɨɥɳɟ ɤɨɠɢ ɢ ɩɪɨɧɢɤɚɹ ɜ ɩɨɞɤɨɠɧɵɟ ɫɨɫɭɞɵ,
ɭɥɭɱɲɚɟɬ ɤɪɨɜɨɫɧɚɛɠɟɧɢɟ, ɭɥɭɱɲɚɟɬ ɪɚɫɫɚɫɵɜɚɧɢɟ ɩɪɨɞɭɤɬɨɜ ɜɨɫɩɚɥɟɧɢɹ ɢ ɨɛɥɚɞɚɹ, ɬɚɤɢɦɢ ɥɟɱɟɛɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɫɩɨɫɨɛɫɬɜɭɟɬ ɛɵɫɬɪɨɦɭ ɜɨɫɫɬɚɧɚɜɥɟɧɢɸ ɮɭɧɤɰɢɢ ɦɨɥɨɱɧɨɣ ɠɟɥɟɡɵ ɤɨɪɨɜ ɜ
ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ, ɜ ɪɚɡɧɵɟ ɫɪɨɤɢ ɫ ɪɚɡɧɢɰɟɣ ɜ 3 ɞɧɹ.
ȼ ɯɨɞɟ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɥɭɱɟɧɧɵɟ ɞɚɧɧɵɟ, ɩɨɞɬɜɟɪɠɞɚɸɳɢɟ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɪɟɩɚɪɚɬɚ ɫ ɲɢɪɨɤɢɦ ɫɩɟɤɬɪɨɦ ɞɟɣɫɬɜɢɹ ɩɪɢ ɦɚɫɬɢɬɟ ɤɨɪɨɜ, ɩɨɡɜɨɥɹɬ ɭɫɤɨɪɢɬɶ ɜɵɡɞɨɪɨɜɥɟɧɢɟ ɠɢɜɨɬɧɵɯ ɫ ɧɨɪɦɚɥɢɡɚɰɢɟɣ ɤɚɱɟɫɬɜɚ ɢ ɤɨɥɢɱɟɫɬɜɚ ɭɞɨɟɜ ɢ ɨɬɫɭɬɫɬɜɢɹ ɜ ɞɚɥɶɧɟɣɲɟɦ ɨɝɪɚɧɢɱɟɧɢɣ ɩɨ ɦɨɥɨɤɭ.
266
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
ɋɬɭɞɟɧɰɨɜ, Ⱥ.ɉ., ɒɢɩɢɥɨɜ, ȼ.ə. ɢ ɞɪ. ȼɟɬɟɪɢɧɚɪɧɨɟ ɚɤɭɲɟɪɫɬɜɨ, ɝɢɧɟɤɨɥɨɝɢɹ ɢ ɛɢɨɬɟɯɧɢɤɚ ɪɚɡɦɧɨɠɟɧɢɹ ɠɢɜɨɬɧɵɯ. – Ɇɨɫɤɜɚ: Ʉɨɥɨɫ, 2005. – 212 ɫ.
ɏɪɚɦɰɨɜ, ȼ.ȼ., ɇɢɤɢɬɢɧ, ȼ.ə. Ⱥɤɭɲɟɪɫɬɜɨ ɢ ɝɢɧɟɤɨɥɨɝɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ. – Ɇɨɫɤɜɚ:
Ʉɨɥɨɫ, 2007. – 200 ɫ.
Ȼɭɥɚɧɤɢɧ, Ⱥ.Ʌ. Ɋɚɡɪɚɛɨɬɤɚ ɢ ɩɪɢɦɟɧɟɧɢɟ ɧɨɜɵɯ ɥɟɱɟɛɧɵɯ ɩɪɟɩɚɪɚɬɨɜ ɩɪɢ ɷɧɞɨɦɟɬɪɢɬɚɯ, ɦɚɫɬɢɬɚɯ ɤɨɪɨɜ: ɚɜɬɨɪɟɮ. ɞɢɫ. ɞ-ɪɚ ɜɟɬ. ɧɚɭɤ. – Ʉɪɚɫɧɨɞɚɪ, 1996. – 47 ɫ.
ɇɢɤɨɧɨɪɨɜ, ɉ.ɇ. ɉɪɨɛɥɟɦɵ ɛɟɫɩɥɨɞɢɹ ɢ ɦɚɫɬɢɬɨɜ ɠɢɜɨɬɧɵɯ. – ɇɨɜɨɫɢɛɢɪɫɤ: ɂɗȼɋɢȾȼ, 1999. –
320 ɫ.
ɍȾɄ: 636.294.002.6:579
ȻȺɄɌȿɊɂȺɅɖɇȺə ɈȻɋȿɆȿɇȿɇɇɈɋɌɖ
ȼɌɈɊɈɋɌȿɉȿɇɇɈɃ ɉɊɈȾɍɄɐɂɂ ɉȺɇɌɈȼɈȽɈ
ɈɅȿɇȿȼɈȾɋɌȼȺ ȼ ɉɊɈɐȿɋɋȿ ɉȿɊȿɊȺȻɈɌɄɂ
ɉɈɅɘɏ Ⱥ.ȼ.,
ȼɫɟɪɨɫɫɢɣɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ,
ɝ. Ȼɚɪɧɚɭɥ, Ɋɨɫɫɢɹ, e-mail: wniipo@rambler.ru
Ɉɬ ɦɚɪɚɥɨɜ ɢ ɩɹɬɧɢɫɬɵɯ ɨɥɟɧɟɣ ɩɨɥɭɱɚɸɬ ɬɪɢ ɜɢɞɚ ɩɪɨɞɭɤɰɢɢ: ɩɚɧɬɨɜɭɸ, ɦɹɫɧɭɸ ɢ ɜɬɨɪɨɫɬɟɩɟɧɧɭɸ ɩɪɨɞɭɤɰɢɸ. Ɉɫɧɨɜɧɚɹ ɩɪɨɞɭɤɰɢɹ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ – ɩɚɧɬɵ [1]. Ⱦɨ 90-ɯ ɝɨɞɨɜ ɩɪɨɲɥɨɝɨ ɜɟɤɚ ɜ Ɋɨɫɫɢɢ ɢɡ ɩɚɧɬɨɜ ɝɨɬɨɜɢɥɢ ɥɢɲɶ ɩɚɧɬɨɤɪɢɧ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɪɟɞɥɨɠɟɧɨ 140 ɪɚɡɥɢɱɧɵɯ ɜɢɞɨɜ ɩɪɟɩɚɪɚɬɨɜ, ɫɪɟɞɫɬɜ, ɞɨɛɚɜɨɤ, ɜ ɫɨɫɬɚɜ ɤɨɬɨɪɵɯ ɜ ɨɫɧɨɜɧɨɦ ɜɯɨɞɹɬ ɤɪɨɜɶ ɢ ɩɚɧɬɵ.
ɇɚɪɹɞɭ ɫ ɩɚɧɬɚɦɢ, ɦɹɫɨɦ, ɤɪɨɜɶɸ ɨɬ ɦɚɪɚɥɨɜ ɦɨɠɧɨ ɡɚɝɨɬɚɜɥɢɜɚɬɶ ɫɭɯɨɠɢɥɢɹ, ɯɜɨɫɬɵ, ɩɨɥɨɜɵɟ
ɨɪɝɚɧɵ ɫɚɦɰɨɜ ɢ ɩɥɨɞɵ ɦɚɬɨɤ ɫ ɩɨɫɥɟɞɭɸɳɟɣ ɩɟɪɟɪɚɛɨɬɤɨɣ ɜ ɛɢɨɫɭɛɫɬɚɧɰɢɢ. ȼɨ ȼɇɂɂ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ ɨɬɪɚɛɨɬɚɧɵ ɦɟɬɨɞɢɤɢ ɢɯ ɡɚɝɨɬɨɜɤɢ ɢ ɩɟɪɟɪɚɛɨɬɤɢ ɜ ɛɢɨɫɭɛɫɬɚɧɰɢɢ, ɢɡɭɱɟɧ ɛɢɨɯɢɦɢɱɟɫɤɢɣ ɫɨɫɬɚɜ ɢ ɛɢɨɥɨɝɢɱɟɫɤɚɹ ɚɤɬɢɜɧɨɫɬɶ, ɩɨɞɬɜɟɪɠɞɟɧɧɚɹ ɬɨɧɢɡɢɪɭɸɳɢɦ, ɝɢɩɨɬɟɧɡɢɜɧɵɦ
ɢ ɝɨɧɚɞɨɬɪɨɩɧɵɦ ɞɟɣɫɬɜɢɟɦ [2].
ɉɢɳɟɜɵɟ ɩɪɨɞɭɤɬɵ ɞɨɥɠɧɵ ɭɞɨɜɥɟɬɜɨɪɹɬɶ ɮɢɡɢɨɥɨɝɢɱɟɫɤɢɟ ɩɨɬɪɟɛɧɨɫɬɢ ɱɟɥɨɜɟɤɚ ɜ ɧɟɨɛɯɨɞɢɦɵɯ ɜɟɳɟɫɬɜɚɯ ɢ ɷɧɟɪɝɢɢ, ɨɬɜɟɱɚɬɶ ɨɛɵɱɧɨ ɩɪɟɞɴɹɜɥɟɧɧɵɦ ɤ ɩɢɳɟɜɵɦ ɩɪɨɞɭɤɬɚɦ ɬɪɟɛɨɜɚɧɢɹɦ
ɜ ɱɚɫɬɢ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɯ ɢ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɢ ɫɨɨɬɜɟɬɫɬɜɨɜɚɬɶ ɭɫɬɚɧɨɜɥɟɧɧɵɦ
ɧɨɪɦɚɬɢɜɧɵɦɢ ɞɨɤɭɦɟɧɬɚɦɢ ɬɪɟɛɨɜɚɧɢɹɦ ɤ ɞɨɩɭɫɬɢɦɨɦɭ ɫɨɞɟɪɠɚɧɢɸ ɯɢɦɢɱɟɫɤɢɯ, ɪɚɞɢɨɚɤɬɢɜɧɵɯ, ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ ɢ ɢɯ ɫɨɟɞɢɧɟɧɢɣ, ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ ɢ ɞɪɭɝɢɯ ɛɢɨɥɨɝɢɱɟɫɤɢɯ ɨɪɝɚɧɢɡɦɨɜ, ɩɪɟɞɫɬɚɜɥɹɸɳɢɯ ɨɩɚɫɧɨɫɬɶ ɞɥɹ ɡɞɨɪɨɜɶɹ ɧɵɧɟɲɧɢɯ ɢ ɛɭɞɭɳɢɯ ɩɨɤɨɥɟɧɢɣ [3].
ɉɨɫɤɨɥɶɤɭ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɟ ɫɭɛɫɬɚɧɰɢɢ ɩɨ ɪɚɡɪɚɛɨɬɚɧɧɨɣ ɬɟɯɧɨɥɨɝɢɢ ɜ ɛɭɞɭɳɟɦ ɩɪɟɞɩɨɥɚɝɚɟɬɫɹ ɩɪɢɦɟɧɹɬɶ ɜ ɩɢɳɟɜɨɣ, ɤɨɫɦɟɬɢɱɟɫɤɨɣ, ɮɚɪɦɚɰɟɜɬɢɱɟɫɤɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ ɢ ɩɪɨɮɟɫɫɢɨɧɚɥɶɧɨɣ ɦɟɞɢɰɢɧɟ, ɜɚɠɧɵɦ ɩɨɤɚɡɚɬɟɥɟɦ ɞɥɹ ɧɢɯ ɹɜɥɹɟɬɫɹ ɛɚɤɬɟɪɢɚɥɶɧɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ.
Ɇɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɨɛɫɟɦɟɧɟɧɧɨɫɬɢ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ
ɢɦɟɸɬ ɫɬɪɨɝɨ ɪɟɝɥɚɦɟɧɬɢɪɨɜɚɧɧɵɟ ɩɨɤɚɡɚɬɟɥɢ (Ɇɟɞɢɤɨ–ɛɢɨɥɨɝɢɱɟɫɤɢɟ ɬɪɟɛɨɜɚɧɢɹ…, 1990), ɚ
ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɧɟɬɪɚɞɢɰɢɨɧɧɨɝɨ ɠɢɜɨɬɧɨɝɨ ɫɵɪɶɹ ɩɪɟɞɩɨɥɚɝɚɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɢɡɭɱɟɧɢɹ ɜɨɡɦɨɠɧɵɯ ɩɭɬɟɣ ɢ ɦɟɯɚɧɢɡɦɨɜ ɟɝɨ ɦɢɤɪɨɛɧɨɣ ɨɛɫɟɦɟɧɟɧɧɨɫɬɢ [4].
Ɋɚɛɨɬɚ ɩɪɨɜɨɞɢɥɚɫɶ ɧɚ ɛɚɡɟ ɥɚɛɨɪɚɬɨɪɢɢ ɡɚɪɚɡɧɵɯ ɛɨɥɟɡɧɟɣ ɠɢɜɨɬɧɵɯ ɎȽȻɇɍ ȼɇɂɂ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ ɢ ɦɚɪɚɥɨɜɨɞɱɟɫɤɢɯ ɯɨɡɹɣɫɬɜɚɯ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ ɜ 2014 ɝɨɞɭ. ɂɫɫɥɟɞɨɜɚɧɢɸ
ɩɨɞɜɟɪɝɚɥɨɫɶ ɫɵɪɶɺ (ɯɜɨɫɬɵ, ɫɭɯɨɠɢɥɢɹ, ɪɟɩɪɨɞɭɤɬɢɜɧɵɟ ɨɪɝɚɧɵ ɦɚɪɚɥɨɜ, ɷɦɛɪɢɨɧɵ), ɤɨɧɟɱɧɵɣ
ɩɪɨɞɭɤɬ ɢ ɩɪɨɛɵ, ɨɬɨɛɪɚɧɧɵɟ ɧɚ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɷɬɚɩɚɯ ɩɪɨɢɡɜɨɞɫɬɜɚ. Ɇɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɜɨɞɢɥ ɩɨ ɨɛɳɟɩɪɢɧɹɬɵɦ ɦɟɬɨɞɢɤɚɦ. ɉɨɥɭɱɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɢ ɢɯ ɚɧɚɥɢɡ ɩɪɢɜɟɞɟɧɵ ɧɢɠɟ.
ɋɭɯɨɠɢɥɢɹ. ȼ ɢɫɯɨɞɧɨɦ ɦɚɬɟɪɢɚɥɟ ɄɈȿ ɫɨɫɬɚɜɥɹɟɬ 8,0*108 ɩɨ ɫɚɩɪɨɮɢɬɧɨɣ ɦɢɤɪɨɮɥɨɪɟ ɢ
6,0*107 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ɉɨɫɥɟ ɷɤɫɬɪɚɤɰɢɢ ɭɥɶɬɪɚɡɜɭɤɨɦ ɫ ɤɨɦɩɥɟɤɫɨɦ ɮɟɪɦɟɧɬɨɜ ɋȽ-50 ɜ
ɫɪɟɞɧɟɦ 1,4*102 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ, ɪɨɫɬɚ ɫɚɩɪɨɮɢɬɧɨɣ ɦɢɤɪɨɮɥɨɪɵ ɧɟ ɧɚɛɥɸɞɚɟɬɫɹ. ɄɈȿ ɩɪɢ
ɩɨɫɥɟɞɭɸɳɟɣ ɷɤɫɬɪɚɤɰɢɢ ɩɚɩɚɢɧɨɦ ɩɪɢ t° 40°ɋ ɫɨɫɬɚɜɢɥɨ 3,2*103 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ȼ ɝɨɬɨɜɨɦ
ɤɨɧɰɟɧɬɪɚɬɟ ɄɈȿ 1,2*104 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ.
Ɋɟɩɪɨɞɭɤɬɢɜɧɵɟ ɨɪɝɚɧɵ ɦɚɪɚɥɨɜ. ȼ ɢɫɯɨɞɧɨɦ ɦɚɬɟɪɢɚɥɟ ɄɈȿ ɫɨɫɬɚɜɥɹɟɬ 7,5*108 ɩɨ ɫɚɩɪɨɮɢɬɧɨɣ ɦɢɤɪɨɮɥɨɪɟ ɢ 5,0*107 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ɉɨɫɥɟ ɷɤɫɬɪɚɤɰɢɢ ɭɥɶɬɪɚɡɜɭɤɨɦ ɫ ɤɨɦɩɥɟɤɫɨɦ
ɮɟɪɦɟɧɬɨɜ ɋȽ-50 ɄɈȿ ɜ ɫɪɟɞɧɟɦ 0,9*104 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ɉɪɢ ɩɨɫɥɟɞɭɸɳɟɣ ɷɤɫɬɪɚɤɰɢɢ ɩɚ267
ɩɚɢɧɨɦ ɩɪɢ t° 40°ɋ 2,9*104. ȼ ɝɨɬɨɜɨɦ ɤɨɧɰɟɧɬɪɚɬɟ ɄɈȿ ɫɨɫɬɚɜɥɹɟɬ 5,0*103 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ,
ɩɨɹɜɥɹɸɬɫɹ ɞɪɨɠɠɢ 5,0*103.
ɏɜɨɫɬɵ. ȼ ɢɫɯɨɞɧɨɦ ɦɚɬɟɪɢɚɥɟ ɄɈȿ ɫɨɫɬɚɜɥɹɟɬ 5,5*107 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ 8,0*107ɩɨ ɫɚɩɪɨɮɢɬɧɨɣ ɦɢɤɪɨɮɥɨɪɟ. ɉɨɫɥɟ ɷɤɫɬɪɚɤɰɢɢ ɭɥɶɬɪɚɡɜɭɤɨɦ ɫ ɤɨɦɩɥɟɤɫɨɦ ɮɟɪɦɟɧɬɨɜ ɋȽ-50 ɄɈȿ 0,8*101
ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ɉɪɢ ɩɨɫɥɟɞɭɸɳɟɣ ɷɤɫɬɪɚɤɰɢɢ ɩɚɩɚɢɧɨɦ ɩɪɢ t° 40°ɋ 3,1*104 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ȼ ɝɨɬɨɜɨɦ ɤɨɧɰɟɧɬɪɚɬɟ ɄɈȿ 4,9*103 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ, ɩɪɢɫɭɬɫɬɜɭɸɬ ɞɪɨɠɠɢ 5,2*103 ɢ
ɫɚɩɪɨɮɢɬɧɚɹ ɦɢɤɪɨɮɥɨɪɚ 1,0*104.
ɗɦɛɪɢɨɧɵ. ȼ ɢɫɯɨɞɧɨɦ ɦɚɬɟɪɢɚɥɟ ɄɈȿ ɫɨɫɬɚɜɥɹɟɬ 5,1*107 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ ɢ 6,1*107 ɩɨ
ɫɚɩɪɨɮɢɬɧɨɣ ɦɢɤɪɨɮɥɨɪɟ. ɉɨɫɥɟ ɷɤɫɬɪɚɤɰɢɢ ɭɥɶɬɪɚɡɜɭɤɨɦ ɫ ɤɨɦɩɥɟɤɫɨɦ ɮɟɪɦɟɧɬɨɜ ɋȽ-50 ɄɈȿ
ɫɧɢɠɚɟɬɫɹ ɞɨ 0,6*101 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ. ɉɪɢ ɩɨɫɥɟɞɭɸɳɟɣ ɷɤɫɬɪɚɤɰɢɢ ɩɚɩɚɢɧɨɦ ɩɪɢ t° 40°ɋ
ɄɈȿ ɫɨɫɬɚɜɥɹɟɬ 2,9*103. ȼ ɝɨɬɨɜɨɦ ɤɨɧɰɟɧɬɪɚɬɟ ɄɈȿ 5,4*103 ɩɨ ɞɪɨɠɠɚɦ, 1,0*104 ɩɨ ɫɚɩɪɨɮɢɬɧɨɣ
ɦɢɤɪɨɮɥɨɪɟ ɢ 5,0*104 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ.
ɉɨ ɦɚɬɟɪɢɚɥɚɦ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɜɬɨɪɨɫɬɟɩɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɫɭɯɨɠɢɥɢɹ, ɩɟɧɢɫɵ,
ɯɜɨɫɬɵ, ɷɦɛɪɢɨɧɵ) ɦɨɠɧɨ ɫɞɟɥɚɬɶ ɜɵɜɨɞ, ɱɬɨ ɜ ɩɪɨɰɟɫɫɟ ɨɛɪɚɛɨɬɤɢ ɫɵɪɶɹ ɞɨ ɝɨɬɨɜɨɣ ɩɪɨɞɭɤɰɢɢ
ɩɪɨɢɫɯɨɞɢɬ ɧɟɡɧɚɱɢɬɟɥɶɧɨɟ ɫɧɢɠɟɧɢɟ ɦɢɤɪɨɛɧɨɣ ɨɛɫɟɦɟɧɟɧɧɨɫɬɢ. ɂɫɤɥɸɱɟɧɢɟɦ ɹɜɥɹɟɬɫɹ ɜɬɨɪɨɣ
ɷɬɚɩ ɩɟɪɟɪɚɛɨɬɤɢ (ɷɤɫɬɪɚɤɰɢɹ ɭɥɶɬɪɚɡɜɭɤɨɦ ɫ ɤɨɦɩɥɟɤɫɨɦ ɮɟɪɦɟɧɬɨɜ ɋȽ-50), ɝɞɟ ɄɈȿ ɫɧɢɠɚɟɬɫɹ
ɜ ɫɪɟɞɧɟɦ ɜ 7,4 ɪɚɡɚ ɩɨ ɫɚɩɪɨɮɢɬɧɨɣ ɦɢɤɪɨɮɥɨɪɟ ɢ 6,3 ɩɨ ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɢɫɯɨɞɧɵɦ ɦɚɬɟɪɢɚɥɨɦ. Ɂɚɬɟɦ ɩɪɨɢɫɯɨɞɢɬ ɫɤɚɱɨɤ ɩɪɢ ɷɤɫɬɪɚɤɰɢɢ ɩɚɩɚɢɧɨɦ. Ɍɚɤ ɠɟ ɞɨɫɬɚɬɨɱɧɨ ɜɵɫɨɤɚɹ
ɤɨɧɬɚɦɢɧɚɰɢɹ ɫɚɩɪɨɮɢɬɚɦɢ, ɷɧɬɟɪɨɛɚɤɬɟɪɢɹɦɢ ɢ ɞɪɨɠɠɚɦɢ ɫɨɯɪɚɧɹɟɬɫɹ ɜ ɝɨɬɨɜɨɦ ɤɨɧɰɟɧɬɪɚɬɟ.
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɨɬɪɚɛɚɬɵɜɚɟɬɫɹ ɬɟɯɧɨɥɨɝɢɹ ɩɨɥɭɱɟɧɢɹ ɩɪɨɞɭɤɰɢɢ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɛɚɤɬɟɪɢɨɫɬɚɬɢɱɟɫɤɢɯ ɢ ɛɚɤɬɟɪɢɰɢɞɧɵɯ ɮɟɪɦɟɧɬɨɜ ɫɩɨɫɨɛɫɬɜɭɸɳɢɯ ɫɧɢɠɟɧɢɸ ɄɈȿ ɞɨ ɞɨɩɭɫɬɢɦɵɯ
ɡɧɚɱɟɧɢɣ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
Ʌɭɧɢɰɵɧ ȼ.Ƚ., Ȼɨɪɢɫɨɜ ɇ.ɉ. ɉɚɧɬɨɜɨɟ ɨɥɟɧɟɜɨɞɫɬɜɨ Ɋɨɫɫɢɢ: ɢɡɞɚɧɢɟ 2-ɟ, ɞɨɩɨɥɧɟɧɧɨɟ /ȼ.Ƚ. Ʌɭɧɢɰɵɧ,
ɇ.ɉ. Ȼɨɪɢɫɨɜ, ɊȺɋɏɇ ȼɇɂɂɉɈ. – Ȼɚɪɧɚɭɥ, 2012.
Ʌɭɧɢɰɵɧ ȼ.Ƚ., Ɏɪɨɥɨɜ ɇ.Ⱥ. ɉɪɨɞɭɤɰɢɹ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ (ɫɩɨɫɨɛɵ ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɹ, ɩɟɪɟɪɚɛɨɬɤɚ, ɢɫɩɨɥɶɡɨɜɚɧɢɟ): ɦɨɧɨɝɪɚɮɢɹ /ɊȺɋɏɇ ɋɢɛ. ɨɬɞ-ɧɢɟ ȼɇɂɂɉɈ. Ȼɚɪɧɚɭɥ. – 2006.
ɋɚɧɉɢɧ 2.3.21078-01 Ƚɢɝɢɟɧɢɱɟɫɤɢɟ ɬɪɟɛɨɜɚɧɢɹ ɛɟɡɨɩɚɫɧɨɫɬɢ ɢ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ. – Ɇ., 2002.
Ɍɭɪɤɭɬɸɤɨɜ ȼ.Ȼ. Ɇɟɞɢɤɨ-ɛɢɨɥɨɝɢɱɟɫɤɨɟ ɨɛɨɫɧɨɜɚɧɢɟ ɩɨɥɭɱɟɧɢɹ ɢ ɩɢɳɟɜɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɪɨɞɭɤɬɨɜ
ɢɡ ɧɟɬɪɚɞɢɰɢɨɧɧɨɝɨ ɫɵɪɶɹ ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ. [Ɍɟɤɫɬ]: ɚɜɬɨɪɟɮ. ɞɢɫ. ɧɚ ɫɨɢɫɤ. ɭɱɟɧ. ɫɬɟɩ. ɞ-ɪɚ
ɦɟɞ. ɧɚɭɤ (14.00.07) /Ɍɭɪɤɭɬɸɤɨɜ ȼɹɱɟɫɥɚɜ Ȼɨɪɢɫɨɜɢɱ; ȼɥɚɞɢɜɨɫɬɨɤɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɦɟɞɢɰɢɧɫɤɢɣ ɭɧɢɜɟɪɫɢɬɟɬ. – ɋɚɧɤɬ-ɉɟɬɟɪɛɭɪɝ, 1997.
1.
2.
3.
4.
ɍȾɄ 631.153: 658.012
ɋɂɋɌȿɆɇɕɃ ȺɇȺɅɂɁ ɄȺɄ ɂɇɋɌɊɍɆȿɇɌ ɍɉɊȺȼɅȿɇɂə
ɉɊɈȾɍɄɌɂȼɇɈɋɌɖɘ ȼ ɆɈɅɈɑɇɈɆ ɋɄɈɌɈȼɈȾɋɌȼȿ
ɉȿɌɅəɄɈȼɋɄɂɃ ȼ.Ⱥ.,
ɎȽȻɍ «ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ», ɝ. ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɣɫɤɚɹ Ɏɟɞɟɪɚɰɢɹ,
e-mail: v3481809@yandex.ru
ȼ ɫɨɜɪɟɦɟɧɧɵɯ ɭɫɥɨɜɢɹɯ ɩɪɨɢɡɜɨɞɫɬɜɨ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɨɩɪɟɞɟɥɹɟɬɫɹ ɤɚɤ ɦɢɧɢɦɭɦ ɞɜɭɦɹ ɩɨɤɚɡɚɬɟɥɹɦɢ: ɷɮɮɟɤɬɢɜɧɨɫɬɶɸ – ɫɬɟɩɟɧɶɸ ɜɵɩɨɥɧɟɧɢɹ ɮɭɧɤɰɢɨɧɚɥɶɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ ɢ
ɩɪɢɛɵɥɶɸ, ɹɜɥɹɸɳɟɣɫɹ ɨɫɧɨɜɨɣ ɜɟɞɟɧɢɹ ɪɚɫɲɢɪɟɧɧɨɝɨ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ. Ɉɫɨɛɟɧɧɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ
ɩɪɢɛɵɥɢ ɜ ɤɚɱɟɫɬɜɟ ɤɪɢɬɟɪɢɹ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɨɛɭɫɥɨɜɥɟɧɨ ɜɨɡɦɨɠɧɨɫɬɶɸ ɭɱɟɬɚ ɷɮɮɟɤɬɚ, ɩɨɥɭɱɚɟɦɨɝɨ ɩɪɢ ɩɪɢɦɟɧɟɧɢɢ ɬɟɯɧɨɥɨɝɢɣ, ɢɦɟɸɳɢɯ ɪɚɡɧɵɣ ɭɪɨɜɟɧɶ ɢɧɬɟɧɫɢɜɧɨɫɬɢ, ɨɩɪɟɞɟɥɹɟɦɵɟ ɫɥɨɠɢɜɲɢɦɢɫɹ ɩɪɢɪɨɞɧɨ-ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɦɢ ɭɫɥɨɜɢɹɦɢ. ɂɡɜɟɫɬɧɨ, ɱɬɨ ɜ ɫɬɪɭɤɬɭɪɟ ɡɚɬɪɚɬ ɩɪɨɢɡɜɨɞɫɬɜɚ
ɩɪɨɞɭɤɰɢɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ 60–75 % ɫɨɫɬɚɜɥɹɸɬ ɤɨɪɦɚ, ɚ ɢɯ ɄɉȾ ɜ ɥɭɱɲɟɦ ɫɥɭɱɚɟ ɧɟ ɩɪɟɜɵɲɚɟɬ
35 %. Ɉɬɫɸɞɚ ɜɨɡɧɢɤɚɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɢɡɭɱɟɧɢɹ ɛɢɨɷɧɟɪɝɟɬɢɱɟɫɤɢɯ ɯɚɪɚɤɬɟɪɢɫɬɢɤ ɨɪɝɚɧɢɡɦɨɜ
ɠɢɜɨɬɧɵɯ (ɛɢɨɤɨɧɜɟɪɫɢɹ) ɞɥɹ ɜɵɹɜɥɟɧɢɹ ɫɩɨɫɨɛɨɜ ɢ ɫɪɟɞɫɬɜ ɩɨɜɵɲɟɧɢɹ ɢɯ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ, ɚ ɬɚɤɠɟ ɤɨɪɦɨɩɪɨɢɡɜɨɞɫɬɜɚ, ɤɚɤ ɢɫɬɨɱɧɢɤɚ ɩɢɬɚɬɟɥɶɧɨɣ ɰɟɧɧɨɫɬɢ ɤɨɪɦɨɜ (ɷɧɟɪɝɨɫɨɞɟɪɠɚɧɢɟ). ɉɨɷɬɨɦɭ
ɫɬɪɚɬɟɝɢɹ ɢɧɬɟɧɫɢɮɢɤɚɰɢɢ ɩɪɨɰɟɫɫɨɜ ɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɟ ɢ ɤɨɪɦɨɩɪɨɢɡɜɨɞɫɬɜɟ ɬɪɟɛɭɟɬ, ɫ ɨɞɧɨɣ ɫɬɨɪɨɧɵ, ɛɨɥɟɟ ɞɢɮɮɟɪɟɧɰɢɪɨɜɚɧɧɨɝɨ ɩɪɢɦɟɧɟɧɢɹ ɬɟɯɧɨɝɟɧɧɵɯ ɮɚɤɬɨɪɨɜ (ɷɮɮɟɤɬɢɜɧɵɯ ɬɟɯɧɨɥɨɝɢɣ
ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɨɪɦɨɜ ɞɥɹ ɫɨɡɞɚɧɢɹ ɩɨɥɧɨɰɟɧɧɵɯ ɪɚɰɢɨɧɨɜ, ɫɨɞɟɪɠɚɧɢɹ ɠɢɜɨɬɧɵɯ ɢ ɞɪ.), ɫ ɞɪɭɝɨɣ –
268
ɢɧɬɟɝɪɚɰɢɸ ɜ ɟɞɢɧɭɸ ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɭɸ ɛɚɡɭ ɫɨɜɨɤɭɩɧɨɫɬɢ ɫɢɫɬɟɦɧɵɯ ɡɧɚɧɢɣ, ɩɨɥɭɱɟɧɧɵɯ ɧɚ ɨɫɧɨɜɟ ɫɢɫɬɟɦɧɨɝɨ ɚɧɚɥɢɡɚ ɜ ɫɦɟɠɧɵɯ ɞɢɫɰɢɩɥɢɧɚɯ ɫɨɜɪɟɦɟɧɧɨɣ ɧɚɭɤɢ.
Ɋɚɫɫɦɚɬɪɢɜɚɹ ɩɪɨɰɟɫɫ ɩɨɥɭɱɟɧɢɹ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ ɤɚɤ ɫɥɨɠɧɭɸ ɫɢɫɬɟɦɭ, ɫɥɟɞɭɟɬ
ɭɱɟɫɬɶ ɟɟ ɢɟɪɚɪɯɢɱɧɨɟ ɫɬɪɨɟɧɢɟ. Ɂɚɤɨɧɨɦɟɪɧɨɫɬɢ ɢɟɪɚɪɯɢɱɟɫɤɨɣ ɭɩɨɪɹɞɨɱɟɧɧɨɫɬɢ ɬɟɫɧɨ ɫɜɹɡɚɧɵ ɫ ɩɨɧɹɬɢɟɦ ɰɟɥɨɫɬɧɨɫɬɢ ɢ ɥɨɝɢɱɟɫɤɢɦ ɪɚɫɱɥɟɧɟɧɢɟɦ ɢɫɫɥɟɞɭɟɦɨɣ ɫɢɫɬɟɦɵ ɧɚ ɭɪɨɜɧɢ. ȼ ɛɢɨɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɣ ɫɢɫɬɟɦɟ ɩɪɨɞɭɤɰɢɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ (ɜɵɪɚɳɢɜɚɧɢɹ ɄɊɋ ɢɥɢ
ɩɨɥɭɱɟɧɢɹ ɤɚɤɨɣ-ɥɢɛɨ ɩɪɨɞɭɤɰɢɢ) ɭɪɨɜɧɹɦɢ ɢɟɪɚɪɯɢɢ ɹɜɥɹɸɬɫɹ: ɠɢɜɨɬɧɵɟ, ɤɨɪɦɚ, ɬɟɯɧɨɥɨɝɢɢ,
ɪɟɫɭɪɫɵ, ɬɟɯɧɢɤɚ.
ɋ ɩɨɡɢɰɢɢ ɫɢɫɬɟɦɧɨɝɨ ɩɨɞɯɨɞɚ ɜ ɭɪɨɜɧɹɯ ɢɟɪɚɪɯɢɢ ɧɟɨɛɯɨɞɢɦɨ ɭɞɟɥɹɬɶ ɨɫɨɛɨɟ ɜɧɢɦɚɧɢɟ ɬɚɤɨɣ
ɡɚɤɨɧɨɦɟɪɧɨɫɬɢ ɤɚɤ ɤɨɦɦɭɧɢɤɚɬɢɜɧɨɫɬɶ, ɭɱɢɬɵɜɚɸɳɟɣ ɜɟɪɬɢɤɚɥɶɧɵɟ ɫɜɹɡɢ ɧɚɞɫɢɫɬɟɦɵ ɫ ɧɢɠɟɥɟɠɚɳɢɦɢ ɭɪɨɜɧɹɦɢ ɢ ɝɨɪɢɡɨɧɬɚɥɶɧɵɦɢ ɫɜɹɡɹɦɢ ɨɞɧɨɭɪɨɜɧɟɜɵɯ ɷɥɟɦɟɧɬɨɜ ɢɫɫɥɟɞɭɟɦɨɣ ɫɢɫɬɟɦɵ.
Ɉɫɧɨɜɧɚɹ ɥɢɧɢɹ ɦɟɬɨɞɨɥɨɝɢɢ ɫɢɫɬɟɦɧɨɝɨ ɚɧɚɥɢɡɚ – ɷɬɨ ɩɪɨɜɟɞɟɧɢɟ ɨɩɟɪɚɰɢɣ ɤɨɥɢɱɟɫɬɜɟɧɧɨɝɨ ɫɪɚɜɧɟɧɢɹ ɚɥɶɬɟɪɧɚɬɢɜ ɫ ɰɟɥɶɸ ɜɵɛɨɪɚ ɢɯ ɪɟɚɥɢɡɚɰɢɢ ɜ ɤɨɧɤɪɟɬɧɵɯ ɭɫɥɨɜɢɹɯ. ɉɪɨɜɨɞɢɦɵɟ
ɨɰɟɧɤɢ ɞɨɥɠɧɵ ɤɨɥɢɱɟɫɬɜɟɧɧɨ ɯɚɪɚɤɬɟɪɢɡɨɜɚɬɶ ɪɚɡɧɨɤɚɱɟɫɬɜɟɧɧɵɟ ɚɥɶɬɟɪɧɚɬɢɜɵ ɩɨ ɜɟɥɢɱɢɧɚɦ
ɜɵɯɨɞɚ, ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɢ ɡɚɬɪɚɬ ɧɚ ɩɨɥɭɱɟɧɢɟ ɞɚɧɧɨɝɨ ɪɟɡɭɥɶɬɚɬɚ. Ʉɪɢɬɟɪɢɟɦ ɨɬɧɟɫɟɧɢɹ ɬɨɝɨ ɢɥɢ
ɢɧɨɝɨ ɷɥɟɦɟɧɬɚ ɜ ɞɚɧɧɭɸ ɫɢɫɬɟɦɭ ɹɜɥɹɟɬɫɹ ɟɝɨ ɭɱɚɫɬɢɟ ɜ ɩɪɨɰɟɫɫɟ, ɨɛɭɫɥɚɜɥɢɜɚɸɳɢɦ ɜɵɯɨɞɧɨɣ
ɪɟɡɭɥɶɬɚɬ ɞɚɧɧɨɣ ɚɥɶɬɟɪɧɚɬɢɜɵ.
ɉɨɞ ɫɢɫɬɟɦɧɵɦ ɩɪɢɤɥɚɞɧɵɦ ɚɧɚɥɢɡɨɦ ɨɛɵɱɧɨ ɩɨɧɢɦɚɸɬ ɜɫɟɫɬɨɪɨɧɧɢɣ ɭɱɟɬ ɜɫɟɯ ɨɛɫɬɨɹɬɟɥɶɫɬɜ
ɢ ɜɡɚɢɦɨɫɜɹɡɟɣ. Ɉɞɧɚɤɨ ɜɨ ɦɧɨɝɢɯ ɫɥɭɱɚɹɯ ɜ ɧɚɱɚɥɶɧɵɣ ɩɟɪɢɨɞ ɪɚɡɪɚɛɨɬɤɢ ɫɢɫɬɟɦɧɨɝɨ ɪɟɲɟɧɢɹ
ɧɟɞɨɫɬɚɬɨɱɧɨ ɢɡɭɱɟɧɧɨɣ ɡɚɞɚɱɢ, ɧɟ ɜɫɟɝɞɚ ɦɨɠɧɨ ɩɪɢɞɟɪɠɢɜɚɬɶɫɹ ɷɬɨɝɨ ɩɨɥɨɠɟɧɢɹ. Ⱦɥɹ ɷɬɨɝɨ ɧɚ
ɩɟɪɜɨɦ ɷɬɚɩɟ ɰɟɥɟɫɨɨɛɪɚɡɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɩɪɨɫɬɭɸ ɥɨɝɢɱɟɫɤɭɸ ɫɯɟɦɭ (ɦɨɞɟɥɶ), ɭɱɢɬɵɜɚɸɳɭɸ
ɥɢɲɶ ɝɥɚɜɧɵɟ, ɧɚɢɛɨɥɟɟ ɜɚɠɧɵɟ ɩɪɨɰɟɫɫɵ, ɫɜɨɣɫɬɜɚ, ɫɜɹɡɢ.
ɉɨ ɦɟɪɟ ɞɚɥɶɧɟɣɲɟɝɨ ɪɚɡɜɢɬɢɹ ɫɢɫɬɟɦɧɨɝɨ ɪɟɲɟɧɢɹ ɩɟɪɜɨɧɚɱɚɥɶɧɚɹ ɦɨɞɟɥɶ ɫɬɚɧɟɬ ɫɜɨɟɨɛɪɚɡɧɵɦ ɫɤɟɥɟɬɨɦ ɛɨɥɟɟ ɩɨɥɧɨɣ ɫɢɫɬɟɦɵ, ɜ ɡɧɚɱɢɬɟɥɶɧɨ ɛɨɥɶɲɟɣ ɦɟɪɟ ɫɨɨɬɜɟɬɫɬɜɭɸɳɟɣ ɜɫɟɣ ɫɥɨɠɧɨɫɬɢ ɩɪɟɞɫɬɚɜɥɟɧɢɣ ɨɛ ɢɡɭɱɚɟɦɨɦ ɨɛɴɟɤɬɟ. ɋ ɭɬɨɱɧɟɧɢɟɦ ɢ ɜɵɹɜɥɟɧɢɟɦ ɧɨɜɵɯ ɡɚɤɨɧɨɦɟɪɧɨɫɬɟɣ, ɫɜɹɡɟɣ, ɫɜɨɣɫɬɜ ɫɢɫɬɟɦɚ ɭɫɥɨɠɧɹɟɬɫɹ ɢ ɩɪɢɨɛɪɟɬɚɟɬ ɜɫɟ ɛɨɥɟɟ ɨɪɝɚɧɢɡɨɜɚɧɧɵɣ ɜɢɞ ɢ ɛɭɞɟɬ
ɫɨɨɬɜɟɬɫɬɜɨɜɚɬɶ ɢɡɭɱɚɟɦɨɦɭ ɨɛɴɟɤɬɭ. ɉɪɢ ɷɬɨɦ ɫɬɚɧɨɜɢɬɫɹ ɜɨɡɦɨɠɧɵɦ ɭɫɬɚɧɚɜɥɢɜɚɬɶ ɢɡɦɟɧɟɧɢɹ,
ɤɚɤɢɟ ɞɨɥɠɧɵ ɩɪɨɢɡɨɣɬɢ ɫ ɢɡɭɱɚɟɦɵɦ ɨɛɴɟɤɬɨɦ ɜ ɡɚɞɚɧɧɵɯ ɭɫɥɨɜɢɹɯ ɜɧɟɲɧɟɣ ɫɪɟɞɵ. Ɉɞɧɚɤɨ ɭɫɥɨɠɧɟɧɢɟ ɫɢɫɬɟɦɵ ɩɪɢɜɨɞɢɬ ɤ ɪɨɫɬɭ ɡɚɬɪɚɬ. ɉɨɷɬɨɦɭ ɭɫɥɨɠɧɟɧɢɟ ɫɢɫɬɟɦɵ ɫɩɪɚɜɟɞɥɢɜɨ ɬɨɥɶɤɨ ɜ
ɬɟɯ ɫɥɭɱɚɹɯ, ɤɨɝɞɚ ɬɪɟɛɭɟɬɫɹ ɭɱɟɬ ɧɨɜɵɯ ɜɚɠɧɵɯ ɡɚɤɨɧɨɦɟɪɧɨɫɬɟɣ ɢɥɢ ɫɭɳɟɫɬɜɟɧɧɨɝɨ ɭɬɨɱɧɟɧɢɹ
ɪɚɧɟɟ ɢɡɜɟɫɬɧɵɯ ɫ ɰɟɥɶɸ ɩɨɜɵɲɟɧɢɹ ɬɨɱɧɨɫɬɢ ɢ ɪɟɡɭɥɶɬɚɬɢɜɧɨɫɬɢ ɪɟɲɟɧɢɹ. ɇɚ ɤɚɠɞɨɦ ɷɬɚɩɟ ɫɢɫɬɟɦɧɨɝɨ ɪɚɫɫɦɨɬɪɟɧɢɹ ɧɟɨɛɯɨɞɢɦɨ ɫɨɢɡɦɟɪɹɬɶ ɞɨɩɨɥɧɢɬɟɥɶɧɵɟ ɡɚɬɪɚɬɵ ɞɥɹ ɩɨɜɵɲɟɧɢɹ ɬɨɱɧɨɫɬɢ,
ɫ ɭɜɟɥɢɱɟɧɢɟɦ ɪɟɡɭɥɶɬɚɬɢɜɧɨɫɬɢ (ɷɮɮɟɤɬɢɜɧɨɫɬɢ) ɨɬ ɩɪɢɧɹɬɨɝɨ ɪɟɲɟɧɢɹ.
ɉɪɢɦɟɪɨɦ ɩɪɚɤɬɢɱɟɫɤɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɫɢɫɬɟɦɧɨɝɨ ɩɪɢɤɥɚɞɧɨɝɨ ɚɧɚɥɢɡɚ ɫɥɭɠɢɬ ɫɢɫɬɟɦɧɵɣ
ɩɨɞɯɨɞ ɩɪɢ ɭɩɪɚɜɥɟɧɢɢ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ ɜ ɦɨɥɨɱɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ.
Ɍɚɤ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɜɨɡɦɨɠɧɨɫɬɟɣ ɤɨɧɤɪɟɬɧɨɝɨ ɫɟɥɶɯɨɡɩɪɟɞɩɪɢɹɬɢɹ ɡɚɞɚɸɬɫɹ
ɨɩɬɢɦɚɥɶɧɵɟ ɩɚɪɚɦɟɬɪɵ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ, ɚ ɭɠɟ ɨɬ ɧɢɯ ɪɟɲɚɟɬɫɹ ɡɚɞɚɱɚ ɭɪɨɜɧɹ ɤɨɪɦɥɟɧɢɹ ɫɤɨɬɚ, ɜ ɬɨɦ ɱɢɫɥɟ ɢ ɩɪɢ ɜɵɪɚɳɢɜɚɧɢɢ ɛɭɞɭɳɟɣ ɜɵɫɨɤɨɩɪɨɞɭɤɬɢɜɧɨɣ ɤɨɪɨɜɵ. ɉɪɢ ɷɬɨɦ ɧɟɨɛɯɨɞɢɦɨ
ɭɱɢɬɵɜɚɬɶ ɩɨɹɜɥɟɧɢɟ ɧɨɜɵɯ ɢɧɬɟɧɫɢɜɧɵɯ ɬɢɩɨɜ ɦɨɥɨɱɧɨɝɨ ɫɤɨɬɚ ɫ ɩɪɢɥɢɬɢɟɦ ɤɪɨɜɢ ɝɨɥɲɬɢɧɨɜ,
ɤɨɬɨɪɵɟ ɪɟɡɤɨ ɪɟɚɝɢɪɭɸɬ ɧɚ ɤɚɱɟɫɬɜɨ ɤɨɪɦɥɟɧɢɹ.
ɍɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɧɨɟ ɠɢɜɨɬɧɨɟ, ɢ ɬɟɦ ɛɨɥɟɟ, ɧɨɜɵɟ ɷɤɨɧɨɦɢɱɟɫɤɢɟ ɭɫɥɨɜɢɹ, ɜ ɤɨɬɨɪɵɯ ɧɚɯɨɞɹɬɫɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɟ ɨɪɝɚɧɢɡɚɰɢɢ, ɞɢɤɬɭɸɬ ɢ ɧɨɜɵɟ ɩɨɞɯɨɞɵ ɜ ɱɚɫɬɧɨɫɬɢ ɜ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɦ
ɩɥɚɧɢɪɨɜɚɧɢɢ, ɤɨɬɨɪɵɟ ɞɨɥɠɧɵ ɥɟɱɶ ɜ ɨɫɧɨɜɭ ɝɨɞɨɜɨɝɨ ɢ ɩɨɦɟɫɹɱɧɨɝɨ ɛɢɡɧɟɫ – ɩɥɚɧɢɪɨɜɚɧɢɹ.
ȼɨ ɝɥɚɜɟ ɫɨɜɪɟɦɟɧɧɨɝɨ ɜɡɝɥɹɞɚ ɧɚ ɩɪɨɛɥɟɦɵ ɭɜɟɥɢɱɟɧɢɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɦɨɥɨɤɚ ɥɟɠɢɬ ɨɫɧɨɜɧɨɟ
ɫɪɟɞɫɬɜɨ ɩɪɨɢɡɜɨɞɫɬɜɚ – ɤɨɪɨɜɚ, ɢɦɟɧɧɨ ɨɬɫɸɞɚ ɦɟɧɹɸɬɫɹ ɦɟɬɨɞɢɱɟɫɤɢɟ ɩɨɞɯɨɞɵ ɜ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɦ ɩɥɚɧɢɪɨɜɚɧɢɢ. Ɂɚ ɨɫɧɨɜɭ ɜ ɩɪɨɢɡɜɨɞɫɬɜɟ ɦɨɥɨɤɚ ɛɟɪɺɬɫɹ ɝɟɧɟɬɢɱɟɫɤɢɣ ɩɨɬɟɧɰɢɚɥ ɠɢɜɨɬɧɨɝɨ, ɤɨɬɨɪɵɣ ɩɨɞɞɟɪɠɢɜɚɟɬɫɹ ɱɟɪɟɡ ɫɢɫɬɟɦɭ ɧɨɪɦɢɪɨɜɚɧɧɨɝɨ ɢ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɝɨ ɤɨɪɦɥɟɧɢɹ.
ɉɪɢɱɟɦ, ɧɨɪɦɢɪɨɜɚɧɧɨɟ ɤɨɪɦɥɟɧɢɟ ɫ ɭɱɟɬɨɦ ɝɟɧɟɬɢɱɟɫɤɨɝɨ ɩɨɬɟɧɰɢɚɥɚ ɢɥɢ ɩɨɞ ɩɥɚɧɢɪɭɟɦɭɸ
ɩɪɨɞɭɤɬɢɜɧɨɫɬɶ, ɟɫɬɶ ɫɭɬɶ ɦɚɥɨ ɡɚɬɪɚɬɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜ ɩɪɨɢɡɜɨɞɫɬɜɟ ɦɨɥɨɤɚ.
ɇɚ ɜɬɨɪɨɦ ɦɟɫɬɟ – ɫɨɡɞɚɧɢɟ ɧɟɨɛɯɨɞɢɦɨɣ ɞɥɹ ɫɬɚɞɚ ɤɨɪɦɨɜɨɣ ɛɚɡɵ, ɬɟɫɧɨ ɭɜɹɡɚɧɧɨɣ ɫ ɮɢɡɢɨɥɨɝɢɟɣ ɢ ɫɢɫɬɟɦɨɣ ɫɨɞɟɪɠɚɧɢɹ ɠɢɜɨɬɧɵɯ.
ɂɫɯɨɞɹ ɢɡ ɩɪɢɨɪɢɬɟɬɚ ɡɧɚɱɢɦɨɫɬɢ ɮɚɤɬɨɪɨɜ, ɫɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɧɚɢɛɨɥɶɲɢɣ ɭɞɟɥɶɧɵɣ ɜɟɫ
ɜ ɷɬɨɦ ɫɥɭɱɚɟ ɜ ɫɬɪɭɤɬɭɪɟ ɡɚɬɪɚɬ ɡɚɧɢɦɚɸɬ ɨɫɧɨɜɧɵɟ ɢ ɤɨɧɰɟɧɬɪɢɪɨɜɚɧɧɵɟ ɤɨɪɦɚ. Ʉɚɤ ɩɨɤɚɡɵɜɚɟɬ
ɚɧɚɥɢɡ, ɞɨɥɹ ɦɨɥɨɤɚ, ɩɨɥɭɱɟɧɧɨɝɨ ɡɚ ɫɱɟɬ ɨɫɧɨɜɧɨɝɨ ɤɨɪɦɚ, ɫɨɫɬɚɜɥɹɟɬ ɥɢɲɶ 30 % (ɚɧɚɥɢɡ ɫɞɟɥɚɧ
ɩɨ ɯɨɡɹɣɫɬɜɚɦ, ɝɞɟ ɢɫɩɨɥɶɡɭɸɬ ɩɨɤɭɩɧɵɟ ɤɨɦɛɢɤɨɪɦɚ). ȼ ɯɨɡɹɣɫɬɜɚɯ, ɝɞɟ ɡɚɝɨɬɚɜɥɢɜɚɸɬ ɤɨɪɦɚ ɧɟ
ɧɢɠɟ 1 ɤɥɚɫɫɚ, ɫ ɨɩɬɢɦɚɥɶɧɵɦ ɫɨɞɟɪɠɚɧɢɟɦ ɩɪɨɬɟɢɧɚ, ɫɚɯɚɪɨɜ ɢ ɞɪɭɝɢɯ ɤɨɦɩɨɧɟɧɬɨɜ, ɷɬɨɬ ɩɨɤɚɡɚɬɟɥɶ ɨɛɵɱɧɨ ɪɚɜɟɧ 50–60 %, ɱɬɨ ɜ ɫɜɨɸ ɨɱɟɪɟɞɶ, ɞɚɟɬ ɜɨɡɦɨɠɧɨɫɬɶ ɪɟɡɤɨ ɫɧɢɡɢɬɶ ɫɟɛɟɫɬɨɢɦɨɫɬɶ
ɪɚɰɢɨɧɚ ɡɚ ɫɱɟɬ ɭɦɟɧɶɲɟɧɢɹ ɭɞɟɥɶɧɨɝɨ ɜɟɫɚ ɞɨɪɨɝɨɫɬɨɹɳɢɯ ɤɨɧɰɟɧɬɪɢɪɨɜɚɧɧɵɯ ɤɨɪɦɨɜ, ɢ, ɫɥɟɞɨɜɚɬɟɥɶɧɨ, ɫɧɢɡɢɬɶ ɫɟɛɟɫɬɨɢɦɨɫɬɶ ɦɨɥɨɤɚ.
269
Ⱦɪɭɝɢɦ ɮɚɤɬɨɪɨɦ ɜ ɫɬɪɭɤɬɭɪɟ ɫɨɫɬɚɜɥɹɸɬ ɡɚɬɪɚɬɵ ɧɚ ɪɟɦɨɧɬ ɫɬɚɞɚ (22–36 %). ɗɬɨ ɜɵɡɜɚɧɨ,
ɫ ɨɞɧɨɣ ɫɬɨɪɨɧɵ, ɜɵɫɨɤɢɦɢ ɡɚɬɪɚɬɚɦɢ ɧɚ ɜɵɪɚɳɢɜɚɧɢɟ ɦɨɥɨɞɧɹɤɚ ɢ ɧɟɬɟɥɟɣ (ɧɢɡɤɢɟ ɫɪɟɞɧɟɫɭɬɨɱɧɵɟ ɩɪɢɪɨɫɬɵ ɢ, ɤɚɤ ɫɥɟɞɫɬɜɢɟ, ɩɨɡɞɧɢɣ ɜɜɨɞ ɜ ɫɬɚɞɨ), ɫ ɞɪɭɝɨɣ ɫɬɨɪɨɧɵ – ɜɵɫɨɤɢɦ ɭɪɨɜɧɟɦ
ɨɛɨɪɨɬɚ ɫɬɚɞɚ (ɛɨɥɟɟ 30 %). ɏɨɡɹɣɫɬɜɚ ɢɫɩɨɥɶɡɭɸɬ ɝɨɥɲɬɢɧɫɤɢɯ ɤɨɪɨɜ 2,5-3 ɝɨɞɚ.
Ɍɚɤɨɣ ɨɛɨɪɨɬ ɷɤɨɧɨɦɢɱɟɫɤɢ ɨɩɪɚɜɞɚɧ ɥɢɲɶ ɜ ɫɬɚɞɚɯ ɫ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ 6–7 ɬɵɫ. ɤɝ ɦɨɥɨɤɚ ɧɚ
ɤɨɪɨɜɭ ɜ ɝɨɞ, ɜ ɩɪɨɬɢɜɧɨɦ ɫɥɭɱɚɟ, ɷɬɢ ɡɚɬɪɚɬɵ ɢɥɢ ɩɪɨɫɬɨ ɧɟ ɨɤɭɩɚɸɬɫɹ, ɢɥɢ ɞɚɸɬ ɫɪɚɜɧɢɬɟɥɶɧɨ
ɧɢɡɤɢɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɷɮɮɟɤɬ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟ ɩɪɨɰɟɫɫɚ ɭɩɪɚɜɥɟɧɢɹ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ ɜ ɦɨɥɨɱɧɨɦ ɫɤɨɬɨɜɨɞɫɬɜɟ ɧɟɨɛɯɨɞɢɦɨ ɨɫɭɳɟɫɬɜɥɹɬɶ ɧɚ ɨɫɧɨɜɟ ɩɪɟɞɥɚɝɚɟɦɨɝɨ ɫɢɫɬɟɦɧɨɝɨ ɚɧɚɥɢɡɚ ɩɪɨɢɡɜɨɞɫɬɜɚ
ɩɪɨɞɭɤɰɢɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ.
ɍȾɄ 576.851.42.:576.858.9.616.591.2
ɉɊɈɎɂɅȺɄɌɂɊɍɘɓɂȿ ɋȼɈɃɋɌȼȺ ȻȺɄɌȿɊɂɈɎȺȽɈȼ
ɉɊɂ ɗɄɋɉȿɊɂɆȿɇɌȺɅɖɇɈɆ ȻɊɍɐȿɅɅȿɁȿ ɀɂȼɈɌɇɕɏ
ɋɍɅɌȺɇɈȼ Ⱥ.Ⱥ., ȻȺɊȺɆɈȼȺ ɒ.Ⱥ., ɈɋɉȺɇɈȼ ȿ.Ʉ., ȾɍɃɋȿȻȿɄɈȼȺ Ƚ.Ⱥ.,
Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɜɟɬɟɪɢɧɚɪɧɵɣ ɢɧɫɬɢɬɭɬ, Ⱥɥɦɚɬɵ, Ʉɚɡɚɯɫɬɚɧ.
E-mail: kaznivialmaty@mail.ru
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ, ɤɨɝɞɚ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ ɩɪɨɢɫɯɨɞɢɬ ɢɧɬɟɧɫɢɜɧɨɟ
ɜɨɫɫɬɚɧɨɜɥɟɧɢɟ ɩɨɝɨɥɨɜɶɹ ɜɵɫɨɤɨɩɪɨɞɭɤɬɢɜɧɨɝɨ ɫɤɨɬɚ (ɡɚɦɟɬɧɨ ɫɧɢɡɢɜɲɟɝɨ ɫɜɨɸ ɱɢɫɥɟɧɧɨɫɬɶ
ɩɨɫɥɟ ɪɚɫɩɚɞɚ ɋɨɸɡɚ), ɫɨɡɞɚɧɢɟ ɢ ɫɨɯɪɚɧɟɧɢɟ ɫɬɚɛɢɥɶɧɨɝɨ ɛɥɚɝɨɩɨɥɭɱɢɹ ɜ ɯɨɡɹɣɫɬɜɭɸɳɢɯ ɫɭɛɴɟɤɬɚɯ, ɨɫɨɛɟɧɧɨ ɜ ɨɬɧɨɲɟɧɢɢ ɨɫɨɛɨ ɨɩɚɫɧɵɯ ɢɧɮɟɤɰɢɣ, ɤ ɤɨɬɨɪɵɦ ɨɬɧɨɫɢɬɫɹ ɢ ɛɪɭɰɟɥɥɟɡ ɠɢɜɨɬɧɵɯ, ɹɜɥɹɟɬɫɹ ɩɟɪɜɨɨɱɟɪɟɞɧɨɣ ɡɚɞɚɱɟɣ ɜɟɬɟɪɢɧɚɪɧɨɣ ɧɚɭɤɢ ɢ ɩɪɚɤɬɢɤɢ.
ȼ ɷɬɨɣ ɫɜɹɡɢ ɧɚɭɱɧɵɟ ɢɡɵɫɤɚɧɢɹ ɜ ɨɛɥɚɫɬɢ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɢ ɪɚɡɪɚɛɨɬɤɢ ɦɟɬɨɞɨɜ ɢ ɫɪɟɞɫɬɜ
ɩɪɨɮɢɥɚɤɬɢɤɢ ɛɪɭɰɟɥɥɟɡɧɨɣ ɢɧɮɟɤɰɢɢ ɫ ɰɟɥɶɸ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɜ ɫɢɫɬɟɦɟ ɩɪɨɬɢɜɨɷɩɢɡɨɨɬɢɱɟɫɤɢɯ
ɦɟɪɨɩɪɢɹɬɢɣ ɧɟ ɬɟɪɹɸɬ ɫɜɨɟɣ ɚɤɬɭɚɥɶɧɨɫɬɢ ɜ ɪɟɲɟɧɢɢ ɩɪɨɛɥɟɦɵ ɫɤɨɪɟɣɲɟɣ ɥɢɤɜɢɞɚɰɢɢ ɞɚɧɧɨɝɨ
ɡɚɛɨɥɟɜɚɧɢɹ. Ɋɟɡɭɥɶɬɚɬɵ ɪɚɧɟɟ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɢɡɭɱɟɧɢɸ ɫɩɟɰɢ-ɮɢɱɟɫɤɨɝɨ ɛɚɤɬɟɪɢɨɮɚɝɚ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɨɛɧɚɪɭɠɟɧɢɟ ɢɯ ɜ ɫɜɟɠɟɜɵɞɟɥɟɧɧɵɯ ɢɡ ɛɢɨɦɚɬɟɪɢɚɥɚ ɛɪɭɰɟɥɥɟɡɧɵɯ ɤɭɥɶɬɭɪɚɯ, ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɨɛ ɨɛɹɡɚɬɟɥɶɧɨɣ ɰɢɪɤɭɥɹɰɢɢ ɜɨɡɛɭɞɢɬɟɥɹ ɢɧɮɟɤɰɢɢ ɜ ɨɪɝɚɧɢɡɦɟ ɢɫɫɥɟɞɭɟɦɨɝɨ ɠɢɜɨɬɧɨɝɨ. ɉɨ ɞɚɧɧɵɦ ɪɚɡɥɢɱɧɵɯ ɢɫɫɥɟɞɨɜɚɬɟɥɟɣ ɛɚɤɬɟɪɢɨɮɚɝɢ ɫɩɨɫɨɛɧɵ ɪɚɡɪɭɲɚɬɶ ɜ
ɨɪɝɚɧɢɡɦɟ ɢɧɮɢɰɢɪɨɜɚɧɧɨɝɨ ɠɢɜɨɬɧɨɝɨ ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɟ ɩɚɬɨɝɟɧɧɵɟ ɦɢɤɪɨɨɪɝɚɧɢɡɦɵ ɢ ɫɧɢɡɢɬɶ
ɬɢɬɪɵ ɚɧɬɢɬɟɥ, ɭɥɚɜɥɢɜɚɟɦɵɯ ɩɪɢɧɹɬɵɦɢ ɞɥɹ ɩɪɚɤɬɢɤɢ ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɦɢ ɬɟɫɬɚɦɢ [1,2,3]. ɂɫɯɨɞɹ
ɢɡ ɷɬɨɝɨ ɧɚɦɢ ɛɵɥ ɭɫɬɚɧɨɜɥɟɧ ɥɢɬɢɱɟɫɤɢɣ ɫɩɟɤɬɪ ɜɵɞɟɥɟɧɧɵɯ ɛɪɭɰɟɥɥɺɡɧɵɯ ɮɚɝɨɜ ɜ ɡɚɜɢɫɢɦɨɫɬɢ
ɨɬ ɢɧɞɭɰɢɪɭɸɳɟɝɨ ɮɚɤɬɨɪɚ, ɩɪɨɜɟɞɟɧɚ ɫɟɥɟɤɰɢɹ ɢ ɫɤɪɢɧɢɧɝ ɚɤɬɢɜɧɨɫɬɢ ɷɬɢɯ ɮɚɝɨɜ, ɢɡɭɱɟɧɵ ɢɯ
ɛɢɨɥɨɝɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ. ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɵɥ ɩɨɥɭɱɟɧ ɩɨɥɢɜɚɥɟɧɬɧɵɣ
ɮɚɝ ɫ ɜɵɫɨɤɢɦ ɬɢɬɪɨɦ ɚɤɬɢɜɧɨɫɬɢ, ɨɬɥɢɱɚɸɳɢɣɫɹ ɨɬ ɢɡɜɟɫɬɧɵɯ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɮɚɝɨɜ, ɫɩɨɫɨɛɧɨɫɬɶɸ ɥɢɡɢɪɨɜɚɬɶ ɤɭɥɶɬɭɪɵ ɛɪɭɰɟɥɥ ɜɢɞɨɜ abortus, suis, melitensis ɜ S ɢ R-ɮɨɪɦɚɯ ɢ ɤɥɟɬɤɢ
B. ɨvis. ȼ ɩɪɟɞɵɞɭɳɢɯ ɨɩɵɬɚɯ ɧɚɦɢ ɛɵɥɨ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɩɨɥɭɱɟɧɧɵɣ ɩɨɥɢɜɚɥɟɧɬɧɵɣ ɛɪɭɰɟɥɥɟɡɧɵɣ ɮɚɝ ɨɛɥɚɞɚɟɬ ɜɵɪɚɠɟɧɧɵɦ ɫɚɧɢɪɭɸɳɢɦ ɞɟɣɫɬɜɢɟɦ ɩɪɢ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɛɪɭɰɟɥɥɟɡɟ ɭ
ɦɨɪɫɤɢɯ ɫɜɢɧɨɤ, ɜɵɡɜɚɧɧɵɦ ɜɢɞɚɦɢ B.melitensis ɢ B.abortus.
ɋ ɰɟɥɶɸ ɢɡɭɱɟɧɢɹ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɫɜɨɣɫɬɜ ɩɨɥɭɱɟɧɧɵɣ ɨɩɵɬɧɵɣ ɮɚɝ ɛɵɥ ɢɫɩɵɬɚɧ ɧɚɦɢ ɜ
ɥɚɛɨɪɚɬɨɪɧɵɯ ɭɫɥɨɜɢɹɯ (ɧɚ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨ ɡɚɪɚɠɟɧɧɵɯ ɦɨɪɫɤɢɯ) ɜ ɤɚɱɟɫɬɜɟ ɩɪɨɬɢɜɨɛɪɭɰɟɥɥɟɡɧɨɝɨ ɩɪɟɩɚɪɚɬɚ, ɫɩɨɫɨɛɧɨɝɨ ɩɪɟɞɨɯɪɚ-ɧɹɬɶ ɨɪɝɚɧɢɡɦ ɠɢɜɨɬɧɵɯ ɨɬ ɡɚɪɚɠɟɧɢɹ ɛɪɭɰɟɥɥɟɡɨɦ. ȼ
ɞɚɧɧɨɦ ɨɩɵɬɟ ɜɵɞɟɥɟɧɧɵɣ ɩɨɥɢɜɚɥɟɧɬɧɵɣ ɮɚɝ ɜɜɨɞɢɥɢ ɩɨɞɤɨɠɧɨ ɦɨɪɫɤɢɦ ɫɜɢɧɤɚɦ ɜ ɞɨɡɟ 50 ɦɥɪɞ
ɤɨɪɩɭɫɤɭɥ ɞɨ ɡɚɪɚɠɟɧɢɹ ɢɯ ɛɪɭɰɟɥɥɚɦɢ. ȼɫɟɝɨ ɛɵɥɨ ɫɮɨɪɦɢɪɨɜɚɧɨ 4 ɝɪɭɩɩɵ ɠɢɜɨɬɧɵɯ, ɩɨ 5 ɝɨɥɨɜ
ɜ ɤɚɠɞɨɣ. Ɇɨɪɫɤɢɯ ɫɜɢɧɨɤ 1 ɢ 3 ɝɪɭɩɩ ɡɚɪɚɠɚɥɢ ɲɬɚɦɦɨɦ B.melitensis 565, 2-ɨɣ ɢ 4-ɨɣ – B.abortus
54. ɀɢɜɨɬɧɵɦ 1-ɨɣ ɢ 2 -ɨɣ ɝɪɭɩɩ ɩɪɟɞɜɚɪɢɬɟɥɶɧɨ ɡɚ 3 ɫɭɬɨɤ ɞɨ ɡɚɪɚɠɟɧɢɹ ɜɜɨɞɢɥɢ ɩɨɥɢɜɚɥɟɧɬɧɵɣ ɮɚɝ, ɚ ɠɢɜɨɬɧɵɟ 3 ɢ 4 ɝɪɭɩɩ ɨɫɬɚɜɚɥɢɫɶ ɤɨɧɬɪɨɥɶɧɵɦɢ – ɮɚɝɢ ɧɟ ɜɜɨɞɢɥɢ. ɉɟɪɟɞ ɡɚɪɚɠɟɧɢɟɦ
ɦɨɪɫɤɢɟ ɫɜɢɧɤɢ ɛɵɥɢ ɢɫɫɥɟɞɨɜɚɧɵ ɧɚ ɛɪɭɰɟɥɥɟɡ ɜ ɊȺ ɢ ɊɋɄ. ȼ ɨɩɵɬ ɛɵɥɢ ɜɡɹɬɵ ɠɢɜɨɬɧɵɟ ɨɬɪɢɰɚɬɟɥɶɧɨ ɪɟɚɝɢɪɭɸɳɢɟ ɧɚ ɛɪɭɰɟɥɥɟɡ ɩɨ ɧɚɡɜɚɧɧɵɦ ɬɟɫɬɚɦ ɜɟɫɨɦ 350–450 ɝ. Ɂɚɬɟɦ ɧɚ 14, 30 ɫɭɬɤɢ
ɢ ɞɚɥɟɟ ɱɟɪɟɡ ɤɚɠɞɵɟ 10 ɫɭɬɨɤ ɭ ɜɫɟɯ ɦɨɪɫɤɢɯ ɫɜɢɧɨɤ ɤɚɤ ɨɩɵɬɧɵɯ, ɬɚɤ ɢ ɤɨɧɬɪɨɥɶɧɵɯ ɝɪɭɩɩ ɛɵɥɢ
ɜɡɹɬɵ ɩɪɨɛɵ ɤɪɨɜɢ ɞɥɹ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ. ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ, ɩɨɥɭɱɟɧɧɵɦ ɜ ɊȺ, ɊȾɋɄ,
ɊȻɉ ɨɩɪɟɞɟɥɟɧɵ ɞɢɧɚɦɢɤɢ ɧɚɪɚɫɬɚɧɢɹ ɢ ɭɝɚɫɚɧɢɹ ɬɢɬɪɨɜ ɫɩɟɰɢɮɢɱɟɫɤɢɯ ɚɧɬɢɬɟɥ.
ɉɨ ɢɫɬɟɱɟɧɢɢ 30 ɫɭɬɨɤ ɩɨɫɥɟ ɡɚɪɚɠɟɧɢɹ, ɧɟɡɚɜɢɫɢɦɨ ɨɬ ɪɟɡɭɥɶɬɚɬɨɜ ɫɟɪɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɵɥ ɩɪɨɜɟɞɟɧ ɭɛɨɣ ɠɢɜɨɬɧɵɯ ɢ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɨɟ ɢɫɫɥɟɞɨɜɚɧɢɟ ɢɯ ɨɪɝɚɧɨɜ, ɫ ɰɟɥɶɸ ɜɵ270
ɞɟɥɟɧɢɹ ɤɭɥɶɬɭɪ ɛɪɭɰɟɥɥ. Ɋɟɡɭɥɶɬɚɬɵ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɜ ɝɪɭɩɩɟ ɦɨɪɫɤɢɯ
ɫɜɢɧɨɤ, ɡɚɪɚɠɟɧɧɵɯ ɤɭɥɶɬɭɪɨɣ ɢɡ ɲɬɚɦɦɚ ȼ.melitensis 565 ɫɩɭɫɬɹ ɬɪɨɟ ɫɭɬɨɤ ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɮɚɝɚ,
ɱɟɪɟɡ ɦɟɫɹɰ ɩɪɨɬɢɜɨɫɬɨɹɥɨ ɢɧɮɢɰɢɪɨɜɚɧɢɸ 68 % ɨɫɨɛɟɣ. ɂɧɞɟɤɫ ɢɧɮɢɰɢɪɨɜɚɧɧɨɫɬɢ ɠɢɜɨɬɧɵɯ
ɜ ɞɚɧɧɨɣ ɝɪɭɩɩɟ ɫɨɫɬɚɜɢɥ 7,6. ȼ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɠɢɜɨɬɧɵɯ, ɩɨɞɜɟɪɝɧɭɬɵɯ ɬɨɥɶɤɨ ɡɚɪɚɠɟɧɢɸ
(ɛɟɡ ɩɪɟɞɜɚɪɢɬɟɥɶɧɨɝɨ ɜɜɟɞɟɧɢɹ ɩɨɥɢɜɚɥɟɧɬɧɨɝɨ ɮɚɝɚ) ɛɪɭɰɟɥɥɟɡɧɚɹ ɢɧɮɟɤɰɢɹ ɪɟɝɢɫɬɪɢɪɨɜɚɥɚɫɶ
ɭ 100 % ɦɨɪɫɤɢɯ ɫɜɢɧɨɤ, ɢɧɞɟɤɫ ɢɧɮɢɰɢɪɨɜɚɧɧɨɫɬɢ ɫɨɫɬɚɜɢɥ – 44 %.Ɋɟɡɭɥɶɬɚɬɵ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɨɪɝɚɧɨɜ ɦɨɪɫɤɢɯ ɫɜɢɧɨɤ, ɡɚɪɚɠɟɧɧɵɯ ɲɬɚɦɦɨɦ ȼ.abortus 54 ɱɟɪɟɡ 3 ɫɭɬɨɤ
ɩɨɫɥɟ ɜɜɟɞɟɧɢɹ ɨɩɵɬɧɨɝɨ ɮɚɝɚ ɩɨɤɚɡɚɥɢ ɨɬɫɭɬɫɬɜɢɟ ɪɨɫɬɚ ɛɪɭɰɟɥɥ, ɬ.ɟ. ɨɬɦɟɱɟɧɨ 100 %-ɧɨɟ ɩɪɨɬɢɜɨɫɬɨɹ-ɧɢɟ ɠɢɜɨɬɧɵɯ ɢɧɮɢɰɢɪɨɜɚɧɢɸ. ɂɡ ɛɢɨɦɚɬɟɪɢɚɥɚ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ ɠɢɜɨɬɧɵɯ ɤɨɧɬɪɨɥɶɧɨɣ
ɝɪɭɩɩɵ (ɬɨɥɶɤɨ ɡɚɪɚɠɟɧɧɨɣ, ɛɟɡ ɜɜɟɞɟɧɢɹ ɮɚɝɚ) ɛɪɭɰɟɥɥɵ ɜɵɫɟɜɚɥɢɫɶ ɜ 100 %-ɧɵɯ ɫɥɭɱɚɹɯ, ɚ ɢɧɞɟɤɫ ɢɧɮɢɰɢɪɨɜɚɧɧɨɫɬɢ ɫɨɫɬɚɜɢɥ – 46 %.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɞɚɧɧɵɟ ɩɪɟɞɜɚɪɢɬɟɥɶɧɵɯ ɨɩɵɬɨɜ ɩɨɤɚɡɵɜɚɸɬ, ɱɬɨ ɩɨɥɭɱɟɧɧɵɣ ɧɚɦɢ ɩɨɥɢɜɚɥɟɧɬɧɵɣ ɫɩɟɰɢɮɢɱɟɫɤɢɣ ɮɚɝ ɫɩɨɫɨɛɟɧ ɩɪɟɞɨɯɪɚɧɢɬɶ ɨɪɝɚɧɢɡɦ ɠɢɜɨɬɧɵɯ ɨɬ ɡɚɪɚɠɟɧɢɹ ɛɪɭɰɟɥɥɟɡɨɦ. ɇɚɢɛɨɥɶɲɢɦ ɩɪɨɮɢɥɚɤɬɢɱɟɫ-ɤɢɦ ɷɮɮɟɤɬɨɦ ɨɛɥɚɞɚɟɬ ɧɚɡɜɚɧɧɵɣ ɮɚɝ ɩɪɨɬɢɜ ɛɪɭɰɟɥɥ ɜɢɞɚ
abortus. ɉɨɥɭɱɟɧɧɵɟ ɜ ɥɚɛɨɪɚɬɨɪɧɵɯ ɭɫɥɨɜɢɹɯ ɨɛɧɚɞɟɠɢɜɚɸɳɢɟ ɞɚɧɧɵɟ ɫɜɢɞɟ-ɬɟɥɶɫɬɜɭɸɬ ɨ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɢɡɭɱɟɧɢɹ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɨɥɭɱɟɧɧɨɝɨ ɩɨɥɢɜɚɥɟɧɬɧɨɝɨ ɮɚɝɚ ɧɚ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
Ʌɹɩɭɫɬɢɧɚ Ʌ.ȼ. Ȼɪɭɰɟɥɥɟɡɧɵɟ ɛɚɤɬɟɪɢɨɮɚɝɢ. Ɉɩɬɢɦɢɡɚɰɢɹ ɬɟɯɧɨɥɨɝɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɢ ɫɩɨɫɨɛɨɜ ɩɪɢɦɟɧɟɧɢɹ ɜ ɥɚɛɨɪɚɬɨɪɧɨɣ ɞɢɚɝɧɨɫɬɢɤɟ ɛɪɭɰɟɥɥɟɡɚ//Ⱦɢɫɫ. … ɞɨɤɬ.ɦɟɞɸɧɚɭɤ:03.00.07.-ɋɚɪɚɬɨɜ,2004. –
212 ɫ.
ɋɭɥɬɚɧɨɜ Ⱥ.Ⱥ, Ɉɫɩɚɧɨɜ ȿ.Ʉ. ɉɪɨɮɢɥɚɤɬɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɮɚɝɨɜ Iz ɢ Ɍɛ ɧɚ ɡɚɪɚɠɟɧɧɵɯ ɦɨɪɫɤɢɯ
ɫɜɢɧɤɚɯ //ȼɟɫɬɧɢɤ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɧɚɭɤɢ Ʉɚɡɚɯɫɬɚɧɚ «Ȼɚɫɬɚɭ».- 2004. – ʋ1.-ɋ.72–75.
ȼɨɪɨɛɶɟɜ Ⱥ.Ⱥ., Ɉɫɩɚɧɨɜ ȿ.Ʉ. ɉɟɪɢɨɞ ɩɟɪɫɢɫɬɟɧɰɢɢ ɛɪɭɰɟɥɥɟɡɧɵɯ ɮɚɝɨɜ ɜ ɨɪɝɚɧɢɡɦɟ ɢɧɬɚɤɬɧɵɯ ɠɢɜɨɬɧɵɯ //ȼɟɫɬɧɢɤ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɧɚɭɤɢ Ʉɚɡɚɯɫɬɚɧɚ «Ȼɚɫɬɚɭ», 2004.-ɋ.63-68.
ɍȾɄ 636.4:636.087.7:619:615.9
ɉɊɂɆȿɇȿɇɂȿ ɋɈɊȻȿɇɌȺ ɂ ɉɊȿȻɂɈɌɂɄȺ
ɉɊɂ ɆɂɄɈɌɈɄɋɂɄɈɁȺɏ ɋȼɂɇȿɃ
ɏȺɉȬɊɋɄɂɃ ɘ.Ⱥ.*, ɋɂɆɈɇɈȼ ɉ.Ƚ.*, ȺɒȿɇȻɊȿɇɇȿɊ Ⱥ.ɂ.*, ȼȿɅɖɄȿɊ Ⱦ.Ⱥ.**,
*ɎȽȻɇɍ «Ⱥɥɬɚɣɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ
ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɢ ɜɟɬɟɪɢɧɚɪɢɢ» (Ⱥɇɂɂɀɢȼ),
**ɈɈɈ “Ȼɢɨɮɚɪɦ Ⱥɥɬɚɣ”
ȼɜɟɞɟɧɢɟ
Ɉɞɧɨɣ ɢɡ ɨɫɧɨɜɧɵɯ ɩɪɨɛɥɟɦ ɫɜɢɧɨɜɨɞɫɬɜɚ ɹɜɥɹɟɬɫɹ ɛɨɪɶɛɚ ɫ ɩɥɟɫɧɟɜɵɦɢ ɝɪɢɛɚɦɢ ɢ ɦɢɤɨɬɨɤɫɢɧɚɦɢ, ɤɨɬɨɪɵɟ ɨɧɢ ɩɪɨɞɭɰɢɪɭɸɬ ɜ ɩɪɨɰɟɫɫɟ ɫɜɨɟɣ ɠɢɡɧɟɞɟɹɬɟɥɶɧɨɫɬɢ.
Ɇɢɤɨɬɨɤɫɢɤɨɡɵ ɢɦɟɸɬ ɞɨɜɨɥɶɧɨ ɲɢɪɨɤɨɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɢ ɧɚɧɨɫɹɬ ɡɧɚɱɢɬɟɥɶɧɵɣ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɭɳɟɪɛ ɜ ɫɜɢɧɨɜɨɞɫɬɜɟ, ɨɧɢ ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧɵ ɜ ɩɪɢɪɨɞɟ ɢ ɞɨɤɚɡɚɧɚ ɢɯ ɪɟɚɥɶɧɚɹ
ɨɩɚɫɧɨɫɬɶ ɞɥɹ ɱɟɥɨɜɟɤɚ ɢ ɠɢɜɨɬɧɵɯ. ȼ Ɋɨɫɫɢɢ ɩɨ ɫɬɟɩɟɧɢ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɧɚɢɛɨɥɶɲɟɟ ɡɧɚɱɟɧɢɟ
ɢɦɟɸɬ ɮɭɡɚɪɢɨɬɨɤɫɢɧɵ – Ɍ2 ɬɨɤɫɢɧ, ɚɮɥɨɬɨɤɫɢɧ, ɨɯɪɚɬɨɤɫɢɧ, ɡɟɚɪɚɥɟɧɨɧ, ɞɟɡɨɤɫɢɧɢɜɚɥɟɧɨɥ. [3]
Ɇɧɨɝɢɟ ɦɢɤɨɬɨɤɫɢɧɵ ɨɛɥɚɞɚɸɬ ɤɚɧɰɟɪɨɝɟɧɧɵɦ, ɦɭɬɚɝɟɧɧɵɦ, ɬɟɪɚɬɨɝɟɧɧɵɦ, ɚɥɥɟɪɝɟɧɧɵɦ, ɢɦɦɭɧɨɫɭɩɪɟɫɫɢɜɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɫɩɨɫɨɛɧɵɦɢ ɫɧɢɠɚɬɶ ɪɟɡɢɫɬɟɧɬɧɨɫɬɶ ɨɪɝɚɧɢɡɦɚ ɤ ɢɧɮɟɤɰɢɨɧɧɵɦ ɢ ɧɟɡɚɪɚɡɧɵɦ ɛɨɥɟɡɧɵɦ.[2]
Ɉɛɳɢɟ ɫɢɦɩɬɨɦɵ, ɫɜɹɡɚɧɧɵɟ ɫ ɦɢɤɨɬɨɤɫɢɧɚɦɢ: ɫɧɢɠɟɧɢɟ ɩɨɬɪɟɛɥɟɧɢɹ ɤɨɪɦɚ, ɫɧɢɠɟɧɢɟ ɬɟɦɩɨɜ ɪɨɫɬɚ, ɫɧɢɠɟɧɢɟ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɤɨɧɜɟɪɫɢɢ ɤɨɪɦɚ, ɭɱɚɳɟɧɢɟ ɫɥɭɱɚɟɜ ɡɚɛɨɥɟɜɚɧɢɣ, ɫɧɢɠɟɧɢɟ
ɢɦɦɭɧɢɬɟɬɚ, ɪɜɨɬɚ, ɜɵɩɚɞɟɧɢɟ ɩɪɹɦɨɣ ɤɢɲɤɢ ɢɥɢ ɜɥɚɝɚɥɢɳɚ, ɜɧɟɡɚɩɧɚɹ ɫɦɟɪɬɶ, ɛɥɟɞɧɨɫɬɶ ɢ ɫɥɚɛɨɫɬɶ ɭ ɫɜɢɧɟɣ; ɤɪɨɜɚɜɵɟ ɮɟɤɚɥɢɢ, ɫɧɢɠɟɧɢɟ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɫɜɢɧɟɣ, ɚɛɨɪɬɵ, ɭɱɚɳɟɧɢɟ ɫɥɭɱɚɟɜ
ɪɟɚɛɫɨɪɛɰɢɢ ɩɥɨɞɚ, ɜɨɡɜɪɚɳɟɧɢɟ ɜ ɨɯɨɬɭ, ɧɟɫɨɨɬɜɟɬɫɬɜɢɟ ɫɬɚɧɞɚɪɬɚɦ ɭɩɢɬɚɧɧɨɫɬɢ, ɡɚɞɟɪɠɤɚ ɩɨɥɨɜɨɝɨ ɫɨɡɪɟɜɚɧɢɹ ɭ ɫɜɢɧɨɤ ɢ ɯɪɹɱɤɨɜ, ɩɨɧɢɠɟɧɧɨɟ ɥɢɛɢɞɨ, ɧɢɡɤɨɟ ɤɚɱɟɫɬɜɨ ɫɩɟɪɦɵ, ɭɱɚɳɟɧɢɟ
ɫɥɭɱɚɟɜ ɛɨɥɟɡɧɟɣ ɩɟɱɟɧɢ ɢ ɩɨɱɟɤ. (1)
Ɉɞɧɢɦ ɢɡ ɪɟɲɟɧɢɣ ɞɚɧɧɨɣ ɩɪɨɛɥɟɦɵ ɦɨɠɟɬ ɫɬɚɬɶ ɫɨɜɦɟɫɬɧɨɟ ɩɪɢɦɟɧɟɧɢɟ ɫɨɪɛɟɧɬɨɜ ɢ ɩɪɟɛɢɨɬɢɤɨɜ.
ɐɟɥɶ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ – ɢɡɭɱɢɬɶ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɤɨɦɩɥɟɤɫɧɨɝɨ ɫɩɨɫɨɛɚ ɩɪɢɦɟɧɟɧɢɹ ɩɪɟɩɚɪɚɬɨɜ “Ɏɭɧɝɢɫɨɪɛ” ɢ «Ʉɨɪɦɨɦɢɤɫ – ɤɨɦɩɥɟɤɫ» ɫ ɰɟɥɶɸ ɫɧɢɠɟɧɢɹ ɧɟɝɚɬɢɜɧɨɝɨ ɜɥɢɹɧɢɹ ɫɨɞɟɪɠɚ271
ɳɢɯɫɹ ɜ ɤɨɦɛɢɤɨɪɦɟ ɬɨɤɫɢɱɟɫɤɢɯ ɩɪɨɞɭɰɟɧɬɨɜ ɩɥɟɫɧɟɜɵɯ ɝɪɢɛɨɜ ɢ ɧɨɪɦɚɥɢɡɚɰɢɢ ɦɢɤɪɨɮɥɨɪɵ
ɠɟɥɭɞɨɱɧɨ-ɤɢɲɟɱɧɨɝɨ ɬɪɚɤɬɚ ɭ ɩɨɪɨɫɹɬ ɧɚ ɫɬɚɞɢɢ ɞɨɪɚɳɢɜɚɧɢɹ ɜ ɭɫɥɨɜɢɹɯ ɩɪɨɢɡɜɨɞɫɬɜɚ.
ɍɫɥɨɜɢɹ, ɦɚɬɟɪɢɚɥɵ ɢ ɦɟɬɨɞɵ. ɂɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɜɟɞɟɧɵ ɜ 2015 ɝ. ɧɚ ɫɜɢɧɨɤɨɦɩɥɟɤɫɟ «ɂɉ ɄɎɏ
Ɇɚɥɶɰɟɜ ɇ.ɉ.», ɧɚ ɡɞɨɪɨɜɵɯ, ɧɨɪɦɚɥɶɧɨ ɪɚɡɜɢɬɵɯ ɩɨɪɨɫɹɬɚɯ ɤɪɭɩɧɨɣ ɛɟɥɨɣ ɩɨɪɨɞɵ ɜ ɞɜɭɯɦɟɫɹɱɧɨɝɨ ɜɨɡɪɚɫɬɚ (ɩɟɪɢɨɞ ɞɨɪɚɳɢɜɚɧɢɹ), ɢɡ ɤɨɬɨɪɵɯ ɩɨ ɩɪɢɧɰɢɩɭ ɚɧɚɥɨɝɨɜ ɛɵɥɢ ɫɮɨɪɦɢɪɨɜɚɧɵ
4 ɝɪɭɩɩɵ (3-ɨɩɵɬɧɵɯ ɢ 1-ɤɨɧɬɪɨɥɶɧɚɹ) ɨɬ 15–17 ɝɨɥɨɜ ɜ ɤɚɠɞɨɣ, ɷɤɫɩɟɪɢɦɟɧɬ ɩɪɨɜɨɞɢɥɫɹ ɞɨ 120
ɞɧɹ ɠɢɡɧɢ. ȼɫɟ ɝɪɭɩɩɵ ɪɚɧɞɨɦɢɡɢɪɨɜɚɧɵ ɩɨ ɭɫɥɨɜɢɹɦ ɫɨɞɟɪɠɚɧɢɹ ɢ ɤɨɪɦɥɟɧɢɹ. ɋɯɟɦɚ ɨɩɵɬɚ
ɩɪɟɞɫɬɚɜɥɟɧɚ ɜ ɬɚɛɥɢɰɟ 1.
Ɍɚɛɥɢɰɚ 1
ȹ ȋȘțȗȗȣ
ɇɚɢɦɟɧɨɜɚɧɢɟ ɩɪɟɩɚɪɚɬɚ
Ʉɨɥ-ɜɨ ɝɨɥ.
ǬȖȏȈ ȊȊȍȌȍȕȐȧ ȗȘȍȗȈȘȈȚȈ, Ȓȋ ȕȈ 1
ȚȖȕȕț ȒȖȘȔȈ
1
2
3
Ʉɨɧɬɪɨɥɶɧɚɹ
Ɏɭɧɝɢɫɨɪɛ
Ʉɨɪɦɨɦɢɤɫ-ɤɨɦɩɥɟɤɫ
Ɏɭɧɝɢɫɨɪɛ + Ʉɨɪɦɨɦɢɤɫ-ɤɨɦɩɥɟɤɫ
-
17
16
15
15
1,0
1,0
1,0 + 1,0
-
Ɋɟɡɭɥɶɬɚɬɵ ɢ ɨɛɫɭɠɞɟɧɢɟ
ɉɪɢ ɩɨɫɬɚɧɨɜɤɟ ɧɚ ɨɩɵɬ ɜ 2 ɦɟɫɹɰɚ ɩɨɪɨɫɹɬɚ ɢɦɟɥɢ ɨɞɢɧɚɤɨɜɭɸ ɠɢɜɭɸ ɦɚɫɫɭ, ɩɨɷɬɨɦɭ ɜɡɹɥɢ
ɡɚ ɨɫɧɨɜɧɵɟ ɩɨɤɚɡɚɬɟɥɢ – ɫɪɟɞɧɟɫɭɬɨɱɧɵɣ ɩɪɢɜɟɫ ɢ ɚɛɫɨɥɸɬɧɵɣ ɩɪɢɪɨɫɬ ɠɢɜɨɣ ɦɚɫɫɵ. Ⱥ ɤ ɤɨɧɰɭ
ɬɪɟɬɶɟɝɨ ɦɟɫɹɰɚ, ɛɥɚɝɨɞɚɪɹ ɪɚɡɥɢɱɧɨɣ ɫɤɨɪɨɫɬɢ ɪɨɫɬɚ, ɠɢɜɚɹ ɦɚɫɫɚ, ɤɨɬɨɪɚɹ ɹɜɥɹɟɬɫɹ ɨɞɧɢɦ ɢɡ
ɜɚɠɧɟɣɲɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɫɜɢɧɟɣ, ɭ ɜɫɟɯ ɝɪɭɩɩ ɡɧɚɱɢɬɟɥɶɧɨ ɨɬɥɢɱɚɥɚɫɶ.
ɉɨɤɚɡɚɬɟɥɢ ɪɨɫɬɚ ɩɨɞɫɜɢɧɤɨɜ ɜ ɩɟɪɢɨɞ ɞɨɪɚɳɢɜɚɧɢɹ ɩɪɟɞɫɬɚɜɥɟɧɵ ɬɚɛɥɢɰɟ 2.
Ɍɚɛɥɢɰɚ 2
ǫȘțȗȗȈ
ǷȖȒȈȏȈȚȍȓȤ
DzȖȕȚȘȖȓȤȕȈȧ
Ǵ±Ț
Cv,
%
Ǵ±Ț
Cv,
%
Ǵ±Ț
Cv,
%
Ǵ±Ț
Cv,
%
ǮȐȊȈȧ ȔȈșșȈ Ȋ 60 Ȍȕ,, Ȓȋ
32,0±0,2
6,2
26,5±0,2
6,1
37,4±0,2
5,0
26,1 ±0,2
5,1
ǮȐȊȈȧ ȔȈșșȈ ȖȗȣȚȈ ȕȈ 90 Ȍȕ., Ȓȋ
37,6±1,2
6,1
41,6±1,3
6,7
45,26±1,2
6,2
41,3±1,0
5,1
ǨȉșȖȓȦȚȕȣȑ ȗȘȐȘȖșȚ ȎȐȊȖȑ ȔȈșșȣ, Ȓȋ
5,6±1,0
6,2
15,1±1,1**
6,8
7,86±1,1**
6,5
15,2±0,9**
5,1
186,0±5,3
6,2
503,3±6,0
6,8
262,0±5,9**
6,5
507,0±4,7**
5,1
ǹȘȍȌȕȍșțȚȖȟȕȣȑ ȗȘȐȘȖșȚ, ȋ
*-Ɋ>0,95; **-Ɋ>0,99
ɉɨ ɚɛɫɨɥɸɬɧɨɦɭ ɩɪɢɪɨɫɬɭ ɠɢɜɨɣ ɦɚɫɫɵ ɥɢɞɟɪɨɦ ɹɜɥɹɥɢɫɶ ɩɨɞɫɜɢɧɤɢ ɬɪɟɬɶɟɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ. Ɉɧɢ ɧɚɛɪɚɥɢ ɛɨɥɶɲɟ ɦɚɫɫɵ, ɱɟɦ ɪɨɜɟɫɧɢɤɢ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɧɚ 9,6 ɤɝ (171,4 %) (Ɋ>0,99),
ɩɟɪɜɨɣ ɢ ɜɬɨɪɨɣ ɧɚ 0,1 ɤɝ (0,7 %) ɢ 7,34 ɤɝ (93,4 %). Ɍɚɤɠɟ ɫɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ ɪɟɡɭɥɶɬɚɬ ɚɛɫɨɥɸɬɧɨɝɨ
ɩɪɢɪɨɫɬɚ ɠɢɜɨɣ ɦɚɫɫɵ ɭ ɫɜɢɧɟɣ ɩɟɪɜɨɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ, ɤɨɬɨɪɵɣ ɪɚɜɧɹɥɫɹ 15,1 ɤɝ (Ɋ>0,99), ɱɬɨ
ɛɵɥɨ ɛɨɥɶɲɟ ɤɨɧɬɪɨɥɹ ɧɚ 9,5 ɤɝ ɢɥɢ 169,4 %. ȼɬɨɪɚɹ ɝɪɭɩɩɚ ɠɢɜɨɬɧɵɯ ɢɦɟɥɚ ɦɟɧɶɲɢɣ ɩɪɢɪɨɫɬ
ɫɪɟɞɢ ɨɩɵɬɧɵɯ ɝɪɭɩɩ – 7,86 ɤɝ (17,4 %).
ɉɨ ɫɪɟɞɧɟɫɭɬɨɱɧɵɦ ɩɪɢɜɟɫɚɦ ɠɢɜɨɣ ɦɚɫɫɵ ɬɪɟɬɶɹ ɝɪɭɩɩɚ ɫɜɢɧɟɣ ɩɨɤɚɡɚɥɚ ɪɟɡɭɥɶɬɚɬ ɜ 507,0 ɝ,
ɤɨɬɨɪɵɣ ɧɚ 321,0 ɝ (172,6 %) (Ɋ>0,99) ɛɨɥɶɲɟ, ɱɟɦ ɭ ɨɫɨɛɟɣ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ. ɀɢɜɨɬɧɵɟ ɜɬɨɪɨɣ ɝɪɭɩɩɵ ɡɚɤɨɧɱɢɥɢ ɫɨ ɫɪɟɞɧɢɦ ɪɟɡɭɥɶɬɚɬɨɦ 262,0 ɝ ɡɚ 30 ɞɧɟɣ ɨɬɤɨɪɦɚ, ɱɬɨ ɛɵɥɨ ɦɟɧɶɲɟ, ɱɟɦ
ɭ ɪɨɜɟɫɧɢɤɨɜ ɬɪɟɬɶɟɣ ɝɪɭɩɩɵ ɧɚ 245,0 ɝ (93,5 %), ɧɨ ɜɫɟ ɠɟ ɛɨɥɶɲɟ ɤɨɧɬɪɨɥɹ ɧɚ 76,0 ɝ (40,9 %)
(Ɋ>0,99). ɉɨɞɫɜɢɧɤɢ ɩɟɪɜɨɣ ɝɪɭɩɩɵ ɨɬɫɬɚɥɢ ɨɬ ɬɪɟɬɶɟɣ ɧɚ 4,0 ɝ (0,73 %), ɧɨ ɩɪɢ ɷɬɨɦ ɫɦɨɝɥɢ ɨɩɟɪɟɞɢɬɶ ɤɨɧɬɪɨɥɶ ɧɚ 317 ɝ (170,4 %).
Ɋɚɡɥɢɱɧɨɟ ɤɨɪɦɥɟɧɢɟ ɠɢɜɨɬɧɵɯ ɩɪɢ ɨɞɢɧɚɤɨɜɵɯ ɭɫɥɨɜɢɹɯ ɫɨɞɟɪɠɚɧɢɹ ɨɤɚɡɚɥɨ ɧɟɨɞɢɧɚɤɨɜɨɟ
ɜɥɢɹɧɢɟ ɧɚ ɢɯ ɫɨɯɪɚɧɧɨɫɬɶ. Ɍɚɤ, ɜ ɤɨɧɬɪɨɥɶɧɨɣ ɢ ɜɨ 2-ɣ ɢ 3-ɣ ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ, ɫɨɯɪɚɧɧɨɫɬɶ
ɫɨɫɬɚɜɢɥɚ 93,3 % ɢ 93,7 % , 86,0 % ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ. ɋɨɯɪɚɧɧɨɫɬɶ ɠɢɜɨɬɧɵɯ ɜ 1-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɨɤɚɡɚɥɚɫɶ ɧɚ ɭɪɨɜɧɟ 100 %. ȼɵɛɵɬɢɟ ɩɨɪɨɫɹɬ ɜɨ ɜɬɨɪɨɣ ɝɪɭɩɩɟ ɩɪɨɢɡɨɲɥɨ ɜ ɬɟɱɟɧɢɟ ɩɟɪɜɨɣ
ɧɟɞɟɥɢ, ɩɪɢɱɢɧɨɣ ɛɵɥ ɬɪɚɜɦɚɬɢɡɦ, ɚ ɜ 3-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɟ ɩɨ ɩɪɢɱɢɧɟ ɬɪɚɜɦɚɬɢɡɦɚ ɜɵɛɵɥɨ 2
ɝɨɥɨɜɵ ɧɚ ɜɬɨɪɨɣ ɧɟɞɟɥɟ ɨɩɵɬɚ. ȼ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɬɚɤɠɟ ɜ ɪɟɡɭɥɶɬɚɬɟ ɦɟɯɚɧɢɱɟɫɤɨɣ ɬɪɚɜɦɵ
ɜɵɧɭɠɞɟɧɧɨ ɭɛɢɬɨ 1 ɠɢɜɨɬɧɨɟ. ȼɨ ɜɫɟɯ ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ ɧɟ ɧɚɛɥɸɞɚɥɢɫɶ ɤɥɢɧɢɱɟɫɤɢɟ ɩɪɢɡɧɚɤɢ
ɝɚɫɬɪɨɷɧɬɟɪɢɬɨɜ ɢ ɛɪɨɧɯɨɩɧɟɜɦɨɧɢɢ. ȼ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɩɪɨɰɟɧɬ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ ɝɚɫɬɪɨɷɧɬɟɪɢɬɨɦ, ɫɨɫɬɚɜɢɥ 80 % (12 ɝɨɥ), ɱɬɨ ɩɨɫɥɭɠɢɥɨ ɫɧɢɠɟɧɢɟɦ ɩɪɨɞɭɤɬɢɜɧɵɯ ɩɨɤɚɡɚɬɟɥɟɣ.
272
ȼɵɜɨɞɵ
Ʌɢɞɟɪɨɦ ɩɨ ɫɪɟɞɧɟɫɭɬɨɱɧɨɦɭ ɩɪɢɜɟɫɭ 507,0 ɝ ɹɜɥɹɥɢɫɶ ɠɢɜɨɬɧɵɟ ɬɪɟɬɶɟɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ, ɫɨ
ɫɪɟɞɧɟɣ ɦɚɫɫɨɣ ɜ 41,3 ɤɝ ɩɪɨɬɢɜ 37,6 ɤɝ ɭ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ, ɬ. ɟ ɧɚ 3,7 ɤɝ ɢɥɢ 9,8 % ɛɨɥɶɲɟ. Ɉɬ
ɩɟɪɜɨɣ ɢ ɜɬɨɪɨɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ, ɧɚ 90 ɞɟɧɶ ɩɨɥɭɱɢɥɢ ɫɪɟɞɧɟɫɭɬɨɱɧɵɣ ɩɪɢɜɟɫ ɧɚ 1 ɝɨɥ. 503,3 ɝ ɢ
262 ɝ, ɨɬɪɵɜ ɫɨɫɬɚɜɢɥ 3,7 ɝ ɢ 245 ɝ ɢɥɢ 0,73 % ɢ 51,7 %. Ɋɚɡɧɢɰɚ ɭ ɫɜɢɧɟɣ ɩɟɪɜɨɣ ɢ ɜɬɨɪɨɣ ɝɪɭɩɩɵ
ɫ ɤɨɧɬɪɨɥɟɦ ɫɨɫɬɚɜɢɥɚ 317 ɝ (170,4 %) ɢ 76 ɝ (40,9 %) ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ. ȼ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɟ ɩɪɨɰɟɧɬ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ ɝɚɫɬɪɨɷɧɬɟɪɢɬɨɦ, ɫɨɫɬɚɜɢɥ 80 %, ɱɬɨ ɩɨɫɥɭɠɢɥɨ ɫɧɢɠɟɧɢɟɦ ɩɪɨɞɭɤɬɢɜɧɵɯ
ɩɨɤɚɡɚɬɟɥɟɣ. ȼɨ ɜɫɟɯ ɨɩɵɬɧɵɯ ɝɪɭɩɩɚɯ ɧɟ ɛɵɥɨ ɜɵɹɜɥɟɧɨ ɤɥɢɧɢɱɟɫɤɢɯ ɫɥɭɱɚɟɜ ɝɚɫɬɪɨɷɧɬɟɪɢɬɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
ɋɬɟɩɭɲɢɧ Ⱥ.ȿ. ɉɪɨɮɢɥɚɤɬɢɤɚ ɦɢɤɨɬɨɤɫɢɤɨɡɨɜ / Ⱥ.ȿ.ɋɬɟɩɭɲɢɧ. – Ɇ.: Ʉɨɥɨɫ, 1998.-69 ɫ.
ɋɦɢɪɧɨɜɚ ɂ.Ɋ. ɋɨɜɪɟɦɟɧɧɨɟ ɫɨɫɬɨɹɧɢɟ ɤɚɱɟɫɬɜɚ ɢ ɛɟɡɨɩɚɫɧɨɫɬɢ ɤɨɪɦɨɜ ɜ Ɋɨɫɫɢɢ / ɂ.Ɋ.Ʌɭɤɢɧ,
Ⱥ.ȼ.Ɇɢɯɚɥɟɜ // ȼɟɬɟɪɢɧɚɪɢɹ. – 2009. – ʋ2. – ɫ 3-5.
ɑɭɥɤɨɜ Ⱥ.Ʉ. Ɉ ɩɪɨɮɢɥɚɤɬɢɤɟ ɦɢɤɨɬɨɤɫɢɤɨɡɨɜ ɠɢɜɨɬɧɵɯ /Ⱥ.Ʉ.ɑɭɥɤɨɜ, Ɇ. ə. Ɍɪɟɦɚɫɨɜ, Ⱥ.ȼ.ɂɜɚɧɨɜ //
ȼɟɬɟɪɢɧɚɪɢɹ. – 2007. – ʋ12. – ɫ 8–9.
ɍȾɄ 619:616:636.2
ɉɈɄȺɁȺɌȿɅɂ ȼȿɌȿɊɂɇȺɊɇɈ-ɋȺɇɂɌȺɊɇɈɃ ɗɄɋɉȿɊɌɂɁɕ
ɆəɋȺ ɂ ɆɈɅɈɄȺ ɂɇɎɂɐɂɊɈȼȺɇɇɕɏ ȼɅɄɊɋ ɂ ȻɈɅɖɇɕɏ
ɅȿɃɄɈɁɈɆ ɀɂȼɈɌɇɕɏ
ɏɊȺɆɐɈȼ ȼ.ȼ., ȾȼɈȿȽɅȺɁɈȼ ɇ.Ƚ., ȺȽȺɊɄɈȼȺ Ɍ.Ⱥ., ɈɋɂɉɈȼȺ ɇ.Ⱥ., ɆȺȽȿɊ C.ɇ.,
ɎȽȻɇɍ «ɂɧɫɬɢɬɭɬ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɣ ɜɟɬɟɪɢɧɚɪɢɢ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɝɨ ȼɨɫɬɨɤɚ»,
ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɣɫɤɚɹ Ɏɟɞɟɪɚɰɢɹ
ȼ ɫɬɚɬɶɟ ɩɪɟɞɫɬɚɜɥɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɨɰɟɧɤɢ ɦɨɥɨɤɚ ɢ ɦɹɫɚ ɨɬ ɢɧɮɢɰɢɪɨɜɚɧɧɨɝɨ ɢ ɛɨɥɶɧɨɝɨ ɥɟɣɤɨɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. Ⱦɚɧɧɵɟ ɩɨ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɦ, ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɦ ɢ ɮɢɡɢɤɨɯɢɦɢɱɟɫɤɢɦ ɩɨɤɚɡɚɬɟɥɹɦ, ɩɨɞɬɜɟɪɠɞɚɸɬ ɨɬɥɢɱɢɟ ɩɨ ɤɚɱɟɫɬɜɭ ɩɪɨɞɭɤɰɢɢ ɨɬ ɠɢɜɨɬɧɵɯ ɫ ɪɚɡɧɨɣ
ɫɬɟɩɟɧɶɸ ɤɨɦɩɪɨɦɟɬɚɰɢɢ ɤ ɥɟɣɤɨɡɭ. ɉɨ ɪɹɞɭ ɩɨɤɚɡɚɬɟɥɟɣ ɦɨɥɨɤɨ ɢ ɦɹɫɨ ɨɬ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ ɠɢɜɨɬɧɵɯ ɫɨɩɨɫɬɚɜɢɦɨ ɫ ɩɨɞɨɛɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ ɧɢɡɤɨɝɨ ɤɚɱɟɫɬɜɚ ɢɥɢ ɹɜɥɹɸɳɢɦɢɫɹ ɧɟɫɜɟɠɢɦɢ.
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: ȼɅɄɊɋ-ɢɧɮɟɤɰɢɹ, ɥɟɣɤɨɡ ɄɊɋ, ɷɤɫɩɟɪɬɢɡɚ ɦɹɫɚ ɢ ɦɨɥɨɤɚ, ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ
ɩɨɤɚɡɚɬɟɥɢ.
ȼɜɟɞɟɧɢɟ
Ʌɟɣɤɨɡɵ ɢ ɞɪɭɝɢɟ ɡɥɨɤɚɱɟɫɬɜɟɧɧɵɟ ɡɚɛɨɥɟɜɚɧɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɜ ɧɚɫɬɨɹɳɟɟ
ɜɪɟɦɹ ɨɞɧɚ ɢɡ ɧɚɢɛɨɥɟɟ ɨɫɬɪɵɯ ɨɛɳɟɛɢɨɥɨɝɢɱɟɫɤɢɯ ɢ ɫɨɰɢɚɥɶɧɵɯ ɩɪɨɛɥɟɦ. Ʉɪɭɩɧɵɣ ɪɨɝɚɬɵɣ ɫɤɨɬ,
ɩɨɞɜɟɪɠɟɧɧɵɣ ɢɧɮɟɤɰɢɨɧɧɵɦ ɡɥɨɤɚɱɟɫɬɜɟɧɧɵɦ ɛɨɥɟɡɧɹɦ, ɢɫɬɨɱɧɢɤ ɧɚɢɛɨɥɟɟ ɰɟɧɧɵɯ ɩɪɨɞɭɤɬɨɜ
ɩɢɬɚɧɢɹ – ɦɨɥɨɤɚ ɢ ɦɹɫɚ. ɋɪɟɞɫɬɜɚ ɢ ɦɟɬɨɞɵ ɥɟɱɟɧɢɹ ɞɚɧɧɨɝɨ ɡɚɛɨɥɟɜɚɧɢɹ ɧɟ ɪɚɡɪɚɛɨɬɚɧɵ ɧɢ ɜ
ɨɞɧɨɣ ɫɬɪɚɧɟ ɦɢɪɚ. Ɉɛɟɫɩɟɱɟɧɢɟ ɛɟɡɨɩɚɫɧɨɫɬɢ ɢ ɤɚɱɟɫɬɜɚ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ ɢ ɩɢɳɟɜɵɯ
ɩɪɨɞɭɤɬɨɜ, ɹɜɥɹɟɬɫɹ ɧɟɨɛɯɨɞɢɦɵɦ ɭɫɥɨɜɢɟɦ, ɨɩɪɟɞɟɥɹɸɳɢɦ ɡɞɨɪɨɜɶɟ ɧɚɫɟɥɟɧɢɹ ɢ ɫɨɯɪɚɧɟɧɢɹ ɟɝɨ
ɝɟɧɨɮɨɧɞɚ. ɉɨɷɬɨɦɭ ɩɨɜɵɲɟɧɢɟ ɫɚɧɢɬɚɪɧɨɝɨ ɤɚɱɟɫɬɜɚ, ɩɢɳɟɜɨɣ ɢ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɩɨɥɧɨɰɟɧɧɨɫɬɢ
ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ, ɢɯ ɛɟɡɨɩɚɫɧɨɫɬɢ, ɢɦɟɸɬ ɛɨɥɶɲɨɟ ɫɨɰɢɚɥɶɧɨɟ ɡɧɚɱɟɧɢɟ [1–5].
ȼɚɠɧɵɦ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɦ ɮɚɤɬɨɪɨɦ ɜ ɪɟɲɟɧɢɢ ɷɬɢɯ ɩɪɨɛɥɟɦ, ɹɜɥɹɟɬɫɹ ɧɚɭɱɧɨ ɨɛɨɫɧɨɜɚɧɧɚɹ
ɥɚɛɨɪɚɬɨɪɧɚɹ ɷɤɫɩɟɪɬɢɡɚ ɦɨɥɨɤɚ ɢ ɦɹɫɚ ɠɢɜɨɬɧɵɯ.
ɐɟɥɶ ɢɫɫɥɟɞɨɜɚɧɢɣ: ɩɪɨɜɟɫɬɢ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɭɸ, ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɭɸ ɢ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɭɸ
ɷɤɫɩɟɪɬɢɡɭ ɦɨɥɨɤɚ ɢ ɦɹɫɚ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ ɢ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ ɠɢɜɨɬɧɵɯ.
Ɇɚɬɟɪɢɚɥɵ ɢ ɦɟɬɨɞɵ ɢɫɫɥɟɞɨɜɚɧɢɣ.
Ɉɛɴɟɤɬ ɢ ɩɪɟɞɦɟɬ ɢɫɫɥɟɞɨɜɚɧɢɣ – ɢɧɬɚɤɬɧɵɣ ɤɥɢɧɢɱɟɫɤɢ ɡɞɨɪɨɜɵɣ, ɫɩɨɧɬɚɧɧɨ ɢɧɮɢɰɢɪɨɜɚɧɧɵɣ ɜɢɪɭɫɨɦ ɥɟɣɤɨɡɚ (ȼɅɄɊɋ) ɢ ɛɨɥɶɧɨɣ ɥɟɣɤɨɡɨɦ ɤɪɭɩɧɵɣ ɪɨɝɚɬɵɣ ɫɤɨɬ, ɚ ɬɚɤɠɟ ɦɨɥɨɤɨ ɢ ɦɹɫɨ,
ɩɨɥɭɱɟɧɧɵɟ ɨɬ ɷɬɢɯ ɠɢɜɨɬɧɵɯ.
ɂɫɫɥɟɞɨɜɚɧɢɹ ɦɨɥɨɤɚ ɩɪɨɜɨɞɢɥɢ ɫɨɝɥɚɫɧɨ ȽɈɋɌ 13264–88 «Ɍɪɟɛɨɜɚɧɢɹ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ
ɫɬɚɧɞɚɪɬɚ ɧɚ ɦɨɥɨɤɨ ɤɨɪɨɜɶɟ, ɡɚɝɨɬɨɜɥɹɟɦɨɟ ɜ ɯɨɡɹɣɫɬɜɚɯ» (Ɇ.,1988).
ɂɫɫɥɟɞɨɜɚɧɢɹ ɦɹɫɚ ɢ ɨɪɝɚɧɨɜ ɭɛɨɣɧɨɝɨ ɫɤɨɬɚ ɩɪɨɜɨɞɢɥɢ ɫɨɝɥɚɫɧɨ «ɉɪɚɜɢɥɚɦ ɜɟɬɟɪɢɧɚɪɧɨɝɨ
ɨɫɦɨɬɪɚ ɭɛɨɣɧɵɯ ɠɢɜɨɬɧɵɯ ɢ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɨɣ ɷɤɫɩɟɪɬɢɡɵ ɦɹɫɚ ɢ ɦɹɫɧɵɯ ɩɪɨɞɭɤɬɨɜ»
(Ɇ., 1988) ɢ ȽɈɋɌ 7269 -79 «Ɇɹɫɨ. Ɇɟɬɨɞɵ ɨɬɛɨɪɚ ɨɛɪɚɡɰɨɜ ɢ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ ɦɟɬɨɞɵ ɨɩɪɟɞɟɥɟɧɢɹ ɫɜɟɠɟɫɬɢ».
273
Ɇɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɜɨɞɢɥɢ ɩɨ ȽɈɋɌ 21237- 75 «Ɇɹɫɨ. Ɇɟɬɨɞɵ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɨɝɨ ɚɧɚɥɢɡɚ, ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ» (ɪɇ ɦɹɫɚ, ɚɤɬɢɜɧɨɫɬɶ ɩɟɪɨɤɫɢɞɚɡɵ ɢ
ɧɚɥɢɱɢɹ ɩɟɪɜɢɱɧɨɝɨ ɪɚɫɩɚɞɚ ɛɟɥɤɨɜ) – ɩɨ ȽɈɋɌ 23392 -78 . «Ɇɹɫɨ. Ɇɟɬɨɞɵ ɯɢɦɢɱɟɫɤɨɝɨ ɢ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɨɝɨ ɚɧɚɥɢɡɚ ɫɜɟɠɟɫɬɢ ɦɹɫɚ», ɚ ɬɚɤɠɟ ɫɨɝɥɚɫɧɨ « ɉɪɚɜɢɥɚɦ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɨɫɦɨɬɪɚ
ɭɛɨɣɧɵɯ ɠɢɜɨɬɧɵɯ ɢ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɨɣ ɷɤɫɩɟɪɬɢɡɵ ɦɹɫɚ ɢ ɦɹɫɨɩɪɨɞɭɤɬɨɜ» (Ɇ., 1988).
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢ ɢɯ ɨɛɫɭɠɞɟɧɢɟ.
Ɉɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɦɹɫɚ. Ⱦɥɹ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɛɵɥɢ ɜɡɹɬɵ ɩɪɨɛɵ ɦɹɫɚ, ɡɞɨɪɨɜɨɝɨ, ɢɧɮɢɰɢɪɨɜɚɧɧɨɝɨ ɢ ɛɨɥɶɧɨɝɨ ɥɟɣɤɨɡɨɦ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. ɂɫɫɥɟɞɨɜɚɧɢɹ
ɩɨɤɚɡɚɥɢ, ɱɬɨ ɩɨ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɦ ɩɨɤɚɡɚɬɟɥɹɦ ɦɹɫɨ ɨɬ ɠɢɜɨɬɧɵɯ ɜ ɫɬɚɞɢɢ ɛɟɫɫɢɦɩɬɨɦɧɨɣ ɢɧɮɟɤɰɢɢ ɧɟ ɨɬɥɢɱɚɟɬɫɹ ɨɬ ɦɹɫɚ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ ɡɞɨɪɨɜɨɝɨ ɫɤɨɬɚ ɬɨɣ ɠɟ ɤɚɬɟɝɨɪɢɢ ɭɩɢɬɚɧɧɨɫɬɢ.
Ɉɞɧɚɤɨ ɦɹɫɧɵɟ ɬɭɲɢ, ɩɨɥɭɱɟɧɧɵɟ ɨɬ ɠɢɜɨɬɧɵɯ, ɭɛɢɬɵɯ ɜ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɚɞɢɢ ɛɨɥɟɡɧɢ, ɞɚɠɟ
ɩɪɢ ɤɪɚɬɤɨɜɪɟɦɟɧɧɨɦ ɯɪɚɧɟɧɢɢ (2–3 ɫɭɬɨɤ) ɢɦɟɥɢ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ ɩɪɢɡɧɚɤɢ, ɯɚɪɚɤɬɟɪɧɵɟ ɞɥɹ
ɦɹɫɚ ɫɨɦɧɢɬɟɥɶɧɨɣ ɫɜɟɠɟɫɬɢ ɢɥɢ ɧɟɫɜɟɠɟɝɨ. ɉɪɢɱɟɦ ɛɵɫɬɪɨɬɚ ɢ ɫɬɟɩɟɧɶ ɩɨɪɱɢ, ɧɚɯɨɞɢɬɫɹ ɜ ɩɪɹɦɨɣ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɬɚɞɢɢ ɥɟɣɤɨɡɧɨɝɨ ɩɪɨɰɟɫɫɚ.
Ɏɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɦɹɫɚ. ɂɫɫɥɟɞɨɜɚɧɢɹɦɢ ɜɵɹɜɥɟɧɵ ɨɬɥɢɱɢɹ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɯ
ɩɨɤɚɡɚɬɟɥɟɣ ɦɹɫɚ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ, ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɦɹɫɨɦ, ɩɨɥɭɱɟɧɧɵɦ ɨɬ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ.
ɍɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɪɇ ɫ ɭɜɟɥɢɱɟɧɢɟɦ ɫɪɨɤɨɜ ɯɪɚɧɟɧɢɹ ɦɹɫɚ ɠɢɜɨɬɧɵɯ, ɭɛɢɬɵɯ ɜ ɫɬɚɞɢɢ ɢɧɮɟɤɰɢɢ ɢ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɚɞɢɢ ɱɟɪɟɡ 48 ɱɚɫɨɜ ɯɪɚɧɟɧɢɹ ɞɨɫɬɢɝɚɟɬ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 5,9 ɢ 6,4. ɑɟɪɟɡ
96 ɱɚɫɨɜ ɩɪɨɢɫɯɨɞɢɬ ɭɜɟɥɢɱɟɧɢɟ ɪɇ ɞɨ 6,1; 6,5. (ɬɚɛɥ.1). ɉɨɤɚɡɚɬɟɥɢ ɦɹɫɚ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ
ɨɫɬɚɜɚɥɢɫɶ ɧɚ ɭɪɨɜɧɟ 5,9 ɜ ɬɟɱɟɧɢɟ 96 ɱɚɫɨɜ. Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɩɪɢ ɢɫɫɥɟɞɨɜɚɧɢɢ ɦɹɫɚ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ ɠɢɜɨɬɧɵɯ ɪɚɡɧɢɰɚ ɜ ɪɇ ɜ ɫɨɩɨɫɬɚɜɥɟɧɢɢ ɫ ɤɨɧɬɪɨɥɟɦ ɜɵɹɜɥɹɟɬɫɹ
ɱɟɪɟɡ 96 ɱɚɫɨɜ.
Ɍɚɤɭɸ ɠɟ ɡɚɤɨɧɨɦɟɪɧɨɫɬɶ ɧɚɛɥɸɞɚɥɢ ɩɪɢ ɨɩɪɟɞɟɥɟɧɢɢ ɤɨɥɢɱɟɫɬɜɚ ɥɟɬɭɱɢɯ ɠɢɪɧɵɯ ɤɢɫɥɨɬ. ɂɯ
ɡɧɚɱɟɧɢɹ ɜɨɡɪɚɫɬɚɥɢ ɫ ɭɜɟɥɢɱɟɧɢɟɦ ɫɪɨɤɨɜ ɯɪɚɧɟɧɢɹ ɢ ɤɨɥɢɱɟɫɬɜɨɦ ɝɢɞɪɨɨɤɫɢɞɚ ɤɚɥɢɹ ɜ ɛɢɨɦɚɬɟɪɢɚɥɟ.
ɉɨɤɚɡɚɬɟɥɢ ɜ ɦɹɫɟ ɨɬ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɚɞɢɢ ɛɨɥɟɡɧɢ, ɩɨɫɥɟ ɯɪɚɧɟɧɢɹ ɟɝɨ ɜ ɬɟɱɟɧɢɟ 96 ɱɚɫɨɜ ɫ ɦɨɦɟɧɬɚ ɭɛɨɹ ɜ ɨɯɥɚɠɞɟɧɧɨɦ ɫɨɫɬɨɹɧɢɢ, ɞɨɫɬɢɝɚɥɢ ɦɚɤɫɢɦɚɥɶɧɨɝɨ
ɡɧɚɱɟɧɢɹ – 3,8; (ɜ ɤɨɧɬɪɨɥɶɧɨɦ ɨɛɪɚɡɰɟ – 2,8).
Ɍɚɛɥɢɰɚ 1
Ɋɟɡɭɥɶɬɚɬɵ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɦɹɫɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ɫ ɪɚɡɧɨɣ ɫɬɟɩɟɧɶɸ ɤɨɦɩɪɨɦɟɬɚɰɢɢ ɤ ɥɟɣɤɨɡɭ
Ƚɪɭɩɩɚ ɠɢɜɨɬɧɵɯ
ɉɨɤɚɡɚɬɟɥɶ
(ɧɨɪɦɚ)
Ɂɞɨɪɨɜɵɟ
n = 18
Ɇ±m
ɂɧɮɢɰɢɪɨɜɚɧɧɵɟ
n = 18
Ɇ±m
ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ
ɛɨɥɶɧɵɟ
n = 18
Ɇ±m
ɱɟɪɟɡ 48 ɱɚɫɨɜ
ɪɇ (5,7–6,2)
Ɋɟɚɤɰɢɹ ɧɚ ɩɟɪɨɤɫɢɞɚɡɭ (ɛɟɧɡɢɞɢɧɨɜɚɹ ɩɪɨɛɚ)
ɉɪɨɛɚ ɫ ɫɟɪɧɨ-ɤɢɫɥɨɣ ɦɟɞɶɸ
5,9±0,04
5,9±0,06
2,8
5,9±0,04
ɱɟɪɟɡ 96 ɱɚɫɨɜ
6,1±0,03
+
3,7
6,4±0,05
6,5±0,04
+
3,8
ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ ɪɟɚɤɰɢɢ ɧɚ ɩɟɪɨɤɫɢɞɚɡɭ ɢ ɮɨɪɦɨɥɶɧɭɸ ɩɪɨɛɭ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɩɪɢ ɯɪɚɧɟɧɢɢ
ɦɹɫɚ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɛɨɥɶɧɨɝɨ ɥɟɣɤɨɡɨɦ, ɩɪɢɡɧɚɤɢ ɩɨɪɱɢ ɚɛɫɨɥɸɬɧɨ
ɫɨɨɬɜɟɬɫɬɜɭɸɬ ɬɚɤɨɜɵɦ, ɭɫɬɚɧɨɜɥɟɧɧɵɦ ɭ ɠɢɜɨɬɧɵɯ ɜ ɫɬɚɞɢɢ ɢɧɮɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ (ɜɢɪɭɫɨɧɨɫɢɬɟɥɶɫɬɜɚ).
Ȼɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɦɹɫɚ. Ɇɢɤɪɨɫɤɨɩɢɱɟɫɤɨɦɭ ɢɫɫɥɟɞɨɜɚɧɢɸ ɩɨɞɜɟɪɝɧɭɬɵ ɛɢɨɦɚɬɟɪɢɚɥ (ɜɧɭɬɪɟɧɧɢɟ ɨɪɝɚɧɵ) ɨɬ 18 ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ ɤɨɪɨɜ, 18 ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ ɠɢɜɨɬɧɵɯ, ɢ 18 ɢɧɬɚɤɬɧɵɯ ɠɢɜɨɬɧɵɯ ɢɡ ɛɥɚɝɨɩɨɥɭɱɧɵɯ ɫɟɥɶɯɨɡɩɪɟɞɩɪɢɹɬɢɣ, ɤɨɬɨɪɵɟ ɩɨɫɥɭɠɢɥɢ
ɤɨɧɬɪɨɥɟɦ.
ɉɟɪɟɞ ɜɡɹɬɢɟɦ ɦɚɬɟɪɢɚɥɚ ɠɢɜɨɬɧɵɯ ɢɫɫɥɟɞɨɜɚɥɢ ɤɥɢɧɢɤɨ-ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ, ɚ ɩɨɫɥɟ ɭɛɨɹ ɩɨɞɜɟɪɝɚɥɢ ɩɚɬɨɥɨɝɨɚɧɚɬɨɦɢɱɟɫɤɨɦɭ ɜɫɤɪɵɬɢɸ ɢ ɢɫɫɥɟɞɨɜɚɧɢɸ.
Ɉɬ ɤɚɠɞɨɝɨ ɠɢɜɨɬɧɨɝɨ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢ ɢɫɫɥɟɞɨɜɚɥɢ ɩɪɨɛɵ (ɤɭɫɨɱɤɢ) ɥɟɝɤɢɯ, ɫɟɥɟɡɟɧɤɢ,
ɩɨɱɤɢ, ɫɟɪɞɰɚ, ɩɟɱɟɧɢ, ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɭɡɥɨɜ.
Ȼɵɥɨ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɦɢɤɪɨɛɧɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɢ ɩɚɪɟɧɯɢɦɚɬɨɡɧɵɯ ɨɪɝɚɧɨɜ ɭɛɢɬɨɝɨ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɧɚɯɨɞɢɬɫɹ ɜ ɩɪɹɦɨɣ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɬɚɞɢɢ ɪɚɡɜɢɬɢɹ ɥɟɣɤɨɡɚ
274
(ɬɚɛɥ. 2). ɇɚ ɪɚɧɧɟɣ ɫɬɚɞɢɢ ɢɧɮɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ (ɛɟɫɫɢɦɩɬɨɦɧɚɹ ɫɬɚɞɢɹ) ɦɢɤɪɨɛɧɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ ɦɵɲɰ ɢ ɩɚɪɟɧɯɢɦɚɬɨɡɧɵɯ ɨɪɝɚɧɨɜ ɛɵɥɚ ɧɟɫɤɨɥɶɤɨ ɜɵɲɟ, ɱɟɦ ɭ ɤɨɧɬɪɨɥɶɧɵɯ ɨɛɪɚɡɰɨɜ.
ɉɪɢ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɤɭɥɶɬɭɪ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ, ɜɵɞɟɥɟɧɧɵɯ ɢɡ ɨɩɵɬɧɵɯ ɨɛɪɚɡɰɨɜ ɦɵɲɟɱɧɨɣ
ɬɤɚɧɢ ɢ ɩɚɪɟɧɯɢɦɚɬɨɡɧɵɯ ɨɪɝɚɧɨɜ ɠɢɜɨɬɧɵɯ, ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɜɢɪɭɫɨɦ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɢ ɤɨɧɬɪɨɥɶɧɵɯ ɩɪɨɛ, ɛɵɥɨ ɭɫɬɚɧɨɜɥɟɧɨ: ɛɚɤɬɟɪɢɢ ɪɨɞɚ Ɋroteus ɨɛɧɚɪɭɠɟɧɵ ɜ ɨɞɧɨɦ
ɫɥɭɱɚɟ ɜ ɩɟɱɟɧɢ, ɢ ɜ ɞɪɭɝɨɦ ɫɥɭɱɚɟ ɜ ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɭɡɥɚɯ ɠɢɜɨɬɧɵɯ.
Ɍɚɛɥɢɰɚ 2
Ɋɟɡɭɥɶɬɚɬɵ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɦɹɫɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ɫ ɪɚɡɧɨɣ ɫɬɟɩɟɧɶɸ ɤɨɦɩɪɨɦɟɬɚɰɢɢ ɤ ɥɟɣɤɨɡɭ
ɉɨɤɚɡɚɬɟɥɶ
ɧɨɪɦɵ
Ȼɚɤɬɟɪɢɨɫɤɨɩɢɹ
Ƚɪɭɩɩɚ ɠɢɜɨɬɧɵɯ
ɢɧɮɢɰɢɪɨɜɚɧɧɵɟ ɩ= 18
ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ ɛɨɥɶɧɵɟ ɩ= 18
ȼ ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɭɡɥɚɯ, ɫɟɥɟɡɟɧɤɟ ɫɚɥɶɦɨɩ =2 ɜ ɥɢɦɮɚɬɢɱɟɫ- ȼ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɢ ɩɚɪɟɧ- ɧɟɥɥɵ, ɫɬɚɮɢɥɨɤɨɤɤɢ, ɜ ɦɚɡɤɚɯ – ɨɬɩɟɱɚɬɤɚɯ
Ƚɪ (+); Ƚɪ (-) ɩɚɥɨɱɤɢ ɢ ɤɨɤɤɢ.
ɤɢɯ ɭɡɥɚɯ – ȿ.ɫɨli,
ɯɢɦɚɬɨɡɧɵɯ ɨɪɝɚɧɚɯ ɩ=1
ɤɨɤɤɨɜɵɟ ɦɢɤɪɨɨɪɝɚ- ɛɚɤɬɟɪɢɹ ɉɪɨɬɟɭɫ, ɤɨɤɤɨɜɵɟ ɩ =4 ȿ.ɫɨli ɢɡ ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɭɡɥɨɜ, ɩɟɱɟɧɢ;
ɧɢɡɦɵ
ɦɢɤɪɨɨɪɝɚɧɢɡɦɵ
ɩ=3 –ɛɚɤɬɟɪɢɹ ɪɨɞɚ ɉɪɨɬɟɭɫ (ɩɟɱɟɧɶ, ɩɨɱɤɢ)
ɢ ɤɨɤɤɨɜɵɟ ɦɢɤɪɨɨɪɝɚɧɢɡɦɵ.
ɡɞɨɪɨɜɵɟ ɩ= 18
ȼ ɤɨɧɬɪɨɥɶɧɵɯ ɨɛɪɚɡɰɚɯ ɛɵɥɚ ɜɵɞɟɥɟɧɚ ȿ.ɫɨli. Ʉɪɨɦɟ ɜɵɲɟɧɚɡɜɚɧɧɵɯ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ, ɜ
ɨɩɵɬɧɵɯ ɢ ɤɨɧɬɪɨɥɶɧɵɯ ɨɛɪɚɡɰɚɯ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɢ ɨɪɝɚɧɨɜ ɨɛɧɚɪɭɠɟɧɵ ɤɨɤɤɨɜɵɟ ɦɢɤɪɨɨɪɝɚɧɢɡɦɵ.
ɉɪɢ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɨɦ ɢɫɫɥɟɞɨɜɚɧɢɢ ɩɚɪɟɧɯɢɦɚɬɨɡɧɵɯ ɨɪɝɚɧɨɜ ɢ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɭɛɨɣɧɨɝɨ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ, ɛɨɥɶɧɨɝɨ ɥɟɣɤɨɡɨɦ ɩɪɢ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɤɭɥɶɬɭɪ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ,
ɜɵɞɟɥɟɧɧɵɯ ɢɡ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɢ ɜɧɭɬɪɟɧɧɢɯ ɨɪɝɚɧɨɜ, ɛɵɥɢ ɨɛɧɚɪɭɠɟɧɵ ɫɥɟɞɭɸɳɢɟ ɦɢɤɪɨɨɪɝɚɧɢɡɦɵ: ȿ. ɫɨli ɜ ɱɟɬɵɪɟɯ ɫɥɭɱɚɹɯ ɛɵɥɚ ɜɵɞɟɥɟɧɚ ɢɡ ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɭɡɥɨɜ ɢ ɩɟɱɟɧɢ; ɜ ɬɪɟɯ ɫɥɭɱɚɹɯ – ɛɚɤɬɟɪɢɹ ɪɨɞɚ Ɋroteus (ɩɟɱɟɧɶ, ɩɨɱɤɢ) ɢ ɤɨɤɤɨɜɵɟ ɦɢɤɪɨɨɪɝɚɧɢɡɦɵ. Ʉɪɨɦɟ ɩɚɬɨɝɟɧɧɵɯ ɢ
ɭɫɥɨɜɧɨ-ɩɚɬɨɝɟɧɧɵɯ, ɛɵɥɢ ɜɵɞɟɥɟɧɵ ɤɨɤɤɨɜɵɟ ɮɨɪɦɵ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɩɨ ɪɟɡɭɥɶɬɚɬɚɦ ɛɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɧɚɢɛɨɥɶɲɭɸ ɦɢɤɪɨɛɧɭɸ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ ɨɛɪɚɡɰɨɜ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɢ ɜɧɭɬɪɟɧɧɢɯ ɨɪɝɚɧɨɜ ɧɚɛɥɸɞɚɥɢ ɭ
ɠɢɜɨɬɧɵɯ ɜ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɚɞɢɢ ɥɟɣɤɨɡɚ.
ɉɨ ɱɚɫɬɨɬɟ ɨɛɧɚɪɭɠɟɧɢɹ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ ɜ ɨɪɝɚɧɚɯ ɢ ɬɤɚɧɹɯ ɧɚ ɩɟɪɜɨɦ ɦɟɫɬɟ ɫɬɨɹɬ ɥɢɦɮɚɬɢɱɟɫɤɢɟ ɭɡɥɵ (60 %), ɡɚɬɟɦ ɩɟɱɟɧɶ (50 %), ɩɨɱɤɢ (35 %) ɢ ɦɵɲɟɱɧɚɹ ɬɤɚɧɶ (27 %).
Ɉɪɝɚɧɨɥɟɬɢɱɟɫɤɨɟ ɢɫɫɥɟɞɨɜɚɧɢɟ ɦɨɥɨɤɚ. Ⱦɥɹ ɨɰɟɧɤɢ ɤɚɱɟɫɬɜɟɧɧɨɣ ɯɚɪɚɤɬɟɪɢɫɬɢɤɢ ɦɨɥɨɤɚ, ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɨɦɭ ɢɫɫɥɟɞɨɜɚɧɢɸ ɛɵɥɨ ɩɨɞɜɟɪɝɧɭɬɨ 18 ɩɪɨɛ, ɩɨɥɭɱɟɧɧɵɯ ɨɬ ɡɞɨɪɨɜɵɯ (ɤɨɧɬɪɨɥɶ),
ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ȼɅɄɊɋ ɢ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ (ɨɩɵɬ) ɤɨɪɨɜ ɨɞɧɨɝɨ ɜɨɡɪɚɫɬɚ, ɩɨɪɨɞɧɨɣ ɩɪɢɧɚɞɥɟɠɧɨɫɬɢ, ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɢ ɪɚɜɧɵɯ ɭɫɥɨɜɢɣ ɤɨɪɦɥɟɧɢɹ, ɫɨɞɟɪɠɚɧɢɹ ɢ ɷɤɫɩɥɭɚɬɚɰɢɢ.
ɉɨɥɭɱɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɩɨ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɦ ɯɚɪɚɤɬɟɪɢɫɬɢɤɚɦ
ɦɨɥɨɤɨ ɠɢɜɨɬɧɵɯ ɜ ɫɬɚɞɢɢ ɛɟɫɫɢɦɩɬɨɦɧɨɣ ɢɧɮɟɤɰɢɢ ɜɢɪɭɫɚ ɥɟɣɤɨɡɚ ɧɟ ɨɬɥɢɱɚɟɬɫɹ ɨɬ ɦɨɥɨɤɚ,
ɡɞɨɪɨɜɵɯ ɤɨɪɨɜ (ɪɚɡɧɢɰɚ ɧɟ ɞɨɫɬɨɜɟɪɧɚ).
Ɏɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɦɨɥɨɤɚ. ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɛɵɥɨ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɭ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ ɠɢɜɨɬɧɵɯ, ɤɨɥɢɱɟɫɬɜɨ ɠɢɪɚ ɜ ɦɨɥɨɤɟ ɭɜɟɥɢɱɢɥɨɫɶ ɨɬ 3,6 ɞɨ 4,1 %, ɫɨɞɟɪɠɚɧɢɟ ɛɟɥɤɚ – ɭɦɟɧɶɲɢɥɨɫɶ ɧɚ 1,82 %, ɚ
ɬɢɬɪɭɟɦɚɹ ɤɢɫɥɨɬɧɨɫɬɶ ɩɨɧɢɠɚɥɚɫɶ ɧɚ 0,8–3,8 ºɌ (ɬɚɛɥ. 3).
Ɍɚɛɥɢɰɚ 3
Ɋɟɡɭɥɶɬɚɬɵ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɦɨɥɨɤɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɫ ɪɚɡɧɨɣ ɫɬɟɩɟɧɶɸ ɤɨɦɩɪɨɦɟɬɚɰɢɢ ɤ ɥɟɣɤɨɡɭ
ɉɨɤɚɡɚɬɟɥɶ ɧɨɪɦɵ
1.Ʉɢɫɥɨɬɧɨɫɬɶ (16- 20º Ɍ)
2. ɀɢɪɧɨɫɬɶ (3,5 -3,7 %)
3.ɋɬɟɩɟɧɶ ɱɢɫɬɨɬɵ ɩɨ ɷɬɚɥɨɧɭ (1–2 ɤɥɚɫɫɚ)
4.ɉɥɨɬɧɨɫɬɶ ɦɨɥɨɤɚ (1,027–1,033 ɝ/ ɫɦ³)
5.ɋɨɞɟɪɠɚɧɢɟ ɛɟɥɤɚ ɜ ɦɨɥɨɤɟ (3,26 %)
ɡɞɨɪɨɜɵɟ (ɩ=18)
16 – 18º Ɍ
3.5 -3,7 %
1 ɢ 2 ɤɥɚɫɫɚ
1,027ɝ\ɫɦ³
3,26 %
Ƚɪɭɩɩɚ ɠɢɜɨɬɧɵɯ
ɢɧɮɢɰɢɪɨɜɚɧɧɵɟ
(ɩ = 18)
15,2 – 15,6º Ɍ
4,1 %
1 ɢ 2 ɤɥɚɫɫɚ
1,033ɝ\ɫɦ³
1,54 %
ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ
ɛɨɥɶɧɵɟ (ɩ =18)
15,2 – 15,6º Ɍ
4,2 %
1 ɢ 2 ɤɥɚɫɫɚ
1,032ɝ\ɫɦ³
1,54 %
Ɇɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɦɨɥɨɤɚ. ɉɪɢ ɩɪɨɜɟɞɟɧɢɢ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɢɡɦɟɧɟɧɢɹ ɧɚɛɥɸɞɚɥɢ ɬɨɥɶɤɨ ɩɨ ɛɚɤɬɟɪɢɚɥɶɧɨɣ ɨɛɫɟɦɟɧɟɧɧɨɫɬɢ ɦɨɥɨɤɚ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ ɛɨɥɶɧɵɯ
ɥɟɣɤɨɡɨɦ ɤɨɪɨɜ, ɤɨɬɨɪɚɹ ɛɵɥɚ ɜɵɲɟ, ɱɟɦ ɜ ɩɪɨɞɭɤɬɟ, ɩɨɥɭɱɟɧɧɨɦ ɨɬ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɡɞɨɪɨɜɵɯ
ɠɢɜɨɬɧɵɯ. Ⱦɚɧɧɵɟ ɩɪɟɞɫɬɚɜɥɟɧɵ ɜ ɬɚɛɥɢɰɟ 4.
275
Ɍɚɛɥɢɰɚ 4
Ɋɟɡɭɥɶɬɚɬɵ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɦɨɥɨɤɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
ɫ ɪɚɡɧɨɣ ɫɬɟɩɟɧɶɸ ɤɨɦɩɪɨɦɟɬɚɰɢɢ ɤ ɥɟɣɤɨɡɭ
ɉɨɤɚɡɚɬɟɥɶ ɧɨɪɦɵ
1.Ȼɚɤɬɟɪɢɚɥɶɧɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ,
ɬɵɫ./ɫɦ³, (ɧɟ ɛɨɥɟɟ 300 – 500)
2. ɋɨɞɟɪɠɚɧɢɟ ɫɨɦɚɬɢɱɟɫɤɢɯ ɤɥɟɬɨɤ,
ɬɵɫ./ɫɦ³, (ɧɟ ɛɨɥɟɟ 500 -1000)
ɡɞɨɪɨɜɵɟ
(ɩ =18)
Ƚɪɭɩɩɚ ɠɢɜɨɬɧɵɯ
ɢɧɮɢɰɢɪɨɜɚɧɧɵɟ
(ɩ = 18)
ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ
ɛɨɥɶɧɵɟ(ɩ =18)
300- 500
300 -500
500–1000
500–1000
1000
1000
ȼɵɜɨɞɵ
1. Ɉɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɩɪɨɛ ɦɹɫɚ ɠɢɜɨɬɧɵɯ ɜ ɫɬɚɞɢɢ ɛɟɫɫɢɦɩɬɨɦɧɨɣ ɢɧɮɟɤɰɢɢ ɧɟ
ɨɬɥɢɱɚɸɬɫɹ ɨɬ ɩɨɤɚɡɚɬɟɥɟɣ ɡɞɨɪɨɜɵɯ, ɬɨɣ ɠɟ ɤɚɬɟɝɨɪɢɢ ɭɩɢɬɚɧɧɨɫɬɢ. Ɇɹɫɧɵɟ ɬɭɲɢ, ɩɨɥɭɱɟɧɧɵɟ
ɨɬ ɠɢɜɨɬɧɵɯ, ɭɛɢɬɵɯ ɜ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɚɞɢɢ ɛɨɥɟɡɧɢ, ɞɚɠɟ ɩɪɢ ɤɪɚɬɤɨɜɪɟɦɟɧɧɨɦ ɯɪɚɧɟɧɢɢ
(2–3 ɫɭɬɨɤ) ɢɦɟɸɬ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ ɩɪɢɡɧɚɤɢ, ɯɚɪɚɤɬɟɪɧɵɟ ɞɥɹ ɦɹɫɚ ɫɨɦɧɢɬɟɥɶɧɨɣ ɫɜɟɠɟɫɬɢ
ɢɥɢ ɧɟ ɫɜɟɠɟɝɨ. Ȼɵɫɬɪɨɬɚ ɢ ɫɬɟɩɟɧɶ ɩɨɪɱɢ ɧɚɯɨɞɹɬɫɹ ɜ ɩɪɹɦɨɣ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɬɚɞɢɢ ɥɟɣɤɨɡɧɨɝɨ
ɩɪɨɰɟɫɫɚ.
2. ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɪɇ ɫ ɭɜɟɥɢɱɟɧɢɟɦ ɫɪɨɤɨɜ ɯɪɚɧɟɧɢɹ ɦɹɫɚ
ɭ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ ɛɨɥɶɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɟɜɵɲɚɟɬ ɩɨɤɚɡɚɬɟɥɢ ɧɨɪɦɵ ɱɟɪɟɡ 96 ɱɚɫɨɜ ɢ ɫɨɫɬɚɜɥɹɟɬ
6,5. Ɍɨɝɞɚ ɤɚɤ ɪɇ ɜ ɩɪɨɛɚɯ ɦɹɫɚ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɡɞɨɪɨɜɵɯ ɠɢɜɨɬɧɵɯ, ɨɫɬɚɟɬɫɹ ɜ ɩɪɟɞɟɥɚɯ ɞɨɩɭɫɬɢɦɨɣ ɧɨɪɦɵ.
3. Ȼɚɤɬɟɪɢɨɥɨɝɢɱɟɫɤɢɦɢ ɢɫɫɥɟɞɨɜɚɧɢɹɦɢ ɭɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɧɚɢɛɨɥɶɲɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ ɦɵɲɟɱɧɨɣ ɬɤɚɧɢ ɢ ɜɧɭɬɪɟɧɧɢɯ ɨɪɝɚɧɨɜ ɧɚɛɥɸɞɚɟɬɫɹ ɭ ɠɢɜɨɬɧɵɯ ɜ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɣ ɫɬɚɞɢɢ ɛɨɥɟɡɧɢ.
ɑɚɫɬɨɬɚ ɨɛɧɚɪɭɠɟɧɢɹ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ ɜ ɨɪɝɚɧɚɯ ɢ ɬɤɚɧɹɯ, ɪɟɝɢɫɬɪɢɪɭɟɬɫɹ ɜ ɫɨɨɬɧɨɲɟɧɢɢ: ɥɢɦɮɚɬɢɱɟɫɤɢɟ ɭɡɥɵ – 60 %, ɩɟɱɟɧɶ – 50 %, ɩɨɱɤɢ – 35 % ɢ ɦɵɲɟɱɧɚɹ ɬɤɚɧɶ – 27 %.
4. Ɉɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɦɨɥɨɤɚ ɠɢɜɨɬɧɵɯ ɜ ɫɬɚɞɢɢ ɛɟɫɫɢɦɩɬɨɦɧɨɣ ɢɧɮɟɤɰɢɢ ɫɨɩɨɫɬɚɜɢɦɵ ɫ ɬɚɤɨɜɵɦɢ ɭ ɡɞɨɪɨɜɵɯ. ɍ ɤɨɪɨɜ, ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ ɛɨɥɶɧɵɯ ɥɟɣɤɨɡɨɦ,
ɤɨɥɢɱɟɫɬɜɨ ɠɢɪɚ ɜ ɦɨɥɨɤɟ ɩɨɜɵɲɟɧɨ ɞɨ 4,1 ɢ 4,2 %, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ; ɛɟɥɤɚ – ɩɨɧɢɠɟɧɨ ɞɨ 1,54 %;
ɬɢɬɪɭɟɦɚɹ ɤɢɫɥɨɬɧɨɫɬɶ ɭɦɟɧɶɲɟɧɚ ɧɚ 0,8–3,8°Ɍ. Ȼɚɤɬɟɪɢɚɥɶɧɚɹ ɨɛɫɟɦɟɧɟɧɧɨɫɬɶ ɦɨɥɨɤɚ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɢ ɛɨɥɶɧɵɯ ɤɨɪɨɜ ɜɵɲɟ, ɱɟɦ ɢɧɮɢɰɢɪɨɜɚɧɧɵɯ ɢ ɡɞɨɪɨɜɵɯ ɢ ɩɪɟɜɵɲɚɟɬ 500–1000 ɬɵɫ./ɫɦ³.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
Ⱥɦɢɪɨɤɨɜ Ɇ.Ⱥ. ɗɩɢɡɨɨɬɨɥɨɝɢɱɟɫɤɢɣ ɢ ɢɦɦɭɧɨɛɢɨɯɢɦɢɱɟɫɤɢɣ ɚɫɩɟɤɬɵ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ: ɚɜɬɨɪɟɮ. ɞɢɫ. …ɤɚɧɞ. ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ. / Ɇ.Ⱥ. Ⱥɦɢɪɨɤɨɜ // Ȼɚɪɧɚɭɥ, 2001.-25ɫ.
Ⱦɨɧɧɢɤ, ɂ.Ɇ. ɍɬɢɥɢɡɚɰɢɹ ɬɭɲ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɩɨ ɩɪɢɱɢɧɟ ɥɟɣɤɨɡɚ / ɂ.Ɇ. Ⱦɨɧɧɢɤ, ȿ.ɇ. Ʉɨɪɫɚɤɨɜɚ, ȼ.Ɇ. Ɇɟɥɶɧɢɤɨɜɚ // Ⱥɤɬɭɚɥɶɧɵɟ ɜɨɩɪɨɫɵ ɞɢɚɝɧɨɫɬɢɤɢ, ɩɪɨɮɢɥɚɤɬɢɤɢ ɢ ɛɨɪɶɛɵ ɫ ɥɟɣɤɨɡɚɦɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɢ ɩɬɢɰ: Ɇɚɬ. ȼɫɟɫɨɸɡ. ɤɨɧɮ. ɤ 65-ɥɟɬɢɸ ɋɜɟɪɞɥ. ɇɂȼɋ. – ȿɤɚɬɟɪɢɧɛɭɪɝ,
2000. – ɋ. 121–127.
ɇɚɯɦɚɧɫɨɧ, ȼ.Ɇ. Ɂɧɚɱɢɦɨɫɬɶ ɤɨɦɩɥɟɤɫɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɜ ɫɢɫɬɟɦɟ ɩɪɨɬɢɜɨɥɟɣɤɨɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ /
ȼ.Ɇ. ɇɚɯɦɚɧɫɨɧ // ɗɩɢɡɨɨɬɨɥɨɝɢɹ, ɞɢɚɝɧɨɫɬɢɤɚ, ɩɪɨɮɢɥɚɤɬɢɤɚ ɢ ɦɟɪɵ ɛɨɪɶɛɵ ɫ ɛɨɥɟɡɧɹɦɢ ɠɢɜɨɬɧɵɯ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1997. – ɋ. 95–96.
ɋɦɢɪɧɨɜ, ɘ.ɉ. Ɋɚɡɜɢɬɢɟ ɥɟɣɤɨɡɧɨɝɨ ɩɪɨɰɟɫɫɚ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɪɟɞɵ ɨɛɢɬɚɧɢɹ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ
ɫɤɨɬɚ / ɘ.ɉ. ɋɦɢɪɧɨɜ // Ⱥɝɪɚɪ. ɧɚɭɤɚ. – 1998. – ʋ1.-ɋ. 18–19.
ɏɪɚɦɰɨɜ ȼ.ȼ. Ɋɚɫɩɪɨɫɬɪɚɧɟɧɢɟ, ɩɚɬɨɝɟɧɟɬɢɱɟɫɤɚɹ ɯɚɪɚɤɬɟɪɢɫɬɢɤɚ ɥɟɣɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɢ
ɫɢɫɬɟɦɚ ɩɪɨɬɢɜɨɥɟɣɤɨɡɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɜ ɋɢɛɢɪɢ: ɞɢɫ. …ɞ-ɪɚ ɜɟɬɟɪɢɧɚɪ. ɧɚɭɤ / ȼ.ȼ. ɏɪɚɦɰɨɜ // ɇɨɜɨɫɢɛɢɪɫɤ, 1995.– 289 ɫ.
1.
2.
3.
4.
5.
ɍȾɄ: 636.619:615.1.4.
ɌȿɊȺɉȿȼɌɂɑȿɋɄȺə ɗɎɎȿɄɌɂȼɇɈɋɌɖ «ɎȺɊɆɋɆȿɋɂ 2»
ɉɊɂ ȺɄɌɂɇɈɆɂɄɈɁȿ ɄɊɍɉɇɈȽɈ ɊɈȽȺɌɈȽɈ ɋɄɈɌȺ
ɒȺɇɖɒɂɇ ɇ.ȼ., ȿȼɋȿȿȼȺ Ɍ.ɉ.,
ȼɫɟɪɨɫɫɢɣɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ,
ɝ. Ȼɚɪɧɚɭɥ ɊɎ. wniipo@rambler.ru
Ⱥɤɬɢɧɨɦɢɤɨɡ – ɯɪɨɧɢɱɟɫɤɨɟ ɢɧɮɟɤɰɢɨɧɧɨɟ ɡɚɛɨɥɟɜɚɧɢɟ, ɜɨɡɛɭɞɢɬɟɥɶ ɥɭɱɢɫɬɵɣ ɝɪɢɛɨɤ –
Actinomyces bovis, ɲɢɪɨɤɨ ɪɚɫɩɪɨɫɬɪɚɧɟɧɧɵɣ ɜ ɩɪɢɪɨɞɟ, ɫɚɩɪɨɮɢɬ. Ɉɛɢɬɚɟɬ ɧɚ ɪɚɡɧɵɯ ɪɚɫɬɟɧɢɹɯ
276
ɢ ɡɥɚɤɚɯ. ȼ ɨɪɝɚɧɢɡɦ ɩɚɬɨɝɟɧɧɵɟ ɝɪɢɛɵ ɩɪɨɧɢɤɚɸɬ ɱɟɪɟɡ ɫɥɢɡɢɫɬɵɟ ɨɛɨɥɨɱɤɢ ɪɨɬɨɜɨɣ ɩɨɥɨɫɬɢ
ɩɪɢ ɩɨɜɪɟɠɞɟɧɢɢ ɢɯ ɡɥɚɤɨɜɵɦɢ ɪɚɫɬɟɧɢɹɦɢ (ɨɫɬɹɦɢ, ɦɹɤɢɧɨɣ, ɫɨɥɨɦɨɣ ɢ ɞɪ) ɢ ɝɪɭɛɵɦɢ ɱɚɫɬɢɰɚɦɢ ɡɟɪɟɧ, ɚ ɬɚɤɠɟ ɱɟɪɟɡ ɪɚɡɥɢɱɧɵɟ ɤɨɠɧɵɟ ɪɚɧɵ, ɫɫɚɞɢɧɵ, ɰɚɪɚɩɢɧɵ. ɑɚɳɟ ɩɨɪɚɠɚɸɬɫɹ ɬɤɚɧɢ ɜ
ɨɛɥɚɫɬɢ ɝɨɥɨɜɵ. ɇɚ ɦɟɫɬɟ ɜɧɟɞɪɟɧɢɹ ɜɨɡɛɭɞɢɬɟɥɹ ɪɚɡɜɢɜɚɟɬɫɹ ɜɨɫɩɚɥɢɬɟɥɶɧɵɣ ɩɪɨɰɟɫɫ ɫ ɮɨɪɦɢɪɨɜɚɧɢɟɦ ɢɧɮɟɤɰɢɨɧɧɨɣ ɝɪɚɧɭɥɟɦɵ – ɚɤɬɢɧɨɦɢɤɨɦɵ. Ɂɪɟɥɚɹ ɝɪɚɧɭɥɟɦɚ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɝɧɨɣɧɵɣ ɮɨɤɭɫ ɫ ɞɪɭɡɚɦɢ ɝɪɢɛɚ. Ƚɪɢɮɵ ɝɪɢɛɚ, ɩɪɨɧɢɤɚɹ ɩɨ ɦɟɠɤɥɟɬɨɱɧɵɦ ɯɨɞɚɦ ɜ ɫɨɫɟɞɧɢɟ ɬɤɚɧɢ,
ɨɛɪɚɡɭɸɬ ɧɨɜɵɟ ɞɨɱɟɪɧɢɟ ɝɪɚɧɭɥɟɦɵ, ɤɨɬɨɪɵɟ ɦɨɝɭɬ ɫɥɢɜɚɬɶɫɹ ɜ ɛɨɥɟɟ ɤɪɭɩɧɵɟ.
Ɉɧɢ ɩɪɨɝɪɟɫɫɢɜɧɨ ɭɜɟɥɢɱɢɜɚɸɬɫɹ, ɨɛɪɚɡɭɹ ɝɧɨɣɧɵɣ ɮɨɤɭɫ, ɤɨɬɨɪɵɣ ɡɚɬɟɦ ɪɚɡɦɹɝɱɚɟɬɫɹ
ɫ ɨɛɪɚɡɨɜɚɧɢɟɦ ɫɦɟɬɚɧɨɨɛɪɚɡɧɨɝɨ ɠɟɥɬɨɜɚɬɨɝɨ ɝɧɨɹ. Ƚɧɨɣɧɵɟ ɦɚɫɫɵ (ɜ ɩɨɫɥɟɞɫɬɜɢɢ ɫɬɚɧɨɜɹɬɫɹ ɤɪɨɜɹɧɢɫɬɵɦɢ) ɨɬɬɨɪɝɚɸɬɫɹ ɜɦɟɫɬɟ ɫ ɪɚɫɩɥɚɜɥɟɧɧɵɦɢ ɬɤɚɧɹɦɢ ɩɨ ɫɜɢɳɟɜɵɦ ɯɨɞɚɦ.
ɉɨɫɥɟɞɧɢɟ ɢɧɨɝɞɚ ɡɚɠɢɜɚɸɬ ɫ ɨɛɪɚɡɨɜɚɧɢɟɦ ɝɪɚɧɭɥɹɰɢɨɧɧɨɣ ɬɤɚɧɢ ɜ ɜɢɞɟ ɰɜɟɬɧɨɣ ɤɚɩɭɫɬɵ,
ɜɵɩɹɱɢɜɚɸɳɟɣɫɹ ɧɚɪɭɠɭ. ɉɪɢ ɩɨɜɪɟɠɞɟɧɢɢ ɤɨɫɬɟɣ (ɜɟɪɯɧɟɣ ɢ ɧɢɠɧɟɣ ɱɟɥɸɫɬɢ) ɨɛɪɚɡɭɸɬɫɹ
ɧɟɩɨɞɜɢɠɧɵɟ ɭɬɨɥɳɟɧɢɹ. [1]
Ⱥɤɬɢɧɨɦɢɤɨɦɵ, ɩɨɹɜɥɹɸɳɢɟɫɹ ɜ ɨɛɥɚɫɬɢ ɝɨɥɨɜɵ ɢ ɝɨɪɬɚɧɢ ɪɚɡɪɚɫɬɚɸɬɫɹ, ɨɛɵɱɧɨ ɧɚɪɭɲɚɸɬ
ɚɤɬ ɞɵɯɚɧɢɹ ɢ ɝɥɨɬɚɧɢɹ, ɩɪɢ ɷɬɨɦ ɧɚɪɭɲɚɟɬɫɹ ɩɪɢɟɦ ɤɨɪɦɚ ɢ ɚɩɩɟɬɢɬ, ɠɢɜɨɬɧɵɟ ɯɭɞɟɸɬ. ȿɫɥɢ ɝɪɢɛɵ ɩɪɨɧɢɤɚɸɬ ɜ ɤɪɨɜɟɧɨɫɧɵɟ ɫɨɫɭɞɵ, ɬɨ ɩɪɨɢɫɯɨɞɢɬ ɝɟɧɟɪɚɥɢɡɚɰɢɹ ɩɪɨɰɟɫɫɚ ɢ ɦɨɝɭɬ ɜɨɡɧɢɤɧɭɬɶ
ɦɟɬɚɫɬɚɡɵ ɜ ɩɟɱɟɧɢ, ɩɨɱɤɚɯ, ɥɟɝɤɢɯ ɢ ɞɪɭɝɢɯ ɨɪɝɚɧɚɯ. Ȼɟɡ ɥɟɱɟɧɢɹ ɛɨɥɶɧɵɟ ɠɢɜɨɬɧɵɟ ɜɵɡɞɨɪɚɜɥɢɜɚɸɬ ɪɟɞɤɨ.
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɬɟɪɚɩɟɜɬɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɧɚ ɪɚɧɧɢɯ ɫɬɚɞɢɹɯ ɬɟɱɟɧɢɹ ɛɨɥɟɡɧɢ ɞɚɟɬ
ɯɨɪɨɲɢɣ ɩɨɥɨɠɢɬɟɥɶɧɵɣ ɪɟɡɭɥɶɬɚɬ, ɫɨɯɪɚɧɹɟɬɫɹ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶ ɠɢɜɨɬɧɵɯ. [2]
Ɇɚɬɟɪɢɚɥɵ ɢ ɦɟɬɨɞɵ ɢɫɫɥɟɞɨɜɚɧɢɣ
ɇɚɦɢ ɪɚɡɪɚɛɨɬɚɧɨ ɢ ɡɚɩɚɬɟɧɬɨɜɚɧɨ «Ʌɟɤɚɪɫɬɜɟɧɧɨɟ ɫɪɟɞɫɬɜɨ ɞɥɹ ɥɟɱɟɧɢɹ ɚɤɬɢɧɨɦɢɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ» – «Ɏɚɪɦɫɦɟɫɶ 2» – ɩɚɬɟɧɬ ɊɎ ʋ2297839 ɨɬ 27 ɚɩɪɟɥɹ 2007 ɝɨɞɚ, ɫɨɞɟɪɠɚɳɟɟ
ɜ ɫɜɨɟɦ ɫɨɫɬɚɜɟ ɣɨɞ ɤɪɢɫɬɚɥɥɢɱɟɫɤɢɣ, ɤɚɥɢɣ ɣɨɞɢɫɬɵɣ ɧɚ ɨɫɧɨɜɟ ɚɤɬɢɜɧɨɝɨ ɪɚɫɬɜɨɪɚ ɝɢɩɨɯɥɨɪɢɬɚ
ɧɚɬɪɢɹ. Ⱦɥɹ ɥɟɱɟɧɢɹ ɚɤɬɢɧɨɦɢɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɮɚɪɦɫɦɟɫɶ 2 ɪɟɤɨɦɟɧɞɭɟɦ ɢɫɩɨɥɶɡɨɜɚɬɶ ɩɨ ɨɞɧɨɣ ɢɡ ɫɯɟɦ, ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɦɟɫɬɚ ɥɨɤɚɥɢɡɚɰɢɢ ɨɱɚɝɚ ɚɤɬɢɧɨɦɢɤɨɦɵ. ɉɪɢ ɩɨɪɚɠɟɧɢɢ
ɝɨɪɬɚɧɢ, ɹɡɵɤɚ, ɨɛɥɚɫɬɢ ɡɚɞɧɟɣ ɧɟɛɧɨɣ ɡɚɧɚɜɟɫɤɢ, ɜɧɭɬɪɟɧɧɢɯ ɨɪɝɚɧɨɜ ɥɟɱɢɥɢ ɩɨ ɫɯɟɦɟ ʋ1:
- ɮɚɪɦɫɦɟɫɶ 2 ɧɚɡɧɚɱɚɥɢ ɜɧɭɬɪɢɜɟɧɧɨ 200–250 ɦɥ ɨɞɢɧ ɪɚɡ ɜ ɫɭɬɤɢ, ɩɨɜɬɨɪɧɨ ɱɟɪɟɡ ɞɜɚ ɞɧɹ,
ɬɪɟɯɤɪɚɬɧɨ. ɋɬɪɟɩɬɨɦɢɰɢɧ ɢɥɢ ɞɪɭɝɢɟ ɚɧɬɢɛɢɨɬɢɤɢ ɲɢɪɨɤɨɝɨ ɫɩɟɤɬɪɚ ɞɟɣɫɬɜɢɹ ɨɞɢɧ ɪɚɡ ɜ ɫɭɬɤɢ
ɱɟɪɟɡ ɞɜɚ ɞɧɹ 5-6 ɪɚɡ.
Ⱥɤɬɢɧɨɦɢɤɨɦɵ, ɥɨɤɚɥɢɡɭɸɳɢɟɫɹ ɧɚ ɱɟɥɸɫɬɹɯ, ɲɟɟ, ɩɨɞɱɟɥɸɫɬɧɨɦ ɩɪɨɫɬɪɚɧɫɬɜɟ ɫ ɩɨɪɚɠɟɧɢɟɦ ɛɥɢɡɶɥɟɠɚɳɢɯ ɥɢɦɮɚɬɢɱɟɫɤɢɯ ɭɡɥɨɜ ɢ ɤɨɫɬɧɨɣ ɬɤɚɧɢ ɫɯɟɦɚ ʋ2:
- ɮɚɪɦɫɦɟɫɶɸ 2 ɨɛɤɚɥɵɜɚɥɢ ɨɱɚɝ ɚɤɬɢɧɨɦɢɤɨɦɵ (ɩɨ ɜɨɡɦɨɠɧɨɫɬɢ ɜɜɟɫɬɢ ɪɚɫɬɜɨɪ ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨ ɜ ɝɪɚɧɭɥɨɦɚɬɨɡɧɭɸ ɬɤɚɧɶ) ɨɞɢɧ ɪɚɡ ɜ ɫɭɬɤɢ, ɩɨɜɬɨɪɧɨ ɱɟɪɟɡ ɞɜɚ ɞɧɹ, 4-5 ɪɚɡ, ɱɟɪɟɞɭɹ ɫ
ɚɧɬɢɛɢɨɬɢɤɚɦɢ ɲɢɪɨɤɨɝɨ ɫɩɟɤɬɪɚ ɞɟɣɫɬɜɢɹ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢ ɢɯ ɨɛɫɭɠɞɟɧɢɹ
Ɋɟɡɭɥɶɬɚɬɵ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɮɚɪɦɫɦɟɫɢ 2 ɩɪɢ ɥɟɱɟɧɢɢ ɚɤɬɢɧɨɦɢɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ
ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɬɹɠɟɫɬɢ ɬɟɱɟɧɢɹ ɛɨɥɟɡɧɢ ɩɪɟɞɫɬɚɜɥɟɧɵ ɜ ɬɚɛɥɢɰɟ 1.
Ɍɚɛɥɢɰɚ 1
ɗɮɮɟɤɬɢɜɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɮɚɪɦɫɦɟɫɢ 2 ɩɪɢ ɥɟɱɟɧɢɢ ɚɤɬɢɧɨɦɢɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ
Ƚɨɞɵ
Ɏɨɪɦɚ ɬɟɱɟɧɢɹ
ɚɤɬɢɧɨɦɢɤɨɡɚ
2004–2005
Ɂɚɛɨɥɟɥɨ,
ɝɨɥ
ɥɟɝɤɚɹ
ɬɹɠɟɥɚɹ
25
96
ɥɟɝɤɚɹ
ɬɹɠɟɥɚɹ
93
ɥɟɝɤɚɹ
ɬɹɠɟɥɚɹ
5
3
ɋɪɟɞɧɟɟ ɩɨ
ɞɜɭɦ ɮɨɪɦɚɦ
ɬɟɱɟɧɢɹ
-
ȼɵɡɞɨɪɨɜɟɥɨ %
2011–2012
Ɂɚɛɨɥɟɥɨ,
ɝɨɥ
ȼɵɡɞɨɪɨɜɟɥɨ %
2014–2015
Ɂɚɛɨɥɟɥɨ,
ɝɨɥ
ɩ/ɫ «Ɍɪɨɢɰɤɢɣ» Ɍɪɨɢɰɤɨɝɨ ɪɚɣɨɧɚ
96,0
62,5
ɈɈɈ ȺɄɏ «Ⱥɧɭɣɫɤɨɟ» ɉɟɬɪɨɩɚɜɥɨɜɫɤɨɝɨ ɪɚɣɨɧɚ
187
85,0
29
62,4
79
65,8
18
Ʌɢɱɧɵɟ ɩɨɞɜɨɪɧɵɟ ɯɨɡɹɣɫɬɜɚ
100,0
3
100,0
3
100,0
1
100,0
2
84,2
-
87,7
ȼɵɡɞɨɪɨɜɟɥɨ %
ȼ ɫɪɟɞɧɟɦ %
ɜɵɡɞɨɪɨɜɥɟɧɢɟ
-
96,0
62,5
86,2
66,7
85,6
65,0
100,0
100,0
100,0
100,0
88,2
84,8
277
Ɉɫɨɛɨ ɫɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɥɟɱɟɧɢɟ ɚɤɬɢɧɨɦɢɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɧɚ ɪɚɧɧɢɯ ɷɬɚɩɚɯ ɪɚɡɜɢɬɢɹ ɛɨɥɟɡɧɢ, ɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɨ, ɞɨɫɬɚɬɨɱɧɨ ɞɜɭɯ, ɬɪɟɯ ɜɜɟɞɟɧɢɣ ɮɚɪɦɫɦɟɫɢ 2 ɜ ɨɱɚɝ
ɚɤɬɢɧɨɦɢɤɨɦɵ ɩɪɢ ɷɬɨɦ ɩɪɨɢɫɯɨɞɢɬ ɤɭɩɢɪɨɜɚɧɢɟ ɢɥɢ ɜɫɤɪɵɬɢɟ (ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɪɚɡɦɟɪɚ ɨɱɚɝɚ)
ɩɨɪɚɠɟɧɧɨɝɨ ɭɱɚɫɬɤɚ, ɜ ɞɚɥɶɧɟɣɲɟɦ ɩɪɨɰɟɫɫ ɥɟɱɟɧɢɹ ɜɟɞɟɬɫɹ ɤɚɤ ɪɜɚɧɨɣ ɪɚɧɵ, ɩɪɢ ɷɬɨɦ ɫɧɢɠɚɸɬɫɹ ɬɪɭɞɨɡɚɬɪɚɬɵ, ɪɚɫɯɨɞ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɫɪɟɞɫɬɜ ɢ ɜɪɟɦɹ ɧɚ ɜɵɡɞɨɪɨɜɥɟɧɢɟ. Ɍɟɪɚɩɟɜɬɢɱɟɫɤɚɹ
ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɜ ɞɚɧɧɨɦ ɫɥɭɱɚɟ ɞɨɫɬɢɝɚɟɬ ɞɨ 100 %. ȼ ɱɚɫɬɧɵɯ ɩɨɞɜɨɪɶɹɯ ɞɚɠɟ ɩɪɢ ɡɚɬɹɧɭɜɲɟɦɫɹ
(ɡɚɩɭɳɟɧɧɨɦ) ɚɤɬɢɧɨɦɢɤɨɡɟ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɫɬɨɩɪɨɰɟɧɬɧɨɟ ɜɵɡɞɨɪɨɜɥɟɧɢɟ ɨɛɴɹɫɧɹɟɬɫɹ
ɬɟɦ, ɱɬɨ ɜ ɢɧɞɢɜɢɞɭɚɥɶɧɵɯ ɩɨɞɜɨɪɶɹɯ ɠɢɜɨɬɧɵɟ ɫɨɞɟɪɠɚɬɫɹ ɜ ɥɭɱɲɢɯ ɭɫɥɨɜɢɹɯ ɢ ɩɨɞɛɢɪɚɟɬɫɹ
ɢɧɞɢɜɢɞɭɚɥɶɧɵɣ ɪɚɰɢɨɧ ɤɨɪɦɥɟɧɢɹ ɜ ɤɚɠɞɨɦ ɤɨɧɤɪɟɬɧɨɦ ɫɥɭɱɚɟ.
Ɂɚɤɥɸɱɟɧɢɟ
Ɍɟɪɚɩɟɜɬɢɱɟɫɤɢɣ ɷɮɮɟɤɬ ɩɪɢ ɢɫɩɨɥɶɡɨɜɚɧɢɢ «Ʌɟɤɚɪɫɬɜɟɧɧɨɝɨ ɫɪɟɞɫɬɜɚ ɞɥɹ ɥɟɱɟɧɢɹ ɚɤɬɢɧɨɦɢɤɨɡɚ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ» – «Ɏɚɪɦɫɦɟɫɶ 2» ɞɨɫɬɢɝɚɟɬɫɹ ɜ ɫɪɟɞɧɟɦ ɜ 84,8 % ɫɥɭɱɚɹɯ, ɭ ɠɢɜɨɬɧɵɯ ɫ
ɧɚɱɚɥɶɧɨɣ ɫɬɚɞɢɟɣ ɬɟɱɟɧɢɹ ɛɨɥɟɡɧɢ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɨɬ 85,0 ɞɨ 100,0 %, ɩɪɢ ɡɚɩɭɳɟɧɧɨɣ (ɬɹɠɟɥɨɣ)
ɮɨɪɦɟ ɬɟɱɟɧɢɹ ɚɤɬɢɧɨɦɢɤɨɡɧɨɝɨ ɩɪɨɰɟɫɫɚ ɥɟɱɟɛɧɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɫɨɫɬɚɜɥɹɟɬ ɨɬ 62,4-66,7 %.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
ɒɢɲɤɨɜ ȼ.ɉ., ɀɚɪɨɜ Ⱥ.ȼ., ɇɚɥɟɬɨɜ ɇ.Ⱥ. ɉɚɬɚɥɨɝɨɚɧɚɬɨɦɢɱɟɫɤɚɹ ɞɢɚɝɧɨɫɬɢɤɚ ɛɨɥɟɡɧɟɣ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. Ɇ:. Ⱥɝɪɨɩɪɨɦɢɡɞɚɬ, 1987.
ɒɚɧɶɲɢɧ ɇ.ȼ., ȿɜɫɟɟɜɚ Ɍ.ɉ. Ɏɚɪɦɫɦɟɫɶ ɩɪɢ ɚɤɬɢɧɨɦɢɤɨɡɟ ɭ ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ. ɉɪɨɛɥɟɦɵ
ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ ɢ ɩɭɬɢ ɢɯ ɪɟɲɟɧɢɹ: ɋɛɨɪɧɢɤ ɧɚɭɱɧɵɯ ɬɪɭɞɨɜ/ɊȺɋɏɇ, ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ.
ȼɇɂɂɉɈ. Ȼɚɪɧɚɭɥ, 2005. ɋ 282–284.
1.
2.
ɍȾɄ 636. 087. 72: 636.6
ɗɊɂɌɊɈɐɂɌȺɊɇɕȿ ɂɇȾȿɄɋɕ ɄɊɈȼɂ ȽɍɋȿɃ
ɂ ɉȿɊȿɉȿɅɈȼ ɉɊɂ ȼȼȿȾȿɇɂɂ ȼ ɋɈɋɌȺȼ ɊȺɐɂɈɇȺ
ɆɂɄɊɈȾɈȻȺȼɈɄ ɋȿɅȿɇȺ ɂ ɃɈȾȺ
ɒȿȼɑȿɇɄɈ Ⱥ.ɂ.1, ɒȿȼɑȿɇɄɈ ɋ.Ⱥ.2, ȻȺȽɇɈ Ɉ.Ⱥ.3, ȺɅȿɄɋȿȿȼȺ Ⱥ.ɂ.3,
Ƚɨɪɧɨ-Ⱥɥɬɚɣɫɤɢɣ ɇɂɂ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ1
Ƚɨɪɧɨ-Ⱥɥɬɚɣɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ2
Ʉɟɦɟɪɨɜɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɣ ɢɧɫɬɢɬɭɬ3
E-mail: shaisol60@mail.ru
Ɉɞɧɢɦ ɢɡ ɤɪɢɬɟɪɢɟɜ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɝɨ ɫɬɚɬɭɫɚ ɩɬɢɰɵ ɩɪɢ ɢɡɭɱɟɧɢɢ ɜɥɢɹɧɢɹ ɧɚ ɧɟɺ ɮɚɤɬɨɪɨɜ
ɷɤɡɨɝɟɧɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ ɹɜɥɹɟɬɫɹ ɤɪɨɜɶ, ɩɨ ɫɨɫɬɨɹɧɢɸ ɩɨɤɚɡɚɬɟɥɟɣ ɤɨɬɨɪɨɣ ɦɨɠɧɨ ɨɩɪɟɞɟɥɢɬɶ
ɨɛɟɫɩɟɱɟɧɧɨɫɬɶ ɨɪɝɚɧɢɡɦɚ ɩɢɬɚɬɟɥɶɧɵɦɢ ɢ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɦɢ ɜɟɳɟɫɬɜɚɦɢ, ɞɚɬɶ ɨɛɴɟɤɬɢɜɧɭɸ ɨɰɟɧɤɭ ɝɨɦɟɨɫɬɚɡɚ ɜ ɰɟɥɨɦ.
ɉɨ ɞɚɧɧɵɦ Ʉɟɦɟɪɨɜɫɤɨɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɦɟɞɢɰɢɧɫɤɨɣ ɚɤɚɞɟɦɢɢ, ɜ Ʉɭɡɛɚɫɫɟ ɩɪɨɫɥɟɠɢɜɚɟɬɫɹ
ɧɟɞɨɫɬɚɬɨɤ ɣɨɞɚ ɢ ɫɟɥɟɧɚ ɩɨ ɜɫɟɦ ɩɪɢɪɨɞɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɦ ɡɨɧɚɦ, ɱɬɨ ɨɛɨɫɧɨɜɵɜɚɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɩɪɨɜɟɞɟɧɢɹ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɦɟɪɨɩɪɢɹɬɢɣ ɜ ɜɢɞɟ ɞɨɩɨɥɧɢɬɟɥɶɧɨɝɨ ɜɜɟɞɟɧɢɹ ɜ ɪɚɰɢɨɧ
ɠɢɜɨɬɧɵɯ ɢ ɱɟɥɨɜɟɤɚ ɩɪɟɩɚɪɚɬɨɜ ɣɨɞɚ ɢ ɫɟɥɟɧɚ [1].
ɐɟɥɶ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ – ɢɡɭɱɢɬɶ ɷɪɢɬɪɨɰɢɬɚɪɧɵɟ ɢɧɞɟɤɫɵ ɤɪɨɜɢ ɝɭɫɟɣ ɢ ɩɟɪɟɩɟɥɨɜ (ɫɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ, ɫɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ, ɫɪɟɞɧɢɣ ɨɛɴɺɦ ɷɪɢɬɪɨɰɢɬɨɜ) ɩɪɢ ɜɜɟɞɟɧɢɢ ɜ ɫɨɫɬɚɜ ɪɚɰɢɨɧɚ ɦɢɤɪɨɞɨɛɚɜɨɤ ɫɟɥɟɧɚ ɢ ɣɨɞɚ.
ɗɤɫɩɟɪɢɦɟɧɬɚɥɶɧɚɹ ɱɚɫɬɶ ɪɚɛɨɬɵ ɪɟɚɥɢɡɨɜɚɧɚ ɧɚ ɝɭɫɢɧɨɣ ɮɟɪɦɟ ɁȺɈ «ɉɪɨɜɢɧɰɢɹ» ɧɚ ɩɨɦɟɫɧɵɯ ɦɹɫɧɵɯ ɝɭɫɹɯ ɤɪɚɫɧɨɡɟɪɫɤɨɣ ɢ ɤɢɬɚɣɫɤɨɣ ɩɨɪɨɞ; ɜ Ɇɍɋɏɉ «Ʉɟɦɟɪɨɜɫɤɚɹ ɢɧɤɭɛɚɬɨɪɧɨ-ɩɬɢɰɟɜɨɞɱɟɫɤɚɹ ɫɬɚɧɰɢɹ» ɧɚ ɩɟɪɟɩɟɥɚɯ ɹɩɨɧɫɤɨɣ ɩɨɪɨɞɵ. ɉɪɢ ɷɬɨɦ ɪɭɤɨɜɨɞɫɬɜɨɜɚɥɢɫɶ «Ɇɟɬɨɞɢɤɨɣ
ɩɪɨɜɟɞɟɧɢɹ ɧɚɭɱɧɵɯ ɢ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɤɨɪɦɥɟɧɢɸ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɬɢɰɵ» [2].
ɉɨ ɦɟɬɨɞɭ ɩɚɪ-ɚɧɚɥɨɝɨɜ ɛɵɥɢ ɫɮɨɪɦɢɪɨɜɚɧɵ ɤɨɧɬɪɨɥɶɧɚɹ ɢ ɨɩɵɬɧɚɹ ɝɪɭɩɩɵ ɢɡ 30-ɫɭɬɨɱɧɵɯ
ɩɨɦɟɫɧɵɯ ɦɹɫɧɵɯ ɝɭɫɹɬ ɤɪɚɫɧɨɡɟɪɫɤɨɣ ɢ ɤɢɬɚɣɫɤɨɣ ɩɨɪɨɞ ɩɨ 50 ɝɨɥɨɜ ɜ ɤɚɠɞɨɣ ɝɪɭɩɩɟ; ɤɨɧɬɪɨɥɶɧɚɹ ɢ ɬɪɢ ɨɩɵɬɧɵɟ ɝɪɭɩɩɵ ɩɟɪɟɩɟɥɨɜ ɹɩɨɧɫɤɨɣ ɩɨɪɨɞɵ ɜ ɜɨɡɪɚɫɬɟ 60 ɞɧɟɣ, ɩɨ 25 ɝɨɥɨɜ ɜ ɤɚɠɞɨɣ
ɝɪɭɩɩɟ. ɉɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɨɩɵɬɚ ɞɥɹ ɝɭɫɟɣ ɫɨɫɬɚɜɢɥɚ 90, ɞɥɹ ɩɟɪɟɩɟɥɨɜ – 120 ɫɭɬɨɤ.
Ƚɭɫɟɣ ɫɨɞɟɪɠɚɥɢ ɜ ɤɥɟɬɤɚɯ ɜ ɩɨɦɟɳɟɧɢɢ ɮɟɪɦɵ, ɩɟɪɟɩɟɥɨɜ – ɜ ɤɥɟɬɨɱɧɵɯ ɛɚɬɚɪɟɹɯ. Ʉɨɪɦɥɟɧɢɟ
ɩɨɞɨɩɵɬɧɵɯ ɩɬɢɰ ɨɫɭɳɟɫɬɜɥɹɥɢ ɩɨ ɪɚɰɢɨɧɚɦ, ɪɚɡɪɚɛɨɬɚɧɧɵɦ ɫɨɝɥɚɫɧɨ «Ɋɟɤɨɦɟɧɞɚɰɢɹɦ ɩɨ ɤɨɪɦɥɟɧɢɸ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɬɢɰɵ» [3].
Ƚɭɫɹɬɚ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɩɨɥɭɱɚɥɢ 0,2 ɦɝ ɫɟɥɟɧɚ ɢ 0,7 ɦɝ ɣɨɞɚ ɧɚ 1 ɤɝ ɤɨɪɦɚ ɜ ɜɢɞɟ ɧɟɨɪɝɚɧɢɱɟɫɤɢɯ ɫɨɟɞɢɧɟɧɢɣ – ɫɟɥɟɧɢɬɚ ɧɚɬɪɢɹ ɢ ɣɨɞɢɞɚ ɤɚɥɢɹ. ɉɬɢɰɚɦ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɫɤɚɪɦɥɢɜɚɥɢ
278
ɨɫɧɨɜɧɨɣ ɪɚɰɢɨɧ ɫ ɞɨɛɚɜɤɚɦɢ ɫɟɥɟɧɚ ɜ ɨɪɝɚɧɢɱɟɫɤɨɣ ɮɨɪɦɟ (ɫɟɥɟɧɨɚɦɢɧɨɤɢɫɥɨɬɵ ɢ ɫɟɥɟɧɨɫɨɞɟɪɠɚɳɢɟ ɛɟɥɤɢ) ɜ ɞɨɡɟ 0,3 ɦɝ ɫɟɥɟɧɚ ɧɚ 1 ɤɝ ɤɨɪɦɚ ɢ ɣɨɞɚ ɜ ɧɟɨɪɝɚɧɢɱɟɫɤɨɣ ɮɨɪɦɟ (ɣɨɞɢɞ ɤɚɥɢɹ) ɜ
ɞɨɡɟ 0,7 ɦɝ ɣɨɞɚ ɧɚ 1 ɤɝ ɤɨɪɦɚ 1 ɪɚɡ ɜ ɫɭɬɤɢ ɜ ɬɟɱɟɧɢɟ 10 ɫɭɬɨɤ, ɩɨɜɬɨɪɧɵɣ ɰɢɤɥ ɱɟɪɟɡ 20 ɫɭɬɨɤ, ɞɨ
ɤɨɧɰɚ ɜɵɪɚɳɢɜɚɧɢɹ.
ɉɟɪɟɩɟɥɚ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɩɨɥɭɱɚɥɢ ɨɫɧɨɜɧɨɣ ɪɚɰɢɨɧ ɫ ɞɨɛɚɜɤɚɦɢ ɫɟɥɟɧɚ ɢ ɣɨɞɚ ɜ ɨɪɝɚɧɢɱɟɫɤɨɣ ɮɨɪɦɟ ɜ ɞɨɡɚɯ, ɪɟɤɨɦɟɧɞɨɜɚɧɧɵɯ ɪɚɡɪɚɛɨɬɱɢɤɚɦɢ ɞɨɛɚɜɨɤ – 100 ɢ 50 ɦɝ/ɤɝ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ
ɜ ɫɨɫɬɚɜɟ 1 % ɜɢɬɚɦɢɧɧɨ-ɦɢɧɟɪɚɥɶɧɨɝɨ ɩɪɟɦɢɤɫɚ. ɉɟɪɟɩɟɥɚ ɨɩɵɬɧɵɯ ɝɪɭɩɩ ɩɨɥɭɱɚɥɢ ɨɫɧɨɜɧɨɣ
ɪɚɰɢɨɧ ɫ ɞɨɛɚɜɤɚɦɢ ɫɟɥɟɧɚ ɢ ɣɨɞɚ ɜ ɮɨɪɦɟ ɬɟɯ ɠɟ ɩɪɟɩɚɪɚɬɨɜ ɫ ɩɨɜɵɲɟɧɢɟɦ ɧɨɪɦɵ ɢɯ ɜɜɟɞɟɧɢɹ ɜ
ɫɨɫɬɚɜ ɪɚɰɢɨɧɚ: 1-ɹ ɨɩɵɬɧɚɹ ɝɪɭɩɩɚ – ɧɚ 25 %, 2-ɹ ɨɩɵɬɧɚɹ – ɧɚ 50 %, 3-ɹ ɨɩɵɬɧɚɹ – ɧɚ 100 % ɩɨ
ɫɪɚɜɧɟɧɢɸ ɫ ɤɨɧɬɪɨɥɟɦ.
Ʉɪɨɜɶ ɭ ɩɨɞɨɩɵɬɧɵɯ ɝɭɫɟɣ ɛɪɚɥɢ ɧɚ 30-ɟ, 75-ɟ ɢ 120-ɟ ɫɭɬɤɢ ɠɢɡɧɢ ɢɡ ɩɨɞɤɨɠɧɨɣ ɜɟɧɵ ɝɨɥɟɧɢ;
ɭ ɩɟɪɟɩɟɥɨɜ – ɧɚ 60-ɟ, 100-ɟ, 140-ɟ ɢ 180-ɟ ɫɭɬɤɢ ɢɡ ɤɪɵɥɨɜɨɣ ɜɟɧɵ. Ƚɟɦɚɬɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɜɤɥɸɱɚɥɢ: ɨɩɪɟɞɟɥɟɧɢɟ ɤɨɥɢɱɟɫɬɜɚ ɷɪɢɬɪɨɰɢɬɨɜ ɢ ɝɟɦɨɝɥɨɛɢɧɚ ɰɢɬɨɦɟɬɪɢɱɟɫɤɢɦ ɦɟɬɨɞɨɦ
ɧɚ ɝɟɦɚɬɨɥɨɝɢɱɟɫɤɨɦ ɚɧɚɥɢɡɚɬɨɪɟ ADVIA-60; ɪɚɫɱɟɬ ɷɪɢɬɪɨɰɢɬɚɪɧɵɯ ɢɧɞɟɤɫɨɜ ɩɨ ɨɛɳɟɩɪɢɧɹɬɵɦ
ɦɟɬɨɞɢɤɚɦ.
ȼɫɟ ɰɢɮɪɨɜɵɟ ɞɚɧɧɵɟ, ɩɨɥɭɱɟɧɧɵɟ ɜ ɯɨɞɟ ɷɤɫɩɟɪɢɦɟɧɬɚ, ɨɛɪɚɛɨɬɚɥɢ ɦɟɬɨɞɨɦ ɜɚɪɢɚɰɢɨɧɧɨɣ
ɫɬɚɬɢɫɬɢɤɢ [4]. Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɟɞɫɬɚɜɥɟɧɵ ɜ ɬɚɛɥ. 1 ɢ 2.
Ɍɚɛɥɢɰɚ 1
ɗɪɢɬɪɨɰɢɬɚɪɧɵɟ ɢɧɞɟɤɫɵ ɤɪɨɜɢ ɝɭɫɟɣ (M±m, n=6)
Ƚɪɭɩɩɚ
ɤɨɧɬɪɨɥɶɧɚɹ
ɨɩɵɬɧɚɹ
ɤɨɧɬɪɨɥɶɧɚɹ
ɨɩɵɬɧɚɹ
ɤɨɧɬɪɨɥɶɧɚɹ
ɨɩɵɬɧɚɹ
ȼɨɡɪɚɫɬ, ɫɭɬ
30
75
ɋɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ, ɩɝ
59,17±2,78
66,37±2,31
63,72±3,71
66,06±2,32
ɋɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ, %
36,11±1,48
36,43±1,35
39,74±1,32
37,19±0,55
ɋɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ, ɦɤɦ3
163,76±1,09
182,69±8,08
159,97±3,97
178,12±8,50
120
63,01±1,73
66,66±0,49
41,29±0,52
41,56±0,21
153,25±2,34
157,94±1,95
Ɍɚɛɥɢɰɚ 2
ɗɪɢɬɪɨɰɢɬɚɪɧɵɟ ɢɧɞɟɤɫɵ ɤɪɨɜɢ ɩɟɪɟɩɟɥɨɜ (M±m, n=5)
Ƚɪɭɩɩɚ
Ʉɨɧɬɪɨɥɶɧɚɹ
1-ɹ ɨɩɵɬɧɚɹ
2-ɹ ɨɩɵɬɧɚɹ
3-ɹ ɨɩɵɬɧɚɹ
Ʉɨɧɬɪɨɥɶɧɚɹ
1-ɹ ɨɩɵɬɧɚɹ
2-ɹ ɨɩɵɬɧɚɹ
3-ɹ ɨɩɵɬɧɚɹ
Ʉɨɧɬɪɨɥɶɧɚɹ
1-ɹ ɨɩɵɬɧɚɹ
2-ɹ ɨɩɵɬɧɚɹ
3-ɹ ɨɩɵɬɧɚɹ
ȼɨɡɪɚɫɬ, ɫɭɬ
60
100
140
ɋɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ (ɩɝ)
31,33±4,79
27,95±4,29
31,68±4,23
32,39±5,72
28,52±4,26
33,80±2,82
29,70±3,20
31,53±4,63
26,48±5,07
32,28±5,54
27,57±5,53
36,20±4,75
ɋɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ( %)
37,62±5,10
30,33±3,25
30,62±2,20
32,95±4,50
27,51±1,48
36,24±5,22
34,09±3,98
31,70±4,32
26,43±1,77
40,33±2,95
28,65±4,29
38,41±4,02
ɋɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ (ɦɤɦ3)
83,29±6,31
92,13±8,89
103,46±12,68
98,32±15,85
103,64±19,76
93,26±14,66
87,13±11,51
99,45±18,98
100,20±15,75
80,04±6,52
96,23±7,82
94,23±21,05
180
30,71±4,68
24,81±3,82
36,02±4,96
25,24±4,17
33,84±1,63
39,16±9,32
39,63±4,68
48,18±3,30
90,76±21,14
63,34±13,44
90,89±18,47
52,38±9,76
ɍ ɝɭɫɟɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɫɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ɧɚ 75-ɟ ɫɭɬɤɢ ɢɫɫɥɟɞɨɜɚɧɢɹ ɭɦɟɧɶɲɚɥɨɫɶ ɨɬɧɨɫɢɬɟɥɶɧɨ ɚɧɚɥɨɝɨɜ ɢɡ ɤɨɧɬɪɨɥɹ ɧɚ 0,5 %, ɧɚ 120-ɟ ɫɭɬɤɢ ɛɵɥɨ ɜɵɲɟ
ɧɚ 5,8 %. ɋɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ɭ ɝɭɫɟɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɧɚ 75-ɟ ɢ
120-ɟ ɫɭɬɤɢ ɢɫɫɥɟɞɨɜɚɧɢɹ ɨɬɧɨɫɢɬɟɥɶɧɨ ɚɧɚɥɨɝɨɜ ɢɡ ɤɨɧɬɪɨɥɹ ɩɨɜɵɲɚɥɚɫɶ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 2,1
ɢ 0,7 %. ɋɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ ɭ ɩɬɢɰɵ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɛɵɥ ɧɢɠɟ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɤɨɧɬ279
ɪɨɥɶɧɨɣ ɩɬɢɰɟɣ ɧɚ 75-ɟ ɫɭɬɤɢ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ 2,5 %. Ʉ 120-ɦ ɫɭɬɤɚɦ ɢɫɫɥɟɞɭɟɦɵɣ ɩɨɤɚɡɚɬɟɥɶ
ɭ ɝɭɫɟɣ ɤɨɧɬɪɨɥɶɧɨɣ ɢ ɨɩɵɬɧɨɣ ɝɪɭɩɩ ɩɨɧɢɠɚɥɫɹ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɩɪɟɞɵɞɭɳɢɦ ɢɫɫɥɟɞɨɜɚɧɢɟɦ.
Ɉɬɧɨɫɢɬɟɥɶɧɨ ɚɧɚɥɨɝɨɜ ɢɡ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɫɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ ɭ ɝɭɫɟɣ ɨɩɵɬɧɨɣ
ɝɪɭɩɩɵ ɛɵɥ ɜɵɲɟ ɧɚ 3,1 %.
ɋɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ɤɪɨɜɢ ɩɟɪɟɩɟɥɨɜ 1-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɛɵɥɨ
ɜɵɲɟ ɧɚ 100-ɟ, 140-ɟ ɫɭɬɤɢ ɨɩɵɬɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 2,0 ɢ 6,7 % ɢ ɧɢɠɟ ɧɚ 180-ɟ ɫɭɬɤɢ – ɧɚ 19,2 %
ɜ ɫɪɚɜɧɟɧɢɢ ɫ ɤɨɧɬɪɨɥɶɧɵɦɢ ɩɨɤɚɡɚɬɟɥɹɦɢ. ɋɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ɤɪɨɜɢ ɩɟɪɟɩɟɥɨɜ 1-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɧɚ 140-ɟ ɢ 180-ɟ ɫɭɬɤɢ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɵɥɚ ɜɵɲɟ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ
ɧɚ 5,6 ɢ 5,3 % ɢ ɧɢɠɟ ɧɚ 100-ɟ ɫɭɬɤɢ – ɧɚ 2,8 % ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɤɨɧɬɪɨɥɟɦ. ɋɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ ɜ ɤɪɨɜɢ ɭ ɩɬɢɰɵ 1-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɛɵɥ ɜɵɲɟ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɩɨɤɚɡɚɬɟɥɹɦɢ ɩɟɪɟɩɟɥɨɜ
ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɧɚ 100-ɟ ɫɭɬɤɢ ɢɫɫɥɟɞɨɜɚɧɢɹ ɧɚ 12,5 %, ɚ ɧɚ 140-ɟ ɢ 180-ɟ ɫɭɬɤɢ – ɧɢɠɟ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 9,9 ɢ 30,2 %.
ɋɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ, ɫɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ɤɪɨɜɢ ɩɟɪɟɩɟɥɨɜ 2-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɧɚ 140-ɟ ɫɭɬɤɢ ɷɤɫɩɟɪɢɦɟɧɬɚ ɛɵɥɢ ɧɢɠɟ ɚɧɚɥɨɝɨɜ ɢɡ ɤɨɧɬɪɨɥɹ ɧɚ 16,4
ɢ 13,7 % ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɚ ɧɚ 100-ɟ ɢ 180-ɟ ɫɭɬɤɢ ɜɵɲɟ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 12,8, 1,4 ɢ 17,3, 5,8 %.
ɋɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ ɤɪɨɜɢ ɩɟɪɟɩɟɥɨɜ 2-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɧɚ 100-ɟ ɢ 180-ɟ ɫɭɬɤɢ ɨɩɵɬɚ ɜ
ɫɪɚɜɧɟɧɢɢ ɫ ɤɨɧɬɪɨɥɶɧɵɦɢ ɩɨɤɚɡɚɬɟɥɹɦɢ ɛɵɥ ɜɵɲɟ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 7,9 ɢ 0,1 %, ɢ ɧɢɠɟ ɧɚ 140-ɟ
ɫɭɬɤɢ – ɧɚ 3,2 %.
ɍ ɩɟɪɟɩɟɥɨɜ 3-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɫɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ ɧɚ 100-ɟ ɢ
180-ɟ ɫɭɬɤɢ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɵɥɨ ɧɢɠɟ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɚɧɚɥɨɝɚɦɢ ɢɡ ɤɨɧɬɪɨɥɹ ɧɚ 1,4 ɢ 17,8 % ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɢ ɜɵɲɟ ɧɚ 140-ɟ ɫɭɬɤɢ – ɧɚ 14,3 %. ɋɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ
ɜ ɚɧɚɥɨɝɢɱɧɨɣ ɝɪɭɩɩɟ ɛɵɥɚ ɜɵɲɟ ɧɚ 140-ɟ ɢ 180-ɟ ɫɭɬɤɢ ɷɤɫɩɟɪɢɦɟɧɬɚ ɧɚ 7,8 ɢ 14,3 % ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɢ ɧɢɠɟ ɧɚ 100-ɟ ɫɭɬɤɢ – ɧɚ 1,7 % ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɚɧɚɥɨɝɚɦɢ ɢɡ ɤɨɧɬɪɨɥɹ. ɋɪɟɞɧɢɣ ɨɛɴɟɦ
ɷɪɢɬɪɨɰɢɬɨɜ ɜ ɤɪɨɜɢ ɩɟɪɟɩɟɥɨɜ 3-ɣ ɨɩɵɬɧɨɣ ɝɪɭɩɩɵ ɧɚ 140-ɟ ɢ 180-ɟ ɫɭɬɤɢ ɨɩɵɬɚ ɜ ɫɪɚɜɧɟɧɢɢ ɫ
ɤɨɧɬɪɨɥɶɧɵɦɢ ɩɨɤɚɡɚɬɟɥɹɦɢ ɛɵɥ ɧɢɠɟ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 8,9 ɢ 42,3 %, ɚ ɧɚ 100-ɟ ɫɭɬɤɢ ɩɨɤɚɡɚɬɟɥɶ
ɩɨɜɵɫɢɥɫɹ ɧɚ 4,5 %.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɩɨɞ ɜɥɢɹɧɢɟɦ ɫɤɚɪɦɥɢɜɚɧɢɹ ɦɢɤɪɨɞɨɛɚɜɨɤ ɫɟɥɟɧɚ ɢ ɣɨɞɚ ɜ ɩɪɟɞɥɨɠɟɧɧɵɯ ɫɨɱɟɬɚɧɢɹɯ ɜ ɤɪɨɜɢ ɝɭɫɟɣ ɢ ɩɟɪɟɩɟɥɨɜ ɨɩɵɬɧɵɯ ɝɪɭɩɩ ɩɨɜɵɲɚɟɬɫɹ ɜ ɩɪɟɞɟɥɚɯ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɣ ɧɨɪɦɵ
ɫɪɟɞɧɟɟ ɫɨɞɟɪɠɚɧɢɟ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ, ɫɪɟɞɧɹɹ ɤɨɧɰɟɧɬɪɚɰɢɹ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɷɪɢɬɪɨɰɢɬɟ
ɢ ɫɪɟɞɧɢɣ ɨɛɴɟɦ ɷɪɢɬɪɨɰɢɬɨɜ. ɋɥɟɞɨɜɚɬɟɥɶɧɨ, ɭɤɚɡɚɧɧɵɟ ɩɪɟɩɚɪɚɬɵ ɫɬɢɦɭɥɢɪɭɸɬ ɷɪɢɬɪɨɩɨɷɡ ɢ
ɫɢɧɬɟɡ ɝɟɦɨɝɥɨɛɢɧɚ ɜ ɨɪɝɚɧɢɡɦɟ ɩɬɢɰ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
Ȼɪɟɠɧɟɜɚ, ȿ.ȼ. Ɉɛɟɫɩɟɱɟɧɧɨɫɬɶ ɣɨɞɨɦ ɢ ɫɟɥɟɧɨɦ ɜɡɪɨɫɥɨɝɨ ɧɚɫɟɥɟɧɢɹ ɝ. Ʉɟɦɟɪɨɜɨ / ȿ.ȼ. Ȼɪɟɠɧɟɜɚ,
ɋ.Ɏ. Ɂɢɧɱɭɤ // Ɏɟɞɟɪɚɥɶɧɵɣ ɢ ɪɟɝɢɨɧɚɥɶɧɵɟ ɚɫɩɟɤɬɵ ɩɨɥɢɬɢɤɢ ɡɞɨɪɨɜɨɝɨ ɩɢɬɚɧɢɹ : ɬɟɡ. ɦɟɠɞɭɧɚɪ.
ɫɢɦɩɨɡɢɭɦɚ. – Ʉɟɦɟɪɨɜɨ: ɄɟɦɌɂɉɉ, 2002. – 32 ɫ.
Ɇɟɬɨɞɢɤɚ ɩɪɨɜɟɞɟɧɢɹ ɧɚɭɱɧɵɯ ɢ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɤɨɪɦɥɟɧɢɸ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɬɢɰɵ: ɪɟɤɨɦɟɧɞɚɰɢɢ / ɒ.Ⱥ. ɂɦɚɧɝɭɥɨɜ, ɂ.Ⱥ. ȿɝɨɪɨɜ, Ɍ.Ɇ. Ɉɤɨɥɟɥɨɜɚ [ɢ ɞɪ.] // ɋɟɪɝɢɟɜ ɉɨɫɚɞ:
ȼɇɂɌɂɉ. – 2000. – 36 ɫ.
Ɋɟɤɨɦɟɧɞɚɰɢɢ ɩɨ ɤɨɪɦɥɟɧɢɸ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɬɢɰɵ / ɒ.Ⱥ. ɂɦɚɧɝɭɥɨɜ, ɂ.Ⱥ. ȿɝɨɪɨɜ, Ɍ.Ɇ. Ɉɤɨɥɟɥɨɜɚ [ɢ ɞɪ.]. – ɋɟɪɝɢɟɜ-ɉɨɫɚɞ: ȼɇɂɌɂɉ, 2009. – 144 ɫ.
ɉɥɨɯɢɧɫɤɢɣ, ɇ.Ⱥ. Ɋɭɤɨɜɨɞɫɬɜɨ ɩɨ ɛɢɨɦɟɬɪɢɢ ɞɥɹ ɡɨɨɬɟɯɧɢɤɨɜ. – Ɇ. : Ʉɨɥɨɫ, 1969. – 256 ɫ.
ɍȾɄ 619:34(094.4)
ɉɊɂɆȿɇȿɇɂȿ ɇɈɊɆ ɄɈȾȿɄɋȺ
ɈȻ ȺȾɆɂɇɂɋɌɊȺɌɂȼɇɕɏ ɉɊȺȼɈɇȺɊɍɒȿɇɂəɏ ɊɎ
ȼ ɈȻɅȺɋɌɂ ɉɊȿȾɉɊɂɇɂɆȺɌȿɅɖɋɄɈɃ ȾȿəɌȿɅɖɇɈɋɌɂ
ɒɂɏȺɅȿȼȺ ɇ.Ʌ.,
ɡɚɦ Ƚɥɚɜɵ ɚɞɦɢɧɢɫɬɪɚɰɢɢ Ɉɤɬɹɛɪɶɫɤɨɝɨ ɪɚɣɨɧɚ,
ɝ. ɇɨɜɨɫɢɛɢɪɫɤɚ ɩɨ ɷɤɨɧɨɦɢɢ ɢ ɞɨɯɨɞɚɦ
ɘɒɄɈȼȺ Ʌ. ə.,
ɎȽȻɇɍ ɂɧɫɬɢɬɭɬ ɗɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɣ ɜɟɬɟɪɢɧɚɪɢɢ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɝɨ ȼɨɫɬɨɤɚ
ɝ. ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ e-mail:iushkowa.l@yandex.ru
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬ. 14.1.
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬ. 14.1 ɄɨȺɉ ɊɎ (Ɉɫɭɳɟɫɬɜɥɟɧɢɟ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɛɟɡ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɪɟɝɢɫɬɪɚɰɢɢ ɢɥɢ ɛɟɡ ɫɩɟɰɢɚɥɶɧɨɝɨ ɪɚɡɪɟɲɟɧɢɹ (ɥɢɰɟɧ280
ɡɢɢ)). Ɉɛɴɟɤɬɨɦ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ ɜ ɨɛɥɚɫɬɢ ɩɪɚɤɬɢɱɟɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɸɪɢɞɢɱɟɫɤɢɯ ɥɢɰ ɢ ɢɧɞɢɜɢɞɭɚɥɶɧɵɯ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɟɣ, ɨɫɭɳɟɫɬɜɥɹɸɳɢɯ
ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɭɸ ɞɟɹɬɟɥɶɧɨɫɬɶ ɜ ɫɮɟɪɟ ɜɟɬɟɪɢɧɚɪɢɢ. Ɉɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɨɣ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɭɦɵɲɥɟɧɧɵɟ ɞɟɣɫɬɜɢɹ ɥɢɰɚ, ɩɨ ɨɫɭɳɟɫɬɜɥɟɧɢɸ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɜ ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɢɢ ɛɟɡ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɪɟɝɢɫɬɪɚɰɢɢ ɢ/ɢɥɢ ɫɩɟɰɢɚɥɶɧɨɝɨ ɪɚɡɪɟɲɟɧɢɹ (ɥɢɰɟɧɡɢɢ).ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɦɨɝɭɬ ɹɜɥɹɬɶɫɹ ɜɟɬɟɪɢɧɚɪɧɵɟ ɫɩɟɰɢɚɥɢɫɬɵ – ɢɧɞɢɜɢɞɭɚɥɶɧɵɟ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɢ ɢɥɢ ɸɪɢɞɢɱɟɫɤɢɟ ɥɢɰɚ, ɨɫɭɳɟɫɬɜɥɹɸɳɢɟ ɢɧɞɢɜɢɞɭɚɥɶɧɭɸ ɬɪɭɞɨɜɭɸ ɞɟɹɬɟɥɶɧɨɫɬɶ. ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɜɵɪɚɠɚɟɬɫɹ ɜ ɮɨɪɦɟ ɩɪɹɦɨɝɨ ɭɦɵɫɥɚ.
ɉɪɢɦɟɧɟɧɢɟ ɧɨɪɦ ɄɨȺɉ ɊɎ ɩɪɢ ɧɚɪɭɲɟɧɢɹɯ ɩɪɨɬɢɜ ɩɨɪɹɞɤɚ ɭɩɪɚɜɥɟɧɢɹ Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɱɚɫɬɢ ɩɟɪɜɨɣ ɫɬɚɬɶɢ 19.4 ɄɨȺɉ ɊɎ Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɱɚɫɬɢ
ɩɟɪɜɨɣ ɫɬ. 19.4 ɄɨȺɉ ɊɎ (ɇɟɩɨɜɢɧɨɜɟɧɢɟ ɡɚɤɨɧɧɨɦɭ ɪɚɫɩɨɪɹɠɟɧɢɸ ɞɨɥɠɧɨɫɬɧɨɝɨ ɥɢɰɚ ɨɪɝɚɧɚ,
ɨɫɭɳɟɫɬɜɥɹɸɳɟɝɨ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɧɚɞɡɨɪ (ɤɨɧɬɪɨɥɶ). Ɉɛɴɟɤɬɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɭɫɬɚɧɨɜɥɟɧɧɵɣ ɩɨɪɹɞɨɤ ɭɩɪɚɜɥɟɧɢɹ, ɩɨɞ ɤɨɬɨɪɵɦ ɫɥɟɞɭɟɬ ɩɨɧɢɦɚɬɶ ɫɨɜɨɤɭɩɧɨɫɬɶ ɩɪɚɜɨɜɵɯ ɢɧɫɬɢɬɭɬɨɜ ɨɛɟɫɩɟɱɢɜɚɸɳɢɯ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɟ ɨɪɝɚɧɨɜ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɜɥɚɫɬɢ. Ɉɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɨɣ
ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɭɦɵɲɥɟɧɧɵɟ ɞɟɣɫɬɜɢɹ ɥɢɰɚ, ɩɪɟɩɹɬɫɬɜɭɸɳɢɟ ɨɫɭɳɟɫɬɜɥɟɧɢɸ ɩɨɥɧɨɦɨɱɢɣ ɩɪɟɞɫɬɚɜɢɬɟɥɟɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɯ ɨɪɝɚɧɨɜ ɧɚɞɡɨɪɚ. ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɦɨɝɭɬ ɹɜɥɹɬɶɫɹ – ɸɪɢɞɢɱɟɫɤɢɟ ɥɢɰɚ, ɨɫɭɳɟɫɬɜɥɹɸɳɟɟ ɪɚɡɜɟɞɟɧɢɟ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɨɢɡɜɨɞɫɬɜɨ ɢ
ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɚɬɟɪɢɚɥɚ) ɜ ɫɟɥɟɤɰɢɨɧɧɵɯ ɰɟɥɹɯ, ɚ ɬɚɤɠɟ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ ɜ
ɨɛɥɚɫɬɢ ɩɥɟɦɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ; – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ
ɬ. ɞ.);- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ). ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɜɵɪɚɠɚɟɬɫɹ ɜ ɮɨɪɦɟ ɩɪɹɦɨɝɨ ɭɦɵɫɥɚ. Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬ. 19.4.1
ɄɨȺɉ ɊɎ Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬ. 19.4.1 ɄɨȺɉ ɊɎ. ȼɨɫɩɪɟɩɹɬɫɬɜɨɜɚɧɢɟ ɡɚɤɨɧɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɞɨɥɠɧɨɫɬɧɨɝɨ ɥɢɰɚ ɨɪɝɚɧɚ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɤɨɧɬɪɨɥɹ (ɧɚɞɡɨɪɚ).
ɋɨɫɬɚɜ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɫɨɨɬɜɟɬɫɬɜɭɟɬ ɫɬ. 19.4 ɄɨȺɉ ɊɎ.
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɱɚɫɬɢ ɩɟɪɜɨɣ ɫɬɚɬɶɢ 19.5 ɄɨȺɉ ɊɎ Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ
ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɱɚɫɬɢ ɩɟɪɜɨɣ ɫɬ. 19.5 ɄɨȺɉ ɊɎ (ɇɟɜɵɩɨɥɧɟɧɢɟ ɜ ɫɪɨɤ ɡɚɤɨɧɧɨɝɨ ɩɪɟɞɩɢɫɚɧɢɹ
(ɩɨɫɬɚɧɨɜɥɟɧɢɹ, ɩɪɟɞɫɬɚɜɥɟɧɢɹ, ɪɟɲɟɧɢɹ) ɨɪɝɚɧɚ (ɞɨɥɠɧɨɫɬɧɨɝɨ ɥɢɰɚ), ɨɫɭɳɟɫɬɜɥɹɸɳɟɝɨ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɧɚɞɡɨɪ (ɤɨɧɬɪɨɥɶ).
Ɉɛɴɟɤɬɨɦ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɭɫɬɚɧɨɜɥɟɧɧɵɣ ɩɨɪɹɞɨɤ ɭɩɪɚɜɥɟɧɢɹ. Ɉɛɴɟɤɬɢɜɧɨɣ
ɫɬɨɪɨɧɨɣ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɭɦɵɲɥɟɧɧɵɟ ɞɟɣɫɬɜɢɹ ɥɢɰɚ, ɜɵɪɚɠɟɧɧɵɟ ɜ ɧɟɢɫɩɨɥɧɟɧɢɢ
ɜ ɫɪɨɤ ɡɚɤɨɧɧɨɝɨ ɩɪɟɞɩɢɫɚɧɢɹ (ɩɨɫɬɚɧɨɜɥɟɧɢɹ, ɩɪɟɞɫɬɚɜɥɟɧɢɹ, ɪɟɲɟɧɢɹ) ɨɪɝɚɧɚ (ɞɨɥɠɧɨɫɬɧɨɝɨ
ɥɢɰɚ), ɨɫɭɳɟɫɬɜɥɹɸɳɟɝɨ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɧɚɞɡɨɪ (ɤɨɧɬɪɨɥɶ). ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ – ɸɪɢɞɢɱɟɫɤɢɟ ɥɢɰɚ, ɨɫɭɳɟɫɬɜɥɹɸɳɟɟ ɪɚɡɜɟɞɟɧɢɟ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɨɢɡɜɨɞɫɬɜɨ ɢ
ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɚɬɟɪɢɚɥɚ) ɜ ɫɟɥɟɤɰɢɨɧɧɵɯ ɰɟɥɹɯ, ɚ ɬɚɤɠɟ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ
ɜ ɨɛɥɚɫɬɢ ɩɥɟɦɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ;
- ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ,
ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ,
ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.); – ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ
ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ). ɋɭɛɴɟɤɬɢɜɧɚɹ
ɫɬɨɪɨɧɚ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɜɵɪɚɠɚɟɬɫɹ ɜ ɮɨɪɦɟ ɩɪɹɦɨɝɨ ɭɦɵɫɥɚ. Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 19.6 ɄɨȺɉ ɊɎ Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬ. 19.6 ɄɨȺɉ ɊɎ
(ɇɟɩɪɢɧɹɬɢɟ ɦɟɪ ɩɨ ɭɫɬɪɚɧɟɧɢɸ ɩɪɢɱɢɧ ɢ ɭɫɥɨɜɢɣ, ɫɩɨɫɨɛɫɬɜɨɜɚɜɲɢɯ ɫɨɜɟɪɲɟɧɢɸ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ).
Ɉɛɴɟɤɬɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɭɫɬɚɧɨɜɥɟɧɧɵɣ ɩɨɪɹɞɨɤ ɭɩɪɚɜɥɟɧɢɹ. Ɉɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɨɣ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɛɟɡɞɟɣɫɬɜɢɟ ɞɨɥɠɧɨɫɬɧɨɝɨ ɥɢɰɚ, ɜɵɪɚɠɟɧɧɨɟ ɜ ɧɟɩɪɢɧɹɬɢɢ ɦɟɪ
ɩɪɟɞɩɢɫɚɧɧɵɯ ɨɪɝɚɧɨɦ (ɞɨɥɠɧɨɫɬɧɵɦ ɥɢɰɨɦ), ɨɫɭɳɟɫɬɜɥɹɸɳɢɦ ɧɚɞɡɨɪ (ɤɨɧɬɪɨɥɶ), ɩɨ ɭɫɬɪɚɧɟɧɢɸ ɩɪɢɱɢɧ ɢ ɭɫɥɨɜɢɣ, ɫɩɨɫɨɛɫɬɜɨɜɚɜɲɢɯ ɫɨɜɟɪɲɟɧɢɸ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ.
ɋɭɛɴɟɤɬɚɦɢ ɹɜɥɹɸɬɫɹ – ɸɪɢɞɢɱɟɫɤɢɟ ɥɢɰɚ, ɨɫɭɳɟɫɬɜɥɹɸɳɟɟ ɪɚɡɜɟɞɟɧɢɟ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɨɢɡɜɨɞɫɬɜɨ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɚɬɟɪɢɚɥɚ) ɜ ɫɟɥɟɤɰɢɨɧɧɵɯ ɰɟɥɹɯ,
ɚ ɬɚɤɠɟ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ ɜ ɨɛɥɚɫɬɢ ɩɥɟɦɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ; – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ
ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ
ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.); [1,2,3,4] – ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ
ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ).ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɜɵɪɚɠɚɟɬɫɹ ɜ ɮɨɪɦɟ ɩɪɹɦɨɝɨ ɭɦɵɫɥɚ.
281
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 19.7 ɄɨȺɉ ɊɎ Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ
ɩɨ ɫɬ. 19.7 ɄɨȺɉ ɊɎ.
(ɇɟɩɪɟɞɫɬɚɜɥɟɧɢɟ ɫɜɟɞɟɧɢɣ (ɢɧɮɨɪɦɚɰɢɢ). Ɉɛɴɟɤɬɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɭɫɬɚɧɨɜɥɟɧɧɵɣ ɩɨɪɹɞɨɤ ɭɩɪɚɜɥɟɧɢɹ ɜ ɨɛɥɚɫɬɢ ɧɟɩɪɟɞɫɬɚɜɥɟɧɢɹ ɢɥɢ ɧɟɫɜɨɟɜɪɟɦɟɧɧɨɝɨ ɩɪɟɞɫɬɚɜɥɟɧɢɹ ɢɧɮɨɪɦɚɰɢɢ ɧɟɨɛɯɨɞɢɦɨɣ ɞɥɹ ɨɫɭɳɟɫɬɜɥɟɧɢɹ ɨɪɝɚɧɨɦ (ɞɨɥɠɧɨɫɬɧɵɦ ɥɢɰɨɦ), ɨɫɭɳɟɫɬɜɥɹɸɳɢɦ
ɧɚɞɡɨɪ (ɤɨɧɬɪɨɥɶ), ɟɝɨ ɡɚɤɨɧɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ. ɋ ɨɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɵ ɞɚɧɧɨɟ ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ
ɦɨɠɟɬ ɛɵɬɶ ɜɵɪɚɠɟɧɨ ɤɚɤ ɞɟɣɫɬɜɢɟɦ, ɬɚɤ ɢ ɛɟɡɞɟɣɫɬɜɢɟɦ. ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɩɪɢɡɧɚɸɬɫɹ – ɸɪɢɞɢɱɟɫɤɢɟ ɥɢɰɚ, ɨɫɭɳɟɫɬɜɥɹɸɳɟɟ ɪɚɡɜɟɞɟɧɢɟ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɨɢɡɜɨɞɫɬɜɨ ɢ
ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɚɬɟɪɢɚɥɚ) ɜ ɫɟɥɟɤɰɢɨɧɧɵɯ ɰɟɥɹɯ, ɚ ɬɚɤɠɟ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ ɜ
ɨɛɥɚɫɬɢ ɩɥɟɦɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ; – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ
ɢ ɬ. ɞ.); – ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ);
– ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ). ɋ ɫɭɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɵ ɞɚɧɧɨɟ
ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ ɦɨɠɟɬ ɛɵɬɶ ɫɨɜɟɪɲɟɧɧɨ ɤɚɤ ɭɦɵɲɥɟɧɧɨ, ɬɚɤ ɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ. ɉɪɢɦɟɧɟɧɢɟ
ɧɨɪɦ ɍɄ ɊɎ
Ʉ ɨɪɝɚɧɚɦ, ɧɚɞɟɥɟɧɧɵɦ ɩɨɥɧɨɦɨɱɢɹɦɢ ɩɨ ɨɮɨɪɦɥɟɧɢɸ ɞɟɥ ɞɥɹ ɩɟɪɟɞɚɱɢ ɜ ɫɥɟɞɫɬɜɟɧɧɵɟ ɨɪɝɚɧɵ, ɨɬɧɨɫɹɬɫɹ ɝɥɚɜɧɵɟ ɜɟɬɟɪɢɧɚɪɧɵɟ ɢɧɫɩɟɤɬɨɪɚ, ɤɨɬɨɪɵɟ ɩɨɞɚɸɬ ɡɚɹɜɥɟɧɢɟ ɧɚ ɢɦɹ ɩɪɨɤɭɪɨɪɚ
ɢɥɢ ɧɚɱɚɥɶɧɢɤɚ ɍȼȾ ɪɚɣɨɧɚ
ɢɥɢ ɝɨɪɨɞɚ, ɜ ɤɨɬɨɪɨɦ ɢɡɥɚɝɚɸɬ ɯɚɪɚɤɬɟɪɢɫɬɢɤɭ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɜ ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɢɢ, ɤɜɚɥɢɮɢɰɢɪɭɟɦɨɝɨ ɤɚɤ ɩɪɟɫɬɭɩɥɟɧɢɟ, ɯɚɪɚɤɬɟɪɢɫɬɢɤɭ ɜɢɧɨɜɧɢɤɚ, ɫɬɟɩɟɧɶ ɬɹɠɟɫɬɢ ɩɪɟɫɬɭɩɥɟɧɢɹ,
ɩɪɟɞɦɟɬ ɨɛɪɚɳɟɧɢɹ (ɲɬɪɚɮ ɢɥɢ ɭɝɨɥɨɜɧɨɟ ɧɚɤɚɡɚɧɢɟ). Ʉ ɡɚɹɜɥɟɧɢɸ ɩɪɢɥɚɝɚɟɬɫɹ ɚɤɬ ɫɨɫɬɚɜɚ ɩɪɟɫɬɭɩɥɟɧɢɹ.
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 238 ɍɄ ɊɎ
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 238 ɍɄ ɊɎ (ɉɪɨɢɡɜɨɞɫɬɜɨ, ɯɪɚɧɟɧɢɟ, ɩɟɪɟɜɨɡɤɚ ɥɢɛɨ
ɫɛɵɬ ɬɨɜɚɪɨɜ ɢ ɩɪɨɞɭɤɰɢɢ, ɜɵɩɨɥɧɟɧɢɟ ɪɚɛɨɬ ɢɥɢ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ, ɧɟ ɨɬɜɟɱɚɸɳɢɯ ɬɪɟɛɨɜɚɧɢɹɦ
ɛɟɡɨɩɚɫɧɨɫɬɢ). Ɉɛɴɟɤɬɨɦ ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ, ɜ ɨɛɥɚɫɬɢ ɩɪɨɢɡɜɨɞɫɬɜɚ, ɯɪɚɧɟɧɢɹ,
ɩɟɪɟɜɨɡɤɢ ɥɢɛɨ ɫɛɵɬ ɬɨɜɚɪɨɜ ɢ ɩɪɨɞɭɤɰɢɢ, ɜɵɩɨɥɧɟɧɢɟ ɪɚɛɨɬ ɢɥɢ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ, ɧɟ ɨɬɜɟɱɚɸɳɢɯ
ɬɪɟɛɨɜɚɧɢɹɦ ɛɟɡɨɩɚɫɧɨɫɬɢ. Ɉɛɴɟɤɬɢɜɧɭɸ ɫɬɨɪɨɧɭ ɫɨɫɬɚɜɥɹɟɬ ɞɟɣɫɬɜɢɟ, ɜɵɪɚɠɟɧɧɨɟ ɜ ɨɫɭɳɟɫɬɜɥɟɧɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɢ/ɢɥɢ ɩɪɨɞɚɠɟ ɬɨɜɚɪɨɜ, ɧɟ ɨɬɜɟɱɚɸɳɢɯ ɬɪɟɛɨɜɚɧɢɹɦ ɛɟɡɨɩɚɫɧɨɫɬɢ ɠɢɡɧɢ
ɢ ɡɞɨɪɨɜɶɹ ɩɨɬɪɟɛɢɬɟɥɟɣ (ɦɹɫɨ, ɦɨɥɨɤɨ, ɹɣɰɚ ɢ ɞɪɭɝɢɟ ɩɪɨɞɭɤɬɵ ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ).
ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ:
- ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.);
- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ).ɋ ɫɭɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɵ ɞɟɣɫɬɜɢɹ ɦɨɝɭɬ
ɛɵɬɶ ɫɨɜɟɪɲɟɧɵ ɭɦɵɲɥɟɧɧɨ ɢɥɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 248 ɍɄ ɊɎ
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 248 ɍɄ ɊɎ (ɇɚɪɭɲɟɧɢɟ ɩɪɚɜɢɥ ɛɟɡɨɩɚɫɧɨɫɬɢ ɩɪɢ ɨɛɪɚɳɟɧɢɢ ɫ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɦɢ ɥɢɛɨ ɞɪɭɝɢɦɢ ɛɢɨɥɨɝɢɱɟɫɤɢɦɢ ɚɝɟɧɬɚɦɢ ɢɥɢ ɬɨɤɫɢɧɚɦɢ).Ɉɛɴɟɤɬɨɦ
ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ, ɜ ɨɛɥɚɫɬɢ ɨɛɟɫɩɟɱɟɧɢɹ ɷɤɨɥɨɝɢɱɟɫɤɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɢ ɡɞɨɪɨɜɶɹ ɧɚɫɟɥɟɧɢɹ. Ɉɛɴɟɤɬɢɜɧɭɸ ɫɬɨɪɨɧɭ ɫɨɫɬɚɜɥɹɟɬ ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ), ɜɵɪɚɠɟɧɧɨɟ ɜ ɧɟɫɨɛɥɸɞɟɧɢɢ (ɧɚɪɭɲɟɧɢɢ) ɩɪɚɜɢɥ ɛɟɡɨɩɚɫɧɨɫɬɢ ɩɪɢ ɨɛɪɚɳɟɧɢɢ ɫ ɦɢɤɪɨɛɢɨɥɨɝɢɱɟɫɤɢɦɢ ɥɢɛɨ ɞɪɭɝɢɦɢ
ɛɢɨɥɨɝɢɱɟɫɤɢɦɢ ɚɝɟɧɬɚɦɢ ɢɥɢ ɬɨɤɫɢɧɚɦɢ. ɋɭɛɴɟɤɬɚɦɢ ɞɚɧɧɨɝɨ ɩɪɟɫɬɭɩɥɟɧɢɹ ɹɜɥɹɸɬɫɹ: – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ ɥɚɛɨɪɚɬɨɪɢɣ, ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɯ ɜɟɬɟɪɢɧɚɪɧɵɯ ɭɱɪɟɠɞɟɧɢɣ; – ɪɚɛɨɬɧɢɤɢ ɜɟɬɟɪɢɧɚɪɧɵɯ ɚɩɬɟɤ. ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ – ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ) ɦɨɠɟɬ ɛɵɬɶ ɫɨɜɟɪɲɟɧɨ
ɭɦɵɲɥɟɧɧɨ, ɢɥɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 171 ɍɄ ɊɎ
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 171 ɍɄ ɊɎ (ɇɟɡɚɤɨɧɧɨɟ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɬɜɨ). Ɉɛɴɟɤɬɨɦ
ɩɪɟɫɬɭɩɥɟɧɢɹ ɹɜɥɹɟɬɫɹ ɭɫɬɚɧɨɜɥɟɧɧɵɣ ɩɨɪɹɞɨɤ ɨɫɭɳɟɫɬɜɥɟɧɢɹ ɢ ɥɢɰɟɧɡɢɪɨɜɚɧɢɹ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ.Ɉɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɜɵɪɚɠɚɟɬɫɹ ɤɚɤ ɜ ɞɟɣɫɬɜɢɢ, ɬɚɤ ɢ ɜ ɛɟɡɞɟɣɫɬɜɢɢ.
ɋɭɛɴɟɤɬɨɦ ɩɪɟɫɬɭɩɥɟɧɢɹ ɹɜɥɹɸɬɫɹ: – ɪɭɤɨɜɨɞɢɬɟɥɢ ɜɟɬɟɪɢɧɚɪɧɵɯ ɨɪɝɚɧɢɡɚɰɢɣ, ɡɚɧɢɦɚɸɳɢɯɫɹ
ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɶɸ – ɜɟɬɟɪɢɧɚɪɧɵɟ ɫɩɟɰɢɚɥɢɫɬɵ ɤɚɤ ɹɜɥɹɸɳɢɟ ɢɧɞɢɜɢɞɭɚɥɶɧɵɦɢ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɹɦɢ, ɬɚɤ ɢ ɧɟ ɹɜɥɹɸɳɢɟɫɹ ɢɦɢ. ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɞɚɧɧɨɝɨ ɩɪɟɫɬɭɩɥɟɧɢɹ ɜɵɪɚɠɚɟɬɫɹ ɜɢɧɨɣ ɜ ɜɢɞɟ ɩɪɹɦɨɝɨ ɢɥɢ ɤɨɫɜɟɧɧɨɝɨ ɭɦɵɫɥɚ. ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ
ɫɬɚɬɶɟ 245 ɍɄ ɊɎ ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 245 ɍɄ ɊɎ (ɀɟɫɬɨɤɨɟ ɨɛɪɚɳɟɧɢɟ ɫ ɠɢɜɨɬɧɵɦɢ).Ɉɛɴɟɤɬɨɦ ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ, ɜ ɨɛɥɚɫɬɢ ɝɭɦɚɧɧɨɝɨ ɨɛɪɚɳɟɧɢɹ ɫ ɠɢɜɨɬɧɵɦɢ (ɫɨɞɟɪɠɚɧɢɟ ɢ ɭɛɨɣ). Ɉɛɴɟɤɬɢɜɧɭɸ ɫɬɨɪɨɧɭ ɫɨɫɬɚɜɥɹɟɬ ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ) ɜɵɪɚɠɟɧɧɨɟ ɜ
ɠɟɫɬɨɤɨɦ ɨɛɪɚɳɟɧɢɢ ɫ ɠɢɜɨɬɧɵɦɢ: ɧɟ ɝɭɦɚɧɧɵɣ ɭɛɨɣ ɢ ɩɪɨɜɟɞɟɧɢɟ ɧɚɭɱɧɵɯ ɨɩɵɬɨɜ, ɜɥɟɤɭɳɢɯ ɡɚ
282
ɫɨɛɨɣ ɮɢɡɢɱɟɫɤɢɟ ɢ ɦɨɪɚɥɶɧɵɟ ɫɬɪɚɞɚɧɢɹ ɠɢɜɨɬɧɵɯ. ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ,
ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.);- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ,
ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ); – ɝɪɚɠɞɚɧɟ ɢɧɨɫɬɪɚɧɧɵɯ ɝɨɫɭɞɚɪɫɬɜ, ɧɚɪɭɲɢɜɲɢɟ ɜɟɬɟɪɢɧɚɪɧɨɟ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨ ɜɨ ɜɪɟɦɹ ɧɚɯɨɠɞɟɧɢɹ ɜ ɊɎ.
ɋ ɫɭɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɵ ɞɟɣɫɬɜɢɹ ɦɨɝɭɬ ɛɵɬɶ ɫɨɜɟɪɲɟɧɵ ɭɦɵɲɥɟɧɧɨ ɢɥɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɱɚɫɬɢ ɩɟɪɜɨɣ ɫɬɚɬɶɢ 249 ɍɄ ɊɎ Ɉɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɱɚɫɬɢ ɩɟɪɜɨɣ ɫɬɚɬɶɢ 249 ɍɄ ɊɎ (ɇɚɪɭɲɟɧɢɟ ɜɟɬɟɪɢɧɚɪɧɵɯ ɩɪɚɜɢɥ). Ɉɛɴɟɤɬɨɦ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ
ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ ɜ ɨɛɥɚɫɬɢ ɫɨɛɥɸɞɟɧɢɹ/ɩɪɢɦɟɧɟɧɢɹ ɜɟɬɟɪɢɧɚɪɧɵɯ ɩɪɚɜɢɥ ɞɥɹ
ɩɪɟɞɨɬɜɪɚɳɟɧɢɹ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɷɩɢɡɨɨɬɢɣ ɢ ɢɧɵɯ ɬɹɠɤɢɯ ɩɨɫɥɟɞɫɬɜɢɣ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
Ɉɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɡɚɤɥɸɱɚɟɬɫɹ ɤɚɤ ɜ ɞɟɣɫɬɜɢɢ, ɬɚɤ ɢ ɜ ɛɟɡɞɟɣɫɬɜɢɢ. ɋɭɛɴɟɤɬɚɦɢ ɹɜɥɹɸɬɫɹ – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ,
ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.); – ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ,
ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɪɭɤɨɜɨɞɢɬɟɥɢ ɩɪɟɞɩɪɢɹɬɢɣ, ɰɟɯɨɜ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ, ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɟ, ɬɨɪɝɨɜɥɟ, ɯɪɚɧɟɧɢɸ ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ (ɞɢɪɟɤɬɨɪɚ ɦɹɫɨɤɨɦɛɢɧɚɬɨɜ, ɦɨɥɨɱɧɵɯ ɡɚɜɨɞɨɜ, ɪɚɛɨɬɧɢɤɨɜ ɬɪɚɧɫɩɨɪɬɚ, ɪɭɤɨɜɨɞɢɬɟɥɢ ɩɪɟɞɩɪɢɹɬɢɣ ɨɛɳɟɫɬɜɟɧɧɨɝɨ
ɩɢɬɚɧɢɹ, ɬɨɪɝɨɜɥɢ, ɪɚɛɨɬɧɢɤɨɜ ɪɵɧɤɨɜ ɢ ɬ. ɞ.); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ,
ɮɟɥɶɞɲɟɪɵ). – ɝɪɚɠɞɚɧɟ ɢɧɨɫɬɪɚɧɧɵɯ ɝɨɫɭɞɚɪɫɬɜ, ɧɚɪɭɲɢɜɲɢɟ ɜɟɬɟɪɢɧɚɪɧɨɟ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨ
ɜɨ ɜɪɟɦɹ ɧɚɯɨɠɞɟɧɢɹ ɜ ɊɎ. ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ – ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ) ɦɨɠɟɬ ɛɵɬɶ ɫɨɜɟɪɲɟɧɨ ɭɦɵɲɥɟɧɧɨ, ɢɥɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ .
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
Ɂɚɤɨɧ ɊɎ « Ɉ ɜɟɬɟɪɢɧɚɪɢɢ» ɨɬ 14.05.1993 ɝ.ʋ 4979–1
Ɂɚɤɨɧ ɊɎ «Ɉ ɡɚɳɢɬɟ ɩɪɚɜ ɩɨɬɪɟɛɢɬɟɥɟɣ» ɨɬ 07.02.1992ɝ. ʋ 2300–1;
ɇɨɪɦɚɬɢɜɧɨɟ ɪɟɝɭɥɢɪɨɜɚɧɢɟ ɞɟɹɬɟɥɶɧɨɫɬɢ ɜɟɬɟɪɢɧɚɪɧɨɣ ɫɥɭɠɛɵ ɊɎ/ ɇ.ȿ.Ȼɚɫɤɚɤɨɜɚ, Ⱥ.ɋ. Ɉɝɚɧɟɫɹɧ,
Ɇ.Ⱥ. ɒɢɛɚɟɜ: ɢɧɮɨɪɦɚɰɢɨɧɧɨ-ɚɧɚɥɢɬɢɱɟɫɤɢɣ ɨɛɡɨɪ – ȼɥɚɞɢɦɢɪ: ɎȽȻɍ «ȼɇɂɂɁɀ», 2012. – 75ɫ.
«Ɇɟɬɨɞɢɱɟɫɤɢɟ ɭɤɚɡɚɧɢɹ ɨ ɩɨɪɹɞɤɟ ɧɚɥɨɠɟɧɢɹ ɲɬɪɚɮɨɜ ɡɚ ɧɚɪɭɲɟɧɢɹ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɚ ɢ ɞɪɭɝɢɯ ɧɨɪɦɚɬɢɜɧɵɯ ɚɤɬɨɜ ɊɎ» ɨɬ 08.04.1994 ɝ. ʋ 19–9–2/68, ɭɬɜɟɪɠɞɺɧɧɵɟ Ƚɥɚɜɧɵɦ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɦ ɜɟɬɟɪɢɧɚɪɧɵɦ ɢɧɫɩɟɤɬɨɪɨɦ ɊɎ.
ɍȾɄ 619:34(094.4)
ɈɌȼȿɌɋɌȼȿɇɇɈɋɌɖ ɁȺ ɇȺɊɍɒȿɇɂȿ
ȼȿɌȿɊɂɇȺɊɇɈȽɈ ɁȺɄɈɇɈȾȺɌȿɅɖɋɌȼȺ
ɘɒɄɈȼȺ Ʌ.ə.,
ɎȽȻɇɍ ɂɧɫɬɢɬɭɬ ɗɤɫɩɟɪɢɦɟɧɬɚɥɶɧɨɣ ɜɟɬɟɪɢɧɚɪɢɢ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɝɨ ȼɨɫɬɨɤɚ
ɝ. ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ e-mail:iushkowa.l@yandex.ru
ɒɂɏȺɅȿȼȺ ɇ.Ʌ.,
ɡɚɦ ɝɥɚɜɵ ɚɞɦɢɧɢɫɬɪɚɰɢɢ Ɉɤɬɹɛɪɶɫɤɨɝɨ ɪɚɣɨɧɚ, ɝ. ɇɨɜɨɫɢɛɢɪɫɤɚ ɩɨ ɷɤɨɧɨɦɢɢ ɢ ɞɨɯɨɞɚɦ
ȼɟɬɟɪɢɧɚɪɧɨɟ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɫɨɜɨɤɭɩɧɨɫɬɶ ɩɪɚɜɨɜɵɯ ɧɨɪɦ, ɨɯɜɚɬɵɜɚɸɳɢɯ ɞɟɹɬɟɥɶɧɨɫɬɶ ɜɟɬɟɪɢɧɚɪɧɵɯ ɫɩɟɰɢɚɥɢɫɬɨɜ, ɮɟɪɦɟɪɨɜ, ɤɪɟɫɬɶɹɧ ɢ ɞɪɭɝɢɯ ɪɚɛɨɬɧɢɤɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ. ȼɟɬɟɪɢɧɚɪɧɨɟ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨ ɫɨɫɬɨɢɬ ɢɡ ɧɨɪɦɚɬɢɜɧɵɯ ɩɪɚɜɨɜɵɯ ɚɤɬɨɜ:
- ɮɟɞɟɪɚɥɶɧɨɝɨ ɡɧɚɱɟɧɢɹ;
- ɪɟɝɢɨɧɚɥɶɧɨɝɨ ɡɧɚɱɟɧɢɹ.
Ɏɟɞɟɪɚɥɶɧɵɟ ɧɨɪɦɚɬɢɜɧɵɟ ɚɤɬɵ ɢɦɟɸɬ ɜɵɫɲɭɸ ɸɪɢɞɢɱɟɫɤɭɸ ɫɢɥɭ ɢ ɨɛɹɡɚɬɟɥɶɧɵ ɞɥɹ ɢɫɩɨɥɧɟɧɢɹ ɜɫɟɦɢ ɸɪɢɞɢɱɟɫɤɢɦɢ ɢ ɮɢɡɢɱɟɫɤɢɦɢ ɥɢɰɚɦɢ, ɨɫɭɳɟɫɬɜɥɹɸɳɢɦɢ ɫɜɨɸ ɞɟɹɬɟɥɶɧɨɫɬɶ ɧɚ
ɬɟɪɪɢɬɨɪɢɢ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ (ɞɚɥɟɟ ɊɎ). Ʉ ɢɯ ɱɢɫɥɭ ɨɬɧɨɫɹɬɫɹ: Ʉɨɧɫɬɢɬɭɰɢɹ ɊɎ, ɎɄɁ, ɎɁ,
ɭɤɚɡɵ ɉɪɟɡɢɞɟɧɬɚ, ɩɨɫɬɚɧɨɜɥɟɧɢɹ ɉɪɚɜɢɬɟɥɶɫɬɜɚ, ɚɤɬɵ ɰɟɧɬɪɚɥɶɧɵɯ ɨɪɝɚɧɨɜ ɢɫɩɨɥɧɢɬɟɥɶɧɨɣ
ɜɥɚɫɬɢ, ɢɡɞɚɜɚɟɦɵɟ Ɇɢɧɢɫɬɟɪɫɬɜɨɦ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ, Ɏɟɞɟɪɚɥɶɧɨɣ ɫɥɭɠɛɨɣ ɩɨ ɜɟɬɟɪɢɧɚɪɧɨɦɭ
ɢ ɮɢɬɨɫɚɧɢɬɚɪɧɨɦɭ ɧɚɞɡɨɪɭ ɢ Ⱦɟɩɚɪɬɚɦɟɧɬɨɦ ɜɟɬɟɪɢɧɚɪɢɢ, ɪɟɲɟɧɢɹ, ɩɨɫɬɚɧɨɜɥɟɧɢɹ, ɬɟɯɧɢɱɟɫɤɢɟ ɪɟɝɥɚɦɟɧɬɵ, ɩɪɚɜɢɥɚ ɢ ɞɪɭɝɢɟ ɞɨɤɭɦɟɧɬɵ, ɪɟɝɭɥɢɪɭɸɳɢɟ ɜɟɬɟɪɢɧɚɪɧɭɸ ɞɟɹɬɟɥɶɧɨɫɬɶ.
ɉɨɞ ɬɟɪɦɢɧɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ ɩɨɧɢɦɚɟɬɫɹ ɩɪɨɬɢɜɨɩɪɚɜɧɨɟ, ɜɢɧɨɜɧɨɟ ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ)
ɮɢɡɢɱɟɫɤɨɝɨ ɢɥɢ ɸɪɢɞɢɱɟɫɤɨɝɨ ɥɢɰɚ, ɡɚ ɤɨɬɨɪɨɟ ɭɫɬɚɧɨɜɥɟɧɚ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɧɨɪɦɚɬɢɜɧɨ-ɩɪɚɜɨɜɵɦɢ ɚɤɬɚɦɢ ɊɎ.
283
ȼ ɱɚɫɬɧɨɫɬɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ, ɫɨɜɟɪɲɟɧɧɵɟ ɜ ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɢɢ, ɜɥɟɤɭɬ ɡɚ ɫɨɛɨɣ ɞɢɫɰɢɩɥɢɧɚɪɧɭɸ, ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɭɸ, ɭɝɨɥɨɜɧɭɸ ɢ ɢɧɭɸ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɞɟɣɫɬɜɭɸɳɟɣ
ɪɟɞɚɤɰɢɟɣ ɡɚɤɨɧɚ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ ɨɬ 14 ɦɚɹ 1993 ɝɨɞɚ ʋ4979–1 «Ɉ ɜɟɬɟɪɢɧɚɪɢɢ» ɢ ɢɧɵɦɢ
ɚɤɬɚɦɢ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɚ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ [1,3].
Ⱦɢɫɰɢɩɥɢɧɚɪɧɚɹ ɢ ɦɚɬɟɪɢɚɥɶɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɪɟɞɭɫɦɨɬɪɟɧɚ ɬɪɭɞɨɜɵɦ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨɦ
ɜ ɜɢɞɟ ɫɥɟɞɭɸɳɢɯ ɜɡɵɫɤɚɧɢɣ: ɡɚɦɟɱɚɧɢɟ, ɜɵɝɨɜɨɪ, ɫɬɪɨɝɢɣ ɜɵɝɨɜɨɪ, ɭɜɨɥɶɧɟɧɢɟ ɢ ɬ.ɞ.
ȼ ɰɟɥɹɯ ɫɨɛɥɸɞɟɧɢɹ ɸɪɢɞɢɱɟɫɤɢɦɢ ɥɢɰɚɦɢ, ɢɧɞɢɜɢɞɭɚɥɶɧɵɦɢ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɹɦɢ ɢ ɝɪɚɠɞɚɧɚɦɢ, ɡɚɧɹɬɵɦɢ ɫɨɞɟɪɠɚɧɢɟɦ ɢ ɭɛɨɟɦ ɠɢɜɨɬɧɵɯ ɢ ɨɛɨɪɨɬɨɦ ɩɪɨɞɭɤɰɢɢ ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ, ɬɪɟɛɨɜɚɧɢɣ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɚ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ ɢ ɫɭɛɴɟɤɬɨɜ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ ɜ
ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɢɢ, ɨɫɨɛɨɟ ɦɟɫɬɨ ɨɬɜɨɞɢɬɫɹ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɦ ɦɟɪɚɦ ɜɨɡɞɟɣɫɬɜɢɹ, ɜ ɬɨɦ ɱɢɫɥɟ
ɩɪɢɜɥɟɱɟɧɢɸ ɤ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɣ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɢ ɥɢɰ, ɫɨɜɟɪɲɚɸɳɢɯ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɟ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ [1,2].
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɧɨɫɢɬ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɯɚɪɚɤɬɟɪ, ɬ.ɟ. ɪɟɝɥɚɦɟɧɬɢɪɭɟɬɫɹ
ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɦɢ ɩɨɥɨɠɟɧɢɹɦɢ ɫɬɚɬɟɣ Ʉɨɞɟɤɫɚ ɨɛ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɯ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹɯ ɊɎ (ɞɚɥɟɟ – ɄɨȺɉ ɊɎ), ɤɨɬɨɪɵɟ ɨɩɪɟɞɟɥɹɸɬ ɞɨɥɠɧɨɫɬɧɵɯ ɥɢɰ, ɭɩɨɥɧɨɦɨɱɟɧɧɵɯ ɩɪɢɦɟɧɹɬɶ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɟ ɦɟɪɵ, ɦɟɪɭ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɢ ɢ ɩɟɪɟɱɟɧɶ ɥɢɰ ɤ ɤɨɬɨɪɵɦ ɩɪɢɦɟɧɹɸɬɫɹ ɧɨɪɦɵ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ.
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ – ɜɢɞ ɸɪɢɞɢɱɟɫɤɨɣ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɢ, ɤɨɬɨɪɚɹ ɜɵɪɚɠɚɟɬɫɹ
ɜ ɩɪɢɦɟɧɟɧɢɢ ɭɩɨɥɧɨɦɨɱɟɧɧɵɦ ɨɪɝɚɧɨɦ ɢɥɢ ɞɨɥɠɧɨɫɬɧɵɦ ɥɢɰɨɦ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɧɚɞɡɨɪɚ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɝɨ ɜɡɵɫɤɚɧɢɹ ɤ ɥɢɰɭ, ɫɨɜɟɪɲɢɜɲɟɦɭ ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ ɜ ɨɛɥɚɫɬɢ
ɜɟɬɟɪɢɧɚɪɢɢ. ȼ ɪɹɞɟ ɫɥɭɱɚɟɜ ɤ ɥɢɰɚɦ, ɫɨɜɟɪɲɢɜɲɢɦ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɟ ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ, ɦɨɝɭɬ
ɛɵɬɶ ɩɪɢɦɟɧɟɧɵ ɞɢɫɰɢɩɥɢɧɚɪɧɵɟ ɦɟɪɵ. Ⱥ ɬɚɤ ɠɟ ɜ ɧɟɤɨɬɨɪɵɯ ɫɥɭɱɚɹɯ ɤ ɧɚɪɭɲɢɬɟɥɸ ɦɨɠɟɬ ɛɵɬɶ
ɩɪɢɦɟɧɟɧɨ ɧɟ ɬɨɥɶɤɨ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨɟ, ɧɨ ɢ ɞɢɫɰɢɩɥɢɧɚɪɧɨɟ ɧɚɤɚɡɚɧɢɟ.
ɍɝɨɥɨɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ – ɜɢɞ ɸɪɢɞɢɱɟɫɤɨɣ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɢ, ɤɨɬɨɪɚɹ ɜɵɪɚɠɚɟɬɫɹ ɜ ɩɪɢɦɟɧɟɧɢɢ ɭɩɨɥɧɨɦɨɱɟɧɧɵɦ ɨɪɝɚɧɨɦ ɧɚɤɚɡɚɧɢɹ ɩɪɟɞɭɫɦɨɬɪɟɧɧɨɝɨ ɍɝɨɥɨɜɧɵɦ Ʉɨɞɟɤɫɨɦ Ɋɨɫɫɢɣɫɤɨɣ
Ɏɟɞɟɪɚɰɢɢ (ɞɚɥɟɟ ɍɄ ɊɎ) ɤ ɥɢɰɭ, ɫɨɜɟɪɲɢɜɲɟɦɭ ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ ɜ ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɢɢ.
ɋɨɫɬɚɜ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ
ɉɪɚɜɨɧɚɪɭɲɟɧɢɟ ɜɤɥɸɱɚɟɬ ɜ ɫɟɛɹ ɫɥɟɞɭɸɳɢɟ ɷɥɟɦɟɧɬɵ: ɨɛɴɟɤɬ, ɨɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ, ɫɭɛɴɟɤɬɵ, ɫɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ.
Ɉɛɴɟɤɬɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɨɛɳɟɫɬɜɟɧɧɨɟ ɨɬɧɨɲɟɧɢɟ ɦɟɠɞɭ ɞɨɥɠɧɨɫɬɧɵɦ ɥɢɰɨɦ
ɭɩɨɥɧɨɦɨɱɟɧɧɨɝɨ ɨɪɝɚɧɚ ɢ ɥɢɰɨɦ, ɞɟɹɬɟɥɶɧɨɫɬɶ ɤɨɬɨɪɨɝɨ ɹɜɥɹɟɬɫɹ ɩɨɞɧɚɞɡɨɪɧɨɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ
ɜɟɬɟɪɢɧɚɪɧɨɣ ɫɥɭɠɛɟ.
Ɉɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ – ɷɬɨ ɞɟɹɧɢɟ, ɜɵɪɚɠɟɧɧɨɟ ɜ ɧɚɪɭɲɟɧɢɢ ɭɫɬɚɧɨɜɥɟɧɧɵɯ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨɦ ɧɨɪɦ ɢ ɩɪɚɜɢɥ.
ɋɭɛɴɟɤɬɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɜɦɟɧɹɟɦɵɟ, ɞɨɫɬɢɝɲɢɟ ɨɩɪɟɞɟɥɟɧɧɨɝɨ ɜɨɡɪɚɫɬɚ ɮɢɡɢɱɟɫɤɢɟ, ɞɨɥɠɧɨɫɬɧɵɟ ɥɢɰɚ, ɚ ɬɚɤɠɟ ɥɢɰɚ, ɡɚɧɢɦɚɸɳɢɟɫɹ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɶɸ ɢ
ɨɪɝɚɧɢɡɚɰɢɢ
Ɋɚɡɥɢɱɚɸɬ ɞɜɚ ɜɢɞɚ ɫɭɛɴɟɤɬɨɜ:
- ɢɧɞɢɜɢɞɭɚɥɶɧɵɟ – ɝɪɚɠɞɚɧɟ ɢ ɥɢɰɚ, ɨɛɥɚɞɚɸɳɢɟ ɫɩɟɰɢɚɥɶɧɵɦ ɩɪɚɜɨɜɵɦ ɫɬɚɬɭɫɨɦ (ɞɨɥɠɧɨɫɬɧɵɟ ɥɢɰɚ);53
- ɤɨɥɥɟɤɬɢɜɧɵɟ – ɸɪɢɞɢɱɟɫɤɢɟ ɢ ɢɧɵɟ ɤɨɥɥɟɤɬɢɜɧɵɟ ɨɛɪɚɡɨɜɚɧɢɹ, ɫɨɜɟɪɲɢɜɲɢɟ ɩɪɚɜɨɧɚɪɭɲɟɧɢɟ.
ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ – ɷɬɨ ɫɨɜɨɤɭɩɧɨɫɬɶ ɩɪɢɡɧɚɤɨɜ, ɯɚɪɚɤɬɟɪɢɡɭɸɳɢɯ ɫɩɨɫɨɛɧɨɫɬɶ ɥɢɰɚ ɨɬɜɟɱɚɬɶ ɡɚ ɩɪɨɬɢɜɨɩɪɚɜɧɨɟ ɞɟɹɧɢɟ ɢ, ɧɚɥɢɱɢɟ ɜɢɧɵ (ɜ ɮɨɪɦɟ ɭɦɵɫɥɚ ɢɥɢ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ).
ɉɪɢɦɟɧɟɧɢɟ ɧɨɪɦ ɄɨȺɉ ɊɎ ɩɪɢ ɧɚɪɭɲɟɧɢɹɯ ɜ ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɢɢ.
Ʉ ɨɪɝɚɧɚɦ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɧɚɞɡɨɪɚ ɩɪɚɜɨɦɨɱɧɵɦ ɩɪɢɧɢɦɚɬɶ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɟ ɦɟɪɵ ɩɨ ɫɬɚɬɶɹɦ ɄɨȺɉ ɊɎ, ɨɬɧɨɫɹɬɫɹ:
- ɮɟɞɟɪɚɥɶɧɵɣ ɨɪɝɚɧ ɢɫɩɨɥɧɢɬɟɥɶɧɨɣ ɜɥɚɫɬɢ ɜ ɨɛɥɚɫɬɢ ɧɨɪɦɚɬɢɜɧɨ- ɩɪɚɜɨɜɨɝɨ ɪɟɝɭɥɢɪɨɜɚɧɢɹ
ɜ ɫɮɟɪɟ ɜɟɬɟɪɢɧɚɪɢɢ;
- ɮɟɞɟɪɚɥɶɧɵɣ ɨɪɝɚɧ ɢɫɩɨɥɧɢɬɟɥɶɧɨɣ ɜɥɚɫɬɢ ɜ ɨɛɥɚɫɬɢ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɧɚɞɡɨɪɚ ɢ ɟɝɨ ɬɟɪɪɢɬɨɪɢɚɥɶɧɵɟ ɨɪɝɚɧɵ;
- ɢɫɩɨɥɧɢɬɟɥɶɧɵɟ ɨɪɝɚɧɵ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɜɥɚɫɬɢ ɫɭɛɴɟɤɬɨɜ Ɋɨɫɫɢɣɫɤɨɣ Ɏɟɞɟɪɚɰɢɢ ɜ ɨɛɥɚɫɬɢ
ɜɟɬɟɪɢɧɚɪɢɢ.
Ɋɚɫɫɦɚɬɪɢɜɚɬɶ ɞɟɥɚ ɨɛ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɵɯ ɧɚɪɭɲɟɧɢɹɯ ɨɬ ɢɦɟɧɢ ɨɪɝɚɧɨɜ ɭɤɚɡɚɧɧɵɯ ɜɵɲɟ,
ɜɩɪɚɜɟ:
- ɝɥɚɜɧɵɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɜɟɬɟɪɢɧɚɪɧɵɣ ɢɧɫɩɟɤɬɨɪ ɊɎ, ɟɝɨ ɡɚɦɟɫɬɢɬɟɥɢ;
- ɝɥɚɜɧɵɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɟ ɜɟɬɟɪɢɧɚɪɧɵɟ ɢɧɫɩɟɤɬɨɪɵ ɫɭɛɴɟɤɬɨɜ ɊɎ, ɢɯ ɡɚɦɟɫɬɢɬɟɥɢ;
- ɝɥɚɜɧɵɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɟ ɜɟɬɟɪɢɧɚɪɧɵɟ ɢɧɫɩɟɤɬɨɪɵ ɝɨɪɨɞɨɜ, ɪɚɣɨɧɨɜ, ɢɯ ɡɚɦɟɫɬɢɬɟɥɢ;
- ɝɥɚɜɧɵɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɟ ɜɟɬɟɪɢɧɚɪɧɵɟ ɢɧɫɩɟɤɬɨɪɵ ɡɨɧɚɥɶɧɵɯ ɭɩɪɚɜɥɟɧɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ
ɧɚɞɡɨɪɚ ɧɚ ɝɪɚɧɢɰɟ ɢ ɬɪɚɧɫɩɨɪɬɟ;
284
- ɝɥɚɜɧɵɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɟ ɜɟɬɟɪɢɧɚɪɧɵɟ ɢɧɫɩɟɤɬɨɪɵ ɬɟɪɪɢɬɨɪɢɣ, ɨɛɫɥɭɠɢɜɚɟɦɵɯ ɜɨɡɝɥɚɜɥɹɟɦɵɦɢ ɢɦɢ ɜɟɬɟɪɢɧɚɪɧɵɦɢ ɥɟɱɟɛɧɢɰɚɦɢ, ɜɟɬɟɪɢɧɚɪɧɵɦɢ ɩɭɧɤɬɚɦɢ.54
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.6 ɄɨȺɉ ɊɎ
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.6 ɄɨȺɉ ɊɎ (ɇɚɪɭɲɟɧɢɟ ɩɪɚɜɢɥ ɤɚɪɚɧɬɢɧɚ
ɠɢɜɨɬɧɵɯ ɢɥɢ ɞɪɭɝɢɯ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɯ ɩɪɚɜɢɥ). Ɉɛɴɟɤɬɨɦ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ
ɨɛɟɫɩɟɱɟɧɢɟ ɜɟɬɟɪɢɧɚɪɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɬɟɪɪɢɬɨɪɢɢ ɊɎ ɢ ɟɟ ɫɭɛɴɟɤɬɨɜ.
Ɉɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɨɣ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɞɟɣɫɬɜɢɟ ɢɥɢ ɛɟɡɞɟɣɫɬɜɢɟ, ɤɨɬɨɪɨɟ ɜɥɟɱɟɬ ɡɚ
ɫɨɛɨɣ ɧɚɪɭɲɟɧɢɟ ɩɪɚɜɢɥ ɤɚɪɚɧɬɢɧɚ ɢɥɢ ɞɪɭɝɢɯ ɜɟɬɟɪɢɧɚɪɧɵɯ ɩɪɚɜɢɥ.
ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɦɨɝɭɬ ɛɵɬɶ – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.);
- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ);
– ɪɭɤɨɜɨɞɢɬɟɥɢ ɩɪɟɞɩɪɢɹɬɢɣ, ɰɟɯɨɜ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ, ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɟ, ɬɨɪɝɨɜɥɟ, ɯɪɚɧɟɧɢɸ
ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ (ɞɢɪɟɤɬɨɪɚ ɦɹɫɨɤɨɦɛɢɧɚɬɨɜ, ɦɨɥɨɱɧɵɯ ɡɚɜɨɞɨɜ, ɪɚɛɨɬɧɢɤɨɜ ɬɪɚɧɫɩɨɪɬɚ, ɪɭɤɨɜɨɞɢɬɟɥɢ ɩɪɟɞɩɪɢɹɬɢɣ ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɩɢɬɚɧɢɹ, ɬɨɪɝɨɜɥɢ, ɪɚɛɨɬɧɢɤɨɜ ɪɵɧɤɨɜ ɢ ɬ. ɞ.).
ɋɭɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɨɣ ɞɚɧɧɨɝɨ ɩɪɨɬɢɜɨɩɪɚɜɧɨɝɨ ɞɟɹɧɢɹ ɦɨɠɟɬ ɛɵɬɶ ɩɪɹɦɨɣ ɢɥɢ ɤɨɫɜɟɧɧɵɣ
ɭɦɵɫɟɥ.
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.7 ɄɨȺɉ ɊɎ
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.7 ɄɨȺɉ ɊɎ (ɋɨɤɪɵɬɢɟ ɫɜɟɞɟɧɢɣ ɨ ɜɧɟɡɚɩɧɨɦ
ɩɚɞɟɠɟ ɠɢɜɨɬɧɵɯ ɢɥɢ ɨɛ ɨɞɧɨɜɪɟɦɟɧɧɵɯ ɦɚɫɫɨɜɵɯ ɡɚɛɨɥɟɜɚɧɢɣ ɠɢɜɨɬɧɵɯ).
Ɉɛɴɟɤɬɨɦ ɧɚɫɬɨɹɳɟɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ ɜ ɨɛɥɚɫɬɢ ɩɪɨɮɢɥɚɤɬɢɤɢ ɡɚɪɚɡɧɵɯ ɢ ɦɚɫɫɨɜɵɯ ɧɟɡɚɪɚɡɧɵɯ ɛɨɥɟɡɧɟɣ ɠɢɜɨɬɧɵɯ, ɚ ɬɚɤ ɠɟ ɜ ɨɛɥɚɫɬɢ ɭɫɬɚɧɨɜɥɟɧɧɵɯ
ɜɟɬɟɪɢɧɚɪɧɨ- ɫɚɧɢɬɚɪɧɵɯ ɩɪɚɜɢɥ.
Ɉɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɡɚɤɥɸɱɚɟɬɫɹ ɤɚɤ ɜ ɞɟɣɫɬɜɢɢ, ɬɚɤ ɢ ɛɟɡɞɟɣɫɬɜɢɢ.
ɋɭɛɴɟɤɬɵ – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ
ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.)
- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ);
- ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ);
- ɝɪɚɠɞɚɧɟ ɢɧɨɫɬɪɚɧɧɵɯ ɝɨɫɭɞɚɪɫɬɜ, ɧɚɪɭɲɢɜɲɢɟ ɜɟɬɟɪɢɧɚɪɧɨɟ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨ ɜɨ ɜɪɟɦɹ ɧɚɯɨɠɞɟɧɢɹ ɜ ɊɎ.
ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ – ɩɪɨɬɢɜɨɩɪɚɜɧɵɟ ɞɟɣɫɬɜɢɹ (ɛɟɡɞɟɣɫɬɜɢɹ), ɜɵɪɚɠɟɧɧɵɟ: ɜ ɫɨɤɪɵɬɢɢ
ɫɜɟɞɟɧɢɣ, ɧɟɫɜɨɟɜɪɟɦɟɧɧɨɦ ɢɡɜɟɳɟɧɢɢ ɨɪɝɚɧɨɜ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɜɟɬɟɪɢɧɚɪɧɨɝɨ ɧɚɞɡɨɪɚ, ɧɟɫɜɨɟɜɪɟɦɟɧɧɨɦ ɩɪɢɧɹɬɢɢ ɦɟɪ ɥɢɛɨ ɧɟɩɪɢɧɹɬɢɟ ɦɟɪ ɩɪɢ ɜɧɟɡɚɩɧɨɦ ɩɚɞɟɠɟ ɠɢɜɨɬɧɵɯ ɢɥɢ ɨɛ ɨɞɧɨɜɪɟɦɟɧɧɨɦ ɦɚɫɫɨɜɨɦ ɡɚɛɨɥɟɜɚɧɢɢ ɠɢɜɨɬɧɵɯ. Ⱦɚɧɧɵɟ ɞɟɣɫɬɜɢɹ ɦɨɝɭɬ ɛɵɬɶ ɤɚɤ ɭɦɵɲɥɟɧɧɵɦɢ, ɬɚɤ ɢ
ɫɨɜɟɪɲɟɧɧɵɦɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.8 ɄɨȺɉ ɊɎ
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.8 ɄɨȺɉ ɊɎ (ɇɚɪɭɲɟɧɢɟ ɜɟɬɟɪɢɧɚɪɧɨ-ɫɚɧɢɬɚɪɧɵɯ ɩɪɚɜɢɥ ɩɟɪɟɜɨɡɤɢ ɢɥɢ ɭɛɨɹ ɠɢɜɨɬɧɵɯ, ɩɪɚɜɢɥ ɩɟɪɟɪɚɛɨɬɤɢ, ɯɪɚɧɟɧɢɹ ɢɥɢ ɪɟɚɥɢɡɚɰɢɢ ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ). Ɉɛɴɟɤɬɨɦ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ ɜ
ɨɛɥɚɫɬɢ ɩɪɚɤɬɢɱɟɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ, ɧɚɩɪɚɜɥɟɧɧɨɣ ɧɚ ɩɪɟɞɭɩɪɟɠɞɟɧɢɟ ɛɨɥɟɡɧɟɣ ɠɢɜɨɬɧɵɯ, ɜɵɩɭɫɤɚ ɛɟɡɨɩɚɫɧɨɣ ɜ ɜɟɬɟɪɢɧɚɪɧɨɦ ɨɬɧɨɲɟɧɢɢ ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɢ ɡɚɳɢɬɚ ɧɚɫɟɥɟɧɢɹ ɨɬ
ɛɨɥɟɡɧɟɣ ɨɛɳɢɯ ɞɥɹ ɱɟɥɨɜɟɤɚ ɢ ɠɢɜɨɬɧɵɯ.
Ɉɛɴɟɤɬɢɜɧɭɸ ɫɬɨɪɨɧɭ ɫɨɫɬɚɜɥɹɸɬ ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ) ɜɵɪɚɠɟɧɧɨɟ ɜ ɧɚɪɭɲɟɧɢɢ ɜɟɬɟɪɢɧɚɪɧɵɯ ɩɪɚɜɢɥ ɩɪɢ ɨɫɭɳɟɫɬɜɥɟɧɢɢ: ɦɟɠɞɭɧɚɪɨɞɧɵɯ 56 (ɷɤɫɩɨɪɬ, ɢɦɩɨɪɬ, ɬɪɚɧɡɢɬ) ɢ ɜɧɭɬɪɟɧɧɢɯ
ɩɟɪɟɜɨɡɨɤ ɠɢɜɨɬɧɵɯ; ɭɛɨɹ ɠɢɜɨɬɧɵɯ; ɩɟɪɟɪɚɛɨɬɤɟ, ɯɪɚɧɟɧɢɢ ɢ/ɢɥɢ ɪɟɚɥɢɡɚɰɢɢ ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ.
ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɩɪɢɡɧɚɸɬɫɹ – ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.);
- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ);
- ɪɭɤɨɜɨɞɢɬɟɥɢ ɩɪɟɞɩɪɢɹɬɢɣ, ɰɟɯɨɜ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ, ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɟ, ɬɨɪɝɨɜɥɟ, ɯɪɚɧɟɧɢɸ ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ (ɞɢɪɟɤɬɨɪɚ ɦɹɫɨɤɨɦɛɢɧɚɬɨɜ, ɦɨɥɨɱɧɵɯ ɡɚɜɨɞɨɜ, ɪɚɛɨɬɧɢɤɨɜ ɬɪɚɧɫɩɨɪɬɚ,
ɪɭɤɨɜɨɞɢɬɟɥɢ ɩɪɟɞɩɪɢɹɬɢɣ ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɩɢɬɚɧɢɹ, ɬɨɪɝɨɜɥɢ, ɪɚɛɨɬɧɢɤɨɜ ɪɵɧɤɨɜ ɢ ɬ. ɞ.); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ).
ɋ ɫɭɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɵ ɭɤɚɡɚɧɧɵɟ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɦɨɝɭɬ ɛɵɬɶ ɫɨɜɟɪɲɟɧɧɵ ɤɚɤ ɭɦɵɲɥɟɧɧɨ,
ɬɚɤ ɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
285
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬɚɬɶɟ 10.11 ɄɨȺɉ ɊɎ
Ⱥɞɦɢɧɢɫɬɪɚɬɢɜɧɚɹ ɨɬɜɟɬɫɬɜɟɧɧɨɫɬɶ ɩɨ ɫɬ. 10.11 ɄɨȺɉ ɊɎ (ɇɚɪɭɲɟɧɢɟ ɧɨɪɦ ɢ ɩɪɚɜɢɥ ɜɟɞɟɧɢɹ
ɩɥɟɦɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ).
Ɉɛɴɟɤɬɨɦ ɞɚɧɧɨɝɨ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ ɨɛɳɟɫɬɜɟɧɧɵɟ ɨɬɧɨɲɟɧɢɹ ɜ ɨɛɥɚɫɬɢ ɩɪɚɤɬɢɱɟɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɩɨ ɪɚɡɜɟɞɟɧɢɸ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɨɢɡɜɨɞɫɬɜɭ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɸ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɚɬɟɪɢɚɥɚ).
Ɉɛɴɟɤɬɢɜɧɨɣ ɫɬɨɪɨɧɨɣ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɟɬɫɹ ɞɟɣɫɬɜɢɟ (ɛɟɡɞɟɣɫɬɜɢɟ) ɩɪɢ ɨɫɭɳɟɫɬɜɥɟɧɢɢ
ɩɪɨɰɟɫɫɚ ɜɨɫɩɪɨɢɡɜɨɞɫɬɜɚ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɜ ɰɟɥɹɯ ɭɥɭɱɲɟɧɢɹ ɩɪɨɞɭɤɬɢɜɧɵɯ ɤɚɱɟɫɬɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɢ ɪɚɡɜɟɞɟɧɢɹ ɜɵɫɨɤɨɩɪɨɞɭɤɬɢɜɧɵɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɫɨɯɪɚɧɟɧɢɹ ɝɟɧɨɮɨɧɞɚ ɦɚɥɨɱɢɫɥɟɧɧɵɯ ɢ ɢɫɱɟɡɚɸɳɢɯ ɩɨɪɨɞ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɨɥɟɡɧɵɯ ɞɥɹ ɫɟɥɟɤɰɢɨɧɧɵɯ ɰɟɥɟɣ. ɋɭɛɴɟɤɬɚɦɢ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ ɹɜɥɹɸɬɫɹ – ɸɪɢɞɢɱɟɫɤɢɟ
ɥɢɰɚ, ɨɫɭɳɟɫɬɜɥɹɸɳɟɟ ɪɚɡɜɟɞɟɧɢɟ ɩɥɟɦɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɩɪɨɢɡɜɨɞɫɬɜɨ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɚɬɟɪɢɚɥɚ) ɜ ɫɟɥɟɤɰɢɨɧɧɵɯ ɰɟɥɹɯ, ɚ ɬɚɤɠɟ ɨɤɚɡɚɧɢɟ ɭɫɥɭɝ ɜ ɨɛɥɚɫɬɢ ɩɥɟɦɟɧɧɨɝɨ
ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ;
- ɪɭɤɨɜɨɞɢɬɟɥɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ, ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɨɪɝɚɧɢɡɚɰɢɣ (ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɤɨɦɩɥɟɤɫɨɜ, ɩɬɢɰɟɮɚɛɪɢɤ, ɩɨɞɫɨɛɧɵɯ ɯɨɡɹɣɫɬɜ, ɚɤɰɢɨɧɟɪɧɵɯ ɨɛɳɟɫɬɜ, ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɬɨɜɚɪɢɳɟɫɬɜ, ɚɫɫɨɰɢɚɰɢɹɦɢ, ɡɚɜɟɞɭɸɳɢɟ ɮɟɪɦɚɦɢ, ɧɚɱɚɥɶɧɢɤɢ ɰɟɯɨɜ ɢ ɬ. ɞ.);
- ɠɢɜɨɬɧɨɜɨɞɵ (ɮɟɪɦɟɪɵ, ɤɪɟɫɬɶɹɧɟ, ɚɪɟɧɞɚɬɨɪɵ ɢ ɞɪɭɝɢɟ ɪɚɛɨɬɧɢɤɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ); – ɜɟɬɟɪɢɧɚɪɧɵɟ ɪɚɛɨɬɧɢɤɢ (ɜɟɬɟɪɢɧɚɪɧɵɟ ɜɪɚɱɢ, ɮɟɥɶɞɲɟɪɵ);
- ɝɪɚɠɞɚɧɟ ɢɧɨɫɬɪɚɧɧɵɯ ɝɨɫɭɞɚɪɫɬɜ, ɧɚɪɭɲɢɜɲɢɟ ɜɟɬɟɪɢɧɚɪɧɨɟ ɡɚɤɨɧɨɞɚɬɟɥɶɫɬɜɨ ɜɨ ɜɪɟɦɹ ɧɚɯɨɠɞɟɧɢɹ ɜ ɊɎ.
ɋɭɛɴɟɤɬɢɜɧɚɹ ɫɬɨɪɨɧɚ ɩɪɚɜɨɧɚɪɭɲɟɧɢɹ – ɩɪɨɬɢɜɨɩɪɚɜɧɵɟ ɞɟɣɫɬɜɢɹ, ɫɨɜɟɪɲɚɟɦɵɟ ɤɚɤ ɭɦɵɲɥɟɧɧɨ, ɬɚɤ ɢ ɩɨ ɧɟɨɫɬɨɪɨɠɧɨɫɬɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
286
Ɂɚɤɨɧ ɊɎ «Ɉ ɡɚɳɢɬɟ ɩɪɚɜ ɩɨɬɪɟɛɢɬɟɥɟɣ» ɨɬ 07.02.1992ɝ. ʋ 2300–1;
ɇɨɪɦɚɬɢɜɧɨɟ ɪɟɝɭɥɢɪɨɜɚɧɢɟ ɞɟɹɬɟɥɶɧɨɫɬɢ ɜɟɬɟɪɢɧɚɪɧɨɣ ɫɥɭɠɛɵ ɊɎ/ ɇ.ȿ.Ȼɚɫɤɚɤɨɜɚ, Ⱥ.ɋ. Ɉɝɚɧɟɫɹɧ,
Ɇ.Ⱥ. ɒɢɛɚɟɜ: ɢɧɮɨɪɦɚɰɢɨɧɧɨ-ɚɧɚɥɢɬɢɱɟɫɤɢɣ ɨɛɡɨɪ – ȼɥɚɞɢɦɢɪ: ɎȽȻɍ «ȼɇɂɂɁɀ», 2012. – 75ɫ.
ɆȿɏȺɇɂɁȺɐɂə, ɗɅȿɄɌɊɂɎɂɄȺɐɂə
ɂ ȺȼɌɈɆȺɌɂɁȺɐɂə
ECOLOGICALLY PURE SOLAR EQUIPMENT FOR THE
INSECTICIDE
BUUVEIBAATAR R., AMGALANZUL J., MUNKH-ERDENE B., GANBOLD D.,
School of Engineering and Technology , Mongolian University of Life Sciences, Mongolia,
amgalanzul@muls.edu.mn
Abstract
We have done research on debugging of insects by high voltage electric field using solar energy and
this method has been successfully tested in Juny-October 2008 at “Nart” training and research center of
MULS in Bornuur soum, Tuv province.
Key words
Solar panel, accumulator, inverter, high voltage, debugging
Introduction
Scientists had been determined that the insects in the crop field are decreasing the harvest by 30–50 %
per hectare and loosing that much amount of incomings [1]. Several methods physical, chemical and
biological etc, have been developed to debugging those insects, but they still costly and bringing the new
problem to the environment and human health.
Materials and Methods
The experiment has done in scale of both laboratory and crop field within theoretical calculation.
Insects debugging equipment has three main parts (solar panel, control panel and lightening trap) it
has shown in figure-1.
Fig. 1. General Diagram for solar power generation
287
Solar panel collects energy to 12–24v accumulator at day time and the energy inverted to alternative
current 220V switches on light trap at night time. The voltage increased to 7000V (7kV) by transformer.
Insects trapped by light are destroyed by the high voltage at night time. The method has not been done by
anyone before in Mongolia and also this is the safe to the environment with using no harmful chemicals
or biological bacteria. This was novity of our research.
High voltage light trap system was turned on for 1 hour at night time per 1 hectare the crop field in
“Nart” training and research center. Debugged insects are studied then.
Results
To debugging the insects by high voltage is a kind of electric-ion technology.
Mechanism for debugging: Insects which are trapped by lights will be destroyed by high voltage
(Figure2).
Fig. 2. Technology scheme for high-voltage light trap system
SE-solar energy; SP-Solar panel; EE-electric energy; B-battery; ICB-inverter and control box; HVShigh voltage source; DL-daylight; CEF-corona electric field; DI-dead insects; FC- food of cock
Huge amount of harmful insects were killed by high voltage light trap system (Figure-3).
Fig 3. Types of destroyed insects by light trap system.
Capacity and normal parameters of high voltage light trapping system
Solar panel’s power (4*60W)240W
Normal circulation 7.5À
High voltage 7000V
Constant voltage 12–24V
Battery capacity (2*100À·h) 200À·h
Alternative voltage 110/220V
Daylight power (2·40 W) 80W
Control box and inventor power 1000W
Equipment height 2.0m
Length of cable
200…500m
Protect active area
1,0hectare
Productivity destruction of insects 1,0…3,0 kg/day
Light trap system’s weight 400,0 kg
Light trap system’s price
5,000$
Figure 4. High voltage light trap at field
288
This system used 2 lamps (40W, 220v) high voltage magnetic field initiator, 2 columns, pedestal.
Trapped insects were collected bottom of the lights. Two columns were separated from land by polymer
material, which provides electric safety work.
Fig 5. Active section of the equipment for destruction of insects in high voltage and light system
The system of high voltage; 2- insulator; 3- defend cage; 4- daylight; 5- corona electric field; 6- spilling;
7- clamp; 8- cord; 9- high voltage insulator
Discussion
We are used unique, new gadget at first time in Mongolia to debugging of insects on this research.
Advantages of the study are as follows:
Do not uses harmful chemicals
Expected insects to be killed per day, 2kg
The equipment could be moved to everywhere because of it uses the solar energy
No cost for power consumption
Huge amount of insects could be killed by high voltage at night time
Loss of harvest due to insects could be reduced to 30–50 %
Capacity of an equipment is 3-5 hectare.
Income of saved vegetable is 4tn*700 000 Ƚɚ = 2 800 000
Solar panel could be used over 40 years
Killed insects could be used to feeding of chicken
Conclusions
We have done a research on insects killing by high voltage using solar energy at “Nart” center in
2007–2008. Results are as follows:
Approximately 2–3 kg insects were killed per day and those insects were prepared for chicken food.
Capacity of equipment is determined to 1–3 hectare.
From last 10 day of June to first 10 day of July is the most spreading time for insects. So, we need to
do research on insects at that time depending on landscape for further study.
References
1.
2.
3.
4.
E. D. Krofacheva. Management and work plan on the protection of agriculture plant. Moscow., 1986.
D. Nasandulam. Vegetable insects and fight methods with it. Agricultural journal. UB., 2002.
Buuveibaatar.R. Research of solar energy equipment to debugging of insects. Report for Canadian project,
2008.
D. Nasandulam. Results of measurement photosynthesis radiation for leafs of plants by Plutella maculipennis
Curt. UB., 2002.
289
ɍȾɄ 631.363.2
ɗɄɋɉȿɊɂɆȿɇɌȺɅɖɇɕȿ ɂɋɋɅȿȾɈȼȺɇɂə
ɉɈ ɈȻɈɋɇɈȼȺɇɂɘ ɉȺɊȺɆȿɌɊɈȼ ɆȺɒɂɇ Ʌɂɇɂɂ
ɉɊɂȽɈɌɈȼɅȿɇɂə ȼɂɌȺɆɂɇɇɈ-ɌɊȺȼəɇɈɃ ɆɍɄɂ
ɂɁ ɅɂɋɌɈȼɈɃ ɑȺɋɌɂ ɌɊȺȼ
ȺȻɂɅɀȺɇɈȼ Ⱦ.Ɍ., ȺȻɂɅɀȺɇɍɅɕ Ɍ., ȺȾɂɅɖɒȿȿȼ Ⱥ.ɋ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɦɟɯɚɧɢɡɚɰɢɢ
ɢ ɷɥɟɤɬɪɢɮɢɤɚɰɢɢ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ» kazniimesh@yandex.kz
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɨɜɵɲɟɧɢɟ ɦɹɫɨɦɨɥɨɱɧɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɠɢɜɨɬɧɵɯ ɡɚɜɢɫɢɬ ɨɬ ɤɚɱɟɫɬɜɚ
ɪɚɡɞɚɜɚɟɦɵɯ ɤɨɪɦɨɜ. ɉɪɢɝɨɬɨɜɥɟɧɢɟ ɩɨɥɧɨɪɚɰɢɨɧɧɵɯ ɤɨɪɦɨɫɦɟɫɟɣ ɞɥɹ ɜɫɟɯ ɠɢɜɨɬɧɵɯ ɢ ɩɬɢɰ
ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɫ ɞɨɛɚɜɥɟɧɢɟɦ ɤɨɦɛɢɤɨɪɦɨɜ. ȼɨ ɜɫɟɯ ɪɟɰɟɩɬɚɯ ɤɨɦɛɢɤɨɪɦɨɜ ɨɞɧɢɦ ɢɡ ɨɫɧɨɜɧɵɯ
ɤɨɦɩɨɧɟɧɬɨɜ ɹɜɥɹɟɬɫɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɚɹ ɦɭɤɚ.
Ɋɚɧɟɟ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ ɜɵɩɭɫɤɚɥɢɫɶ ɚɝɪɟɝɚɬɵ ɬɢɩɚ ȺȼɆ. ȼ ɷɬɢɯ
ɚɝɪɟɝɚɬɚɯ ɩɪɢɝɨɬɨɜɥɟɧɢɟ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ ɨɫɭɳɟɫɬɜɥɹɥɨɫɶ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɞɢɡɟɥɶɧɨɝɨ
ɬɨɩɥɢɜɚ. Ʉɪɨɦɟ ɬɨɝɨ, ɷɬɢ ɚɝɪɟɝɚɬɵ ɨɱɟɧɶ ɦɟɬɚɥɥɨɟɦɤɢɟ ɢ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɨɧɢ ɢɦɟɸɬ ɜɵɫɨɤɭɸ
ɫɬɨɢɦɨɫɬɶ.
Ⱦɥɹ ɪɟɲɟɧɢɹ ɞɚɧɧɨɣ ɩɪɨɛɥɟɦɧɨɣ ɡɚɞɚɱɢ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɧɚɦɢ ɩɪɟɞɥɨɠɟɧ ɧɨɜɵɣ ɫɩɨɫɨɛ
ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ ɢɡ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ ɛɟɡ ɩɪɢɦɟɧɟɧɢɹ ɞɢɡɟɥɶɧɨɝɨ ɬɨɩɥɢɜɚ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɧɚɦɢ ɪɚɡɪɚɛɨɬɚɧɚ ɥɢɧɢɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ, ɢɦɟɸɳɚɹ ɦɚɫɫɭ ɜ 9,0 ɪɚɡ ɦɟɧɶɲɟ ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɚɝɪɟɝɚɬɨɦ ȺȼɆ-0,4.
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɧɵɯ ɬɟɨɪɟɬɢɱɟɫɤɢɯ ɢ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɵɥɢ ɨɛɨɫɧɨɜɚɧɵ ɨɫɧɨɜɧɵɟ ɩɚɪɚɦɟɬɪɵ ɦɚɲɢɧ ɞɚɧɧɨɣ ɥɢɧɢɢ [1…4]. ȼ 2014 ɝɨɞɭ ɛɵɥɢ ɩɪɨɜɟɞɟɧɵ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨ ɨɛɨɫɧɨɜɚɧɢɸ ɧɟɤɨɬɨɪɵɯ ɩɚɪɚɦɟɬɪɨɜ ɦɚɥɨɝɚɛɚɪɢɬɧɨɣ ɫɭɲɢɥɶɧɨɣ ɭɫɬɚɧɨɜɤɢ ɢ ɫɟɩɚɪɚɬɨɪɚ ɦɟɥɤɨɣ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ.
ɉɪɢ ɩɪɨɜɟɞɟɧɢɢ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɨɛɨɫɧɨɜɚɧɢɸ ɧɟɤɨɬɨɪɵɯ ɩɚɪɚɦɟɬɪɨɜ ɦɚɲɢɧ ɥɢɧɢɢ ɛɵɥɢ ɢɫɩɨɥɶɡɨɜɚɧɵ ɤɨɪɦɨɭɛɨɪɨɱɧɵɣ ɚɝɪɟɝɚɬ, ɫɨɫɬɨɹɳɢɣ ɢɡ ɬɪɚɤɬɨɪɚ ɆɌɁ-80, ɩɨɞɛɨɪɳɢɤ-ɢɡɦɟɥɶɱɢɬɟɥɶ ɤɨɪɦɨɜ ɉɂɄ-1,8 (ɪɚɡɪɚɛɨɬɤɚ ɌɈɈ «ɄɚɡɇɂɂɆɗɋɏ») ɫ ɲɢɪɢɧɨɣ ɡɚɯɜɚɬɚ 1,8 ɦ
ɢ ɬɟɥɟɠɤɚ 2ɉɌɋ-4.
ɉɨ ɩɪɟɞɥɚɝɚɟɦɨɣ ɧɨɜɨɣ ɬɟɯɧɨɥɨɝɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ, ɥɸɰɟɪɧɚ ɩɨɫɥɟ
ɫɤɚɲɢɜɚɧɢɹ ɩɨɞɫɭɲɢɜɚɟɬɫɹ ɧɚ ɩɪɨɤɨɫɟ ɞɨ ɜɥɚɠɧɨɫɬɢ 30…35 %, ɩɨɫɥɟ ɱɟɝɨ ɩɪɨɜɹɥɟɧɧɚɹ ɬɪɚɜɚ
ɩɨɞɛɢɪɚɟɬɫɹ ɩɪɹɦɨ ɫ ɩɪɨɤɨɫɚ ɢ ɩɨɞɚɟɬɫɹ ɜ ɬɟɥɟɠɤɭ.
ɉɪɢ ɩɨɞɛɨɪɟ ɩɪɨɜɹɥɟɧɧɨɣ ɥɸɰɟɪɧɵ ɢɡ ɤɚɦɟɪɵ ɢɡɦɟɥɶɱɟɧɢɹ ɩɨɞɛɨɪɳɢɤɚ-ɢɡɦɟɥɶɱɢɬɟɥɹ ɫɧɢɦɚɸɬɫɹ ɜɫɟ ɪɹɞɵ ɤɨɧɬɪɦɨɥɨɬɤɨɜ, ɬ.ɟ. ɜ ɞɚɧɧɨɦ ɫɥɭɱɚɟ ɩɨɞɛɨɪɳɢɤ-ɢɡɦɟɥɶɱɢɬɟɥɶ ɢɫɩɨɥɶɡɭɟɬɫɹ ɞɥɹ
ɩɨɞɛɨɪɚ ɢ ɩɨɝɪɭɡɤɢ ɩɪɨɜɹɥɟɧɧɨɣ ɥɸɰɟɪɧɵ ɜ ɤɭɡɨɜ ɬɟɥɟɠɤɢ. Ⱦɚɥɟɟ ɩɪɨɜɹɥɟɧɧɚɹ ɬɪɚɜɚ ɬɪɚɧɫɩɨɪɬɢɪɭɟɬɫɹ ɩɨɞ ɧɚɜɟɫ, ɝɞɟ ɭɫɬɚɧɨɜɥɟɧɚ ɥɢɧɢɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ ɢ ɩɪɨɢɡɜɨɞɢɬɫɹ
ɩɨɞɫɭɲɤɚ ɫɟɧɚ ɞɨ ɜɥɚɠɧɨɫɬɢ 14…16 % ɧɚ ɦɚɥɨɝɚɛɚɪɢɬɧɨɣ ɫɭɲɢɥɶɧɨɣ ɭɫɬɚɧɨɜɤɟ ɢ ɜɵɫɭɲɟɧɧɨɟ
ɫɟɧɨ ɩɨɞɚɟɬɫɹ ɜ ɛɟɡɪɟɲɟɬɧɵɣ ɢɡɦɟɥɶɱɢɬɟɥɶ. ȼ ɞɚɧɧɨɦ ɫɥɭɱɚɟ ɥɢɫɬɨɜɚɹ ɱɚɫɬɶ ɦɚɫɫɵ ɩɪɟɜɪɚɳɚɟɬɫɹ
ɩɨɱɬɢ ɜ ɦɭɱɧɢɫɬɭɸ ɮɪɚɤɰɢɸ ɫ ɪɚɡɦɟɪɨɦ ɞɨ 10 ɦɦ, ɚ ɫɬɟɛɥɟɜɚɹ ɱɚɫɬɶ ɢɡɦɟɥɶɱɚɟɬɫɹ ɧɚ ɮɪɚɤɰɢɢ ɫɨ
ɫɪɟɞɧɢɦ ɪɚɡɦɟɪɨɦ 20…50 ɦɦ. Ⱦɚɥɟɟ ɩɪɟɞɜɚɪɢɬɟɥɶɧɨ ɢɡɦɟɥɶɱɟɧɧɚɹ ɦɚɫɫɚ ɬɪɚɧɫɩɨɪɬɟɪɨɦ ɩɨɞɚɟɬɫɹ
ɧɚ ɫɟɩɚɪɚɬɨɪ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ ɢ ɨɬɫɟɩɚɪɢɪɨɜɚɧɧɚɹ ɥɢɫɬɨɜɚɹ ɱɚɫɬɶ ɩɨɫɬɭɩɚɟɬ ɜ ɪɟɲɟɬɧɵɣ ɢɡɦɟɥɶɱɢɬɟɥɶ ɞɥɹ ɢɡɦɟɥɶɱɟɧɢɹ ɟɟ ɜ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɭɸ ɦɭɤɭ.
ȼ ɩɪɨɰɟɫɫɟ ɫɭɲɤɢ, ɤɨɝɞɚ ɩɨɞɫɬɨɠɧɵɣ ɤɚɧɚɥ ɫɨ ɜɫɟɯ ɫɬɨɪɨɧ ɡɚɤɪɵɬ ɩɪɨɜɹɥɟɧɧɨɣ ɬɪɚɜɨɣ, ɩɪɨɢɫɯɨɞɢɬ ɫɭɳɟɫɬɜɟɧɧɨɟ ɢɡɦɟɧɟɧɢɟ ɫɤɨɪɨɫɬɢ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɩɨ ɞɥɢɧɟ ɩɨɞɫɬɨɠɧɨɝɨ ɤɚɧɚɥɚ. Ⱦɥɹ
ɨɩɪɟɞɟɥɟɧɢɹ ɡɚɤɨɧɨɦɟɪɧɨɫɬɢ ɢɡɦɟɧɟɧɢɹ ɫɤɨɪɨɫɬɢ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɜ ɩɨɞɫɬɨɠɧɨɦ ɤɚɧɚɥɟ ɛɵɥɢ
ɩɪɨɜɟɞɟɧɵ ɫɩɟɰɢɚɥɶɧɵɟ ɨɩɵɬɵ. ɋɤɨɪɨɫɬɶ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɜ ɩɨɞɫɬɨɠɧɨɦ ɤɚɧɚɥɟ ɨɩɪɟɞɟɥɹɥɚɫɶ
ɫ ɩɨɦɨɳɶɸ ɬɪɭɛɤɢ ɉɢɬɨ-ɉɪɚɧɞɬɥɹ. Ƚɪɚɮɢɤ ɢɡɦɟɧɟɧɢɹ ɫɤɨɪɨɫɬɢ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɜ ɡɚɜɢɫɢɦɨɫɬɢ
ɨɬ ɞɥɢɧɵ ɩɨɞɫɬɨɠɧɨɝɨ ɤɚɧɚɥɚ ɩɪɢɜɟɞɟɧ ɧɚ ɪɢɫɭɧɤɟ 1. ɂɡ ɝɪɚɮɢɤɚ 1 ɜɢɞɧɨ, ɱɬɨ ɫɤɨɪɨɫɬɶ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɩɪɢ ɜɵɯɨɞɟ ɢɡ ɩɚɬɪɭɛɤɚ ɢɦɟɟɬ ɡɧɚɱɟɧɢɟ ɛɥɢɡɤɨɟ ɤ ɥɢɧɟɣɧɨɣ ɫɤɨɪɨɫɬɢ ɩɨ ɤɨɧɰɚɦ ɥɨɩɚɫɬɢ
ɜɟɧɬɢɥɹɬɨɪɚ Vɜ– 28,5 ɦ/ɫ. ȼ ɧɚɱɚɥɟ ɞɥɢɧɵ ɩɨɞɫɬɨɠɧɨɝɨ ɤɚɧɚɥɚ ɩɪɨɢɫɯɨɞɢɬ ɪɟɡɤɨɟ ɫɧɢɠɟɧɢɟ ɫɤɨɪɨɫɬɢ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ, ɚ ɜ ɞɚɥɶɧɟɣɲɟɦ ɨɧɚ ɧɟɫɤɨɥɶɤɨ ɫɬɚɛɢɥɢɡɭɟɬɫɹ.
Ⱦɚɧɧɨɟ ɢɡɦɟɧɟɧɢɟ ɫɤɨɪɨɫɬɢ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɫɜɹɡɚɧɨ ɫ ɬɟɦ, ɱɬɨ ɧɚ ɜɵɯɨɞɟ ɩɨɞɫɬɨɠɧɵɣ ɤɚɧɚɥ
ɡɚɤɪɵɬ ɩɪɨɜɹɥɟɧɧɨɣ ɬɪɚɜɨɣ, ɩɨɷɬɨɦɭ ɫɤɨɪɨɫɬɶ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɜ ɤɨɧɰɟ ɩɨɞɫɬɨɠɧɨɝɨ ɤɚɧɚɥɚ
ɫɧɢɠɚɟɬɫɹ. ȼ ɫɟɪɟɞɢɧɟ ɩɨɞɫɬɨɠɧɨɝɨ ɤɚɧɚɥɚ ɫɤɨɪɨɫɬɶ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɧɚɯɨɞɢɬɫɹ ɜ ɩɪɟɞɟɥɚɯ
10–15ɦ/ɫ. ɬ.ɟ. ɜ ɩɪɟɞɟɥɚɯ ɨɩɬɢɦɚɥɶɧɨɣ ɫɤɨɪɨɫɬɢ ɞɥɹ ɫɭɲɤɢ ɩɪɨɜɹɥɟɧɧɨɣ ɬɪɚɜɵ [4].
290
Ɋɢɫ.1. Ƚɪɚɮɢɤ ɢɡɦɟɧɟɧɢɹ ɫɤɨɪɨɫɬɢ ɜɨɡɞɭɲɧɨɝɨ ɩɨɬɨɤɚ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɞɥɢɧɵ ɩɨɞɫɬɨɠɧɨɝɨ ɤɚɧɚɥɚ
Ɋɢɫ. 2. Ɉɛɳɢɣ ɜɢɞ ɥɢɧɢɢ ɫ ɰɢɤɥɨɧɨɦ ɢ ɜɟɧɬɢɥɹɬɨɪɨɦ
Ⱦɥɹ ɩɨɥɧɨɝɨ ɭɫɬɪɚɧɟɧɢɹ ɩɵɥɟɨɛɪɚɡɨɜɚɧɢɹ ɜɟɪɯɧɹɹ ɬɪɭɛɚ ɰɢɤɥɨɧɚ ɫɨɟɞɢɧɹɟɬɫɹ ɫɩɟɰɢɚɥɶɧɨɣ
ɬɪɭɛɨɣ ɫ ɜɫɚɫɵɜɚɸɳɢɦ ɨɤɧɨɦ ɜɟɧɬɢɥɹɬɨɪɚ (ɪɢɫɭɧɨɤ 2). Ɍɚɤɨɟ ɫɨɟɞɢɧɟɧɢɟ ɜɟɧɬɢɥɹɬɨɪɚ ɫ ɰɢɤɥɨɧɨɦ
ɧɟɨɛɯɨɞɢɦɨ, ɩɨɬɨɦɭ ɱɬɨ ɜ ɩɪɨɰɟɫɫɟ ɧɟɩɪɟɪɵɜɧɨɣ ɪɚɛɨɬɵ ɥɢɧɢɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ ɫɭɲɤɢ
ɩɪɨɜɹɥɟɧɧɨɣ ɬɪɚɜɵ ɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ ɞɨɥɠɧɵ ɛɵɬɶ ɨɫɭɳɟɫɬɜɥɟɧɵ ɩɚɪɚɥɥɟɥɶɧɨ.
ɉɨɫɥɟ ɫɭɲɤɢ ɬɪɚɜɵ ɧɚ ɩɨɞɫɬɨɠɧɨɦ ɤɚɧɚɥɟ ɛɵɥɢ ɩɪɨɜɟɞɟɧɵ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɩɨ ɨɛɨɫɧɨɜɚɧɢɸ ɞɢɚɦɟɬɪɚ ɨɬɜɟɪɫɬɢɣ ɪɟɲɟɬɚ. Ɍɚɤ ɤɚɤ, ɪɚɧɟɟ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨ
ɨɛɨɫɧɨɜɚɧɢɸ ɩɚɪɚɦɟɬɪɨɜ ɫɟɩɚɪɚɬɨɪɚ ɭɠɟ ɛɵɥɢ ɩɪɨɜɟɞɟɧɵ ɫ ɪɟɲɟɬɚɦɢ ɞɢɚɦɟɬɪɨɦ ɨɬɜɟɪɫɬɢɣ 4 ɢ 5
ɦɦ [3], ɬɨ ɧɚɦɢ ɩɪɨɜɟɞɟɧɵ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɪɢ ɪɚɛɨɬɟ ɫɟɩɚɪɚɬɨɪɚ, ɫɧɚɛɠɟɧɧɨɝɨ ɪɟɲɟɬɨɦ ɫ ɞɢɚɦɟɬɪɨɦ ɨɬɜɟɪɫɬɢɣ 5 ɦɦ. ɉɪɢ ɷɬɨɦ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɫɟɩɚɪɚɬɨɪɚ ɛɵɥɚ ɪɚɜɧɚ 280 ɤɝ/ɱ ɢ ɛɵɥɨ ɜɵɞɟɥɟɧɨ 32 % ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜɵ. ȿɫɥɢ ɭɱɟɫɬɶ, ɱɬɨ ɨɤɨɥɨ 40 % ɨɛɳɟɣ ɦɚɫɫɵ ɥɸɰɟɪɧɵ ɫɨɫɬɚɜɥɹɟɬ
ɥɢɫɬɨɜɭɸ ɱɚɫɬɶ ɪɚɫɬɟɧɢɣ, ɬɨ ɹɫɧɨ, ɱɬɨ ɟɳɟ ɧɟ ɜɵɞɟɥɟɧɨ ɛɵɥɨ ɨɤɨɥɨ 10 % ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ, ɩɨɷɬɨɦɭ ɞɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɜɥɢɹɧɢɹ ɞɢɚɦɟɬɪɚ ɨɬɜɟɪɫɬɢɣ ɪɟɲɟɬɚ ɧɚ ɩɪɨɰɟɫɫ ɫɟɩɚɪɢɪɨɜɚɧɢɹ ɥɢɫɬɨɜɨɣ
ɱɚɫɬɢ ɛɵɥɢ ɢɡɝɨɬɨɜɥɟɧɵ ɪɟɲɟɬɚ ɫ ɞɢɚɦɟɬɪɨɦ ɨɬɜɟɪɫɬɢɣ 6…7 ɦɦ.
ȼ ɩɪɨɰɟɫɫɟ ɨɩɵɬɨɜ ɪɚɡɥɨɠɟɧɧɚɹ ɦɚɫɫɚ ɩɨɞɚɜɚɥɚɫɶ ɧɚ ɫɟɩɚɪɚɬɨɪ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ ɢ ɨɩɪɟɞɟɥɹɥɨɫɶ ɜɪɟɦɹ ɩɪɨɯɨɠɞɟɧɢɹ ɦɚɫɫɵ ɱɟɪɟɡ ɪɟɲɟɬɨ. ɉɨɫɥɟ ɷɬɨɝɨ ɜɡɜɟɲɢɜɚɥɚɫɶ ɜɵɞɟɥɟɧɧɚɹ ɥɢɫɬɨɜɚɹ
ɱɚɫɬɶ, ɧɚɯɨɞɹɳɚɹɫɹ ɩɨɞ ɪɟɲɟɬɨɦ ɫɟɩɚɪɚɬɨɪɚ ɢ ɜɵɞɟɥɟɧɧɚɹ ɫɬɟɛɥɟɜɚɹ ɱɚɫɬɶ ɬɪɚɜɵ. ȼ ɩɪɨɰɟɫɫɟ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɵɥɚ ɨɩɪɟɞɟɥɟɧɚ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɩɪɨɰɟɫɫɚ ɫɟɩɚɪɢɪɨɜɚɧɢɹ ɧɚ
ɪɟɲɟɬɚɯ ɫ ɞɢɚɦɟɬɪɚɦɢ ɨɬɜɟɪɫɬɢɹ 6 ɢ 7 ɦɦ.
Ɋɟɡɭɥɶɬɚɬɵ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨ ɨɩɪɟɞɟɥɟɧɢɸ ɜɥɢɹɧɢɢ ɞɢɚɦɟɬɪɚ ɨɬɜɟɪɫɬɢɣ ɪɟɲɟɬɚ ɧɚ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɩɪɨɰɟɫɫɚ ɫɟɩɚɪɢɪɨɜɚɧɢɹ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ ɩɪɢɜɟɞɟɧɵ ɧɚ ɪɢɫɭɧɤɟ 3.
291
ɉɪɢ ɭɜɟɥɢɱɟɧɢɢ ɞɢɚɦɟɬɪɚ ɨɬɜɟɪɫɬɢɣ ɪɟɲɟɬɚ, ɧɚɱɢɧɚɹ ɫ 6ɦɦ, ɩɪɨɢɫɯɨɞɢɬ ɢɧɬɟɧɫɢɜɧɨɟ ɩɨɜɵɲɟɧɢɟ
ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɫɟɩɚɪɚɬɨɪɚ, ɬ.ɟ. ɩɨɜɵɲɟɧɢɟ
ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɜɫɟɣ ɥɢɧɢɢ. ɉɪɢ ɷɬɨɦ, ɫɪɟɞɧɹɹ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɧɚ ɪɟɲɟɬɟ 6ɦɦ ɛɵɥɚ ɪɚɜɧɚ
314 ɤɝ/ɱ, ɚ ɩɪɢ ɪɟɲɟɬɟ 7 ɦɦ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ
ɥɢɧɢɢ ɞɨɯɨɞɢɥɚ ɞɨ 376 ɤɝ/ɱ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1. Ɍɟɨɪɟɬɢɱɟɫɤɨɟ ɨɛɨɫɧɨɜɚɧɢɟ ɤɢɧɟɦɚɬɢɱɟɫɤɨɝɨ ɪɟɠɢɦɚ ɫɟɩɚɪɚɬɨɪɚ ɦɟɥɤɨɣ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ. Ⱦ.Ɍ.
Ⱥɛɢɥɠɚɧɨɜ, Ɍ. Ⱥɛɢɥɠɚɧɭɥɵ // Ɍɪɚɤɬɨɪɵ ɢ ɫɟɥɶɯɨɡ-ɦɚɲɢɧɵ.-2014.-ʋ7.-ɋ.32–35.
2. Ɉɛɨɫɧɨɜɚɧɢɟ ɩɚɪɚɦɟɬɪɨɜ ɫɟɩɚɪɚɬɨɪɚ ɦɟɥɤɨɣ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ. Ⱦ.Ɍ. Ⱥɛɢɥɠɚɧɨɜ, Ɍ. Ⱥɛɢɥɠɚɧɭɥɵ, ȼ.Ʌ.
Ɋɢɫ. 3. ȼɥɢɹɧɢɟ ɞɢɚɦɟɬɪɚ ɨɬɜɟɪɫɬɢɣ ɪɟɲɟɬɚ
ɍɬɟɲɟɜ // Ɍɪɚɤɬɨɪɵ ɢ ɫɟɥɶɯɨɡɦɚɲɢɧɵ.-2014.-ʋ8.
ɧɚ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɫɟɩɚɪɚɬɨɪɚ ɥɢɫɬɨɜɨɣ
3. Ɋɚɡɪɚɛɨɬɤɚ ɬɟɯɧɨɥɨɝɢɢ ɢ ɥɢɧɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜɢɱɚɫɬɢ ɬɪɚɜ
ɬɚɦɢɧɧɨ-ɬɪɚɜɹɧɨɣ ɦɭɤɢ ɢɡ ɥɢɫɬɨɜɨɣ ɱɚɫɬɢ ɬɪɚɜ. Ⱦ.Ɍ.
Ⱥɛɢɥɠɚɧɨɜ, Ɍ. Ⱥɛɢɥɠɚɧɭɥɵ // Ɍɪɚɤɬɨɪɵ ɢ ɫɟɥɶɯɨɡɦɚɲɢɧɵ.-2015.-ʋ2.
4. Ԥɛɿɥɠɚɧԝɥɵ Ɍ., Ԥɛɿɥɠɚɧɨɜ Ⱦ.Ɍ., ɇԝɪɥɵɛɚɟɜ Ʉ.ɇ., Ȼɚԕɵɬ Ⱥ. Ɉɛɨɫɧɨɜɚɧɢɟ ɩɚɪɚɦɟɬɪɨɜ ɦɚɥɨɝɚɛɚɪɢɬɧɨɣ
ɫɭɲɢɥɶɧɨɣ ɭɫɬɚɧɨɜɤɢ // ɀɚɪɲɵ, 2014.– ʋ2.– ɋ.47–51.
Ʉ ȼɈɉɊɈɋɍ ɂɋɋɅȿȾɈȼȺɇɂɃ
ɗɎɎȿɄɌɂȼɇɈɋɌɂ ȾȿɃɋɌȼɂə ɗɅȿɄɌɊɂɑȿɋɄɈȽɈ
ɌɊȺɇɋɉɈɊɌȺ ȽɈɊɈȾȺ ɍɅȺȺɇȻȺȺɌȺɊ
ȻȺȺɌȺɊɏɍɍ Ⱦ. , ɆəȽɆȺɊɋɍɊɗɇ Ȼ.,
ɂɧɠɟɧɟɪɧɨ-ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ, Ɇɨɧɝɨɥɶɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɚɝɪɚɪɧɵɣ
ɭɧɢɜɟɪɫɢɬɟɬ, ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ, e-mail:baatar_khuu2000@yahoo.com
ȼ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɹɜɥɟɧɢɹ ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɤɚɬɚɫɬɪɨɮ ɜɫɺ ɱɚɳɟ ɧɚɛɥɸɞɚɸɬɫɹ ɜɫɥɟɞɫɬɜɢɢ ɡɚɝɪɹɡɧɟɧɢɹ ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɣ ɜ ɦɢɪɟ, ɤɨɬɨɪɨɟ ɹɜɥɹɟɬɫɹ ɨɞɧɢɦ ɢɡ ɚɤɬɭɚɥɶɧɵɯ ɜɨɩɪɨɫɨɜ ɱɟɥɨɜɟɱɟɫɬɜɚ.
ȼ ɛɨɥɶɲɢɧɫɬɜɟ ɪɚɡɜɢɬɵɯ ɫɬɪɚɧɚɯ ɦɢɪɚ ɭɪɨɜɟɧɶ ɡɚɝɪɹɡɧɟɧɢɹ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ ɞɨɫɬɢɝ ɤ ɤɪɢɬɢɱɟɫɤɨɣ ɨɬɦɟɬɤɟ, ɱɬɨ ɨɛɴɹɜɥɹɸɬ ɨ ɫɜɨɢɯ ɤɚɬɚɫɬɪɨɮɢɱɟɫɤɢɯ ɩɨɥɨɠɟɧɢɹɯ ɦɢɪɨɜɨɦɭ ɨɛɳɟɫɬɜɭ. ɇɚ
ɫɱɺɬ ɧɚɲɟɣ ɫɬɪɚɧɵ ɫɬɨɥɢɰɚ ɍɥɚɚɧɛɚɚɬɚɪ ɫɱɢɬɚɟɬɫɹ ɫɚɦɨɣ ɡɚɝɪɟɡɧɺɧɧɨɣ ɱɚɫɬɶɸ Ɇɨɧɝɨɥɢɢ. ɏɨɬɹ
ɩɪɚɜɢɬɟɥɶɫɬɜɨ ɩɪɟɞɩɪɢɧɢɦɚɟɬ ɪɹɞ ɦɟɪ ɞɥɹ ɭɦɟɧɶɲɟɧɢɹ ɡɚɝɪɹɡɧɟɧɢɹ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ, ɧɨ ɷɬɢ
ɦɟɪɵ ɧɟ ɩɪɢɜɨɞɹɬ ɤ ɭɞɨɜɥɟɬɜɨɪɹɸɳɢɦ ɪɟɡɭɥɶɬɚɬɚɦ [1]. ɉɨɷɬɨɦɭ ɜ ɷɬɨɦ ɞɨɤɥɚɞɟ ɝɨɜɨɪɢɬɫɹ ɜɨɩɪɨɫ
ɨ ɧɵɧɟɲɧɨɣ ɫɢɬɭɚɰɢɢ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɝɨɪɨɞɚ ɍɥɚɚɧɛɚɚɬɚɪɚ ɢ ɦɚɪɤɟɬɢɧɝɨɜɨɦ ɜɨɩɪɨɫɟ
ɞɚɥɶɧɟɣɲɟɝɨ ɭɦɟɧɶɲɟɧɢɹ ɡɚɝɪɹɡɧɟɧɢɹ ɜɨɡɞɭɯɚ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ. ɗɥɟɤɬɪɢɱɟɫɤɢɣ ɜɢɞ ɬɪɚɧɫɩɨɪɬɚ, ɬɪɨɥɥɟɣɛɭɫ ɷɤɫɩɥɭɚɬɢɪɭɟɬɫɹ ɭɠɟ 27 ɥɟɬ ɜ ɧɚɲɟɦ ɫɬɨɥɢɰɟ. ȿɫɥɢ ɭɥɭɱɲɢɬɶ ɭɫɥɨɜɢɟ ɨɛɫɥɭɠɢɜɚɧɢɹ ɢ ɭɦɟɧɶɲɢɬɶ ɬɟɯɧɢɱɟɫɤɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɟ ɩɨɬɟɪɢ ɷɬɨɝɨ ɜɢɞɚ, ɬɨ ɟɫɬɶ ɜɨɡɦɨɠɧɨɫɬɶ ɫɞɟɥɚɬɶ
ɞɨɦɢɧɢɪɭɸɳɢɦ ɜɢɞɨɦ ɝɨɪɨɞɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ, ɜɥɢɹɸɳɢɣ ɧɚ ɡɚɝɪɹɡɧɟɧɢɹ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ ɢ
ɫɬɚɬɶ ɷɤɨɥɨɝɢɱɟɫɤɢ ɱɢɫɬɵɦ ɬɪɚɧɫɩɨɪɬɧɵɦ ɫɪɟɞɫɬɜɨɦ ɞɥɹ ɝɨɪɨɞɚ ɍɥɚɚɧɛɚɚɬɚɪ.
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: ɗɥɟɤɬɪɢɱɟɫɤɢɣ ɬɪɚɧɫɩɨɪɬ, ɬɪɨɥɥɟɣɛɭɫ, ɡɚɝɪɹɡɧɟɧɢɟ ɜɨɡɞɭɯɚ.
ɇɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɜ ɝɨɪɨɞɟ ɞɨɫɬɚɬɨɱɧɨ ɦɧɨɝɨ ɤɨɦɩɚɧɢɢ, ɨɛɫɥɭɠɢɜɚɸɳɢɯ ɨɛɳɟɫɬɜɟɧɧɵɦ
ɬɪɚɧɫɩɨɪɬɨɦ ɩɚɫɫɚɠɢɪɚɦ. Ɉɞɧɢɦ ɹɜɥɹɟɬɫɹ ɷɥɟɤɬɪɢɱɟɫɤɢɣ ɜɢɞ ɬɪɚɧɫɩɨɪɬɚ, ɨɬ ɤɨɬɨɪɨɝɨ ɡɚɜɢɫɢɬ
ɛɵɬɢɟ ɝɨɪɨɞɫɤɨɝɨ ɧɚɫɟɥɟɧɢɹ. ȼ 1990–1998 ɝɨɞɚɯ, ɜ ɩɟɪɢɨɞ ɧɚ ɪɵɧɨɱɧɭɸ ɷɤɨɧɨɦɢɤɭ, ɤɨɝɞɚ ɚɜɬɨɛɭɫɧɵɣ ɩɚɪɤ ɛɵɥ ɧɚ ɝɪɚɧɢ ɩɚɞɟɧɢɹ, ɬɪɨɥɥɟɣɛɭɫɧɵɣ ɩɚɪɤ ɚɤɬɢɜɧɨ ɨɛɫɥɭɠɢɜɚɥ ɝɨɪɨɞɫɤɨɦɭ ɧɚɫɟɥɟɧɢɸ
ɩɨɱɬɢ ɧɚ 100 % ɩɨ ɩɚɪɤɨɜɨɦɭ ɱɢɫɥɭ ɩɟɪɟɞɜɢɠɧɨɝɨ ɫɨɫɬɚɜɚ. Ɍɚɤ ɤɚɤ ɜ ɬɨ ɜɪɟɦɹ ɚɜɬɨɛɭɫɧɵɣ ɩɚɪɤ
ɜɵɩɭɫɤɚɥ ɧɚ ɥɢɧɢɢ ɜɫɟɝɨ ɥɢɲɶ 15 %-20 % ɚɜɬɨɛɭɫɨɜ. Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɬɪɨɥɥɟɣɛɭɫ ɡɚɧɢɦɚɟɬ ɨɫɨɛɨɟ
ɡɧɚɱɟɧɢɟ ɜ ɝɨɪɨɞɟ ɍɥɚɚɧɛɚɚɬɚɪ.
1.Ⱥɤɬɭɚɥɶɧɵɟ ɜɨɩɪɨɫɵ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ
ȼ ɝɨɪɨɞɟ ɍɥɚɚɧɛɚɚɬɚɪ ɩɟɪɟɜɨɡɤɚ ɩɚɫɫɚɠɢɪɨɜ ɬɪɨɥɥɟɣɛɭɫɚɦɢ ɫɬɚɧɨɜɢɬɫɹ ɜɫɟ ɪɟɠɟ ɩɨɩɪɢɱɢɧɟ
ɧɟɯɜɚɬɤɢ ɦɚɬɟɪɢɚɥɶɧɵɯ ɛɚɡ, ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ ɢ.ɬ.ɩ. ɉɨ ɞɚɧɧɵɦ ɩɪɨɲɟɞɳɢɯ 5 ɥɟɬ ɱɢɫɥɨ
ɨɛɫɥɭɠɢɜɚɸɳɢɯ ɬɪɨɥɥɟɣɛɭɫɨɦ ɡɧɚɱɢɬɟɥɶɧɨ ɭɦɟɧɶɲɢɥɨɫɶ. ɇɚ ɫɟɝɨɞɧɹɳɧɵɣ ɞɟɧɶ 60 % ɩɟɪɟɞɜɢɠ292
ɧɨɝɨ ɫɨɫɬɚɜɚ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɨ ɢɡɧɨɳɟɧɨ ɢ ɬɪɟɛɭɟɬɫɹ ɫɩɢɫɚɧɢɟ ɢɡ ɦɚɪɲɪɭɬɧɨɝɨ ɨɛɫɥɭɠɢɜɚɧɢɹ ɢɥɢ
ɤɚɩɢɬɚɥɶɧɵɣ ɪɟɦɨɧɬ [2].
ȿɫɥɢ ɷɬɨ ɛɭɞɟɬ ɩɪɨɞɨɥɠɚɬɶɫɹ ɛɟɡ ɩɨɞɞɟɪɠɤɢ, ɬɨ ɨɛɳɟɫɬɜɟɧɧɵɣ ɷɥɟɤɬɪɢɱɟɫɤɢɣ ɬɪɚɧɫɩɨɪɬ ɩɨɣɞɟɬ ɜ ɭɩɚɞɨɤ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɤɚɱɟɫɬɜɨ ɨɛɫɥɭɠɢɜɚɧɢɹ ɩɚɫɫɚɠɢɪɚɦ ɭɯɭɞɲɢɜɚɟɬɫɹ ɢ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɩɪɢɛɵɥɶ ɨɬ ɩɟɪɟɞɜɢɠɧɨɝɨ ɫɨɫɬɚɜɚ ɭɦɟɧɶɲɢɜɚɟɬɫɹ. ɇɚɩɪɢɦɟɪ, ɜ 2012 ɝɨɞɭ ɱɢɫɥɨ ɩɚɫɫɚɠɢɪɨɜ,
ɨɛɫɥɭɠɟɧɧɵɯ ɬɪɨɥɟɣɛɭɫɨɦ ɛɵɥɨ 1,12 ɦɢɥɥɢɨɧɚ, ɚ ɜ 2013 ɝɨɞɭ ɷɬɨ ɱɢɫɥɨ ɫɬɚɥɨ 0,56 ɦɢɥɥɢɨɧɨɜ, ɱɬɨ
ɨɡɧɚɱɚɟɬ ɩɨɬɨɤ ɩɚɫɫɚɠɢɪɨɜ ɫɨɤɪɚɬɢɥɫɹ ɜ ɞɜɚ ɪɚɡɚ [2].
Ɉɫɧɨɜɧɨɣ ɩɪɢɱɢɧɨɣ, ɧɟɭɞɨɜɥɟɬɜɨɪɹɸɳɟɣ ɝɨɪɨɞɫɤɢɯ ɠɢɬɟɥɟɣ ɹɜɥɹɟɬɫɹ ɭɫɬɚɪɟɥɵɣ ɜɢɞ ɦɨɞɢɮɢɤɚɰɢɢ ɩɟɪɟɞɜɢɠɧɨɝɨ ɫɨɫɬɚɜɚ, ɦɟɞɥɟɧɧɚɹ ɫɤɨɪɨɫɬɶ ɢ ɤɨɦɮɨɪɬɚɛɟɥɶɧɨɫɬɶ. ɉɨɷɬɨɦɭ ɩɚɫɫɚɠɢɪɵ
ɜɵɛɢɪɚɸɬ ɛɨɥɟɟ ɤɨɦɮɨɪɬɧɵɣ, ɛɵɫɬɪɵɣ ɩɟɪɟɞɜɢɠɧɨɣ ɫɨɫɬɚɜ, ɱɟɦ ɬɪɨɥɥɟɣɛɭɫ. ȼ ɨɬɪɚɫɥɢ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɝɨɪɨɞɚ ɍɥɚɚɧɛɚɚɬɚɪ ɜɨɡɧɢɤɚɟɬ ɞɜɚ ɨɫɧɨɜɧɵɯ ɚɤɬɭɚɥɶɧɵɯ ɜɨɩɪɨɫɨɜ.
ȼɨ ɩɟɪɜɵɯ: ɫɚɦɨɮɢɧɚɧɫɢɪɨɜɚɧɢɟ ɜ ɨɬɪɚɫɥɢ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɧɟ ɩɪɨɢɡɜɨɞɢɬɫɹ.
ȼɨ ɜɬɨɪɵɯ: Ɇɚɬɟɪɢɚɥɶɧɨ-ɬɟɯɧɢɱɟɫɤɚɹ ɛɚɡɚ ɩɟɪɟɞɜɢɠɧɨɝɨ ɫɨɫɬɚɜɚ ɧɟ ɭɞɨɜɥɟɬɜɨɪɹɟɬ ɬɪɟɛɭɟɦɵɣ
ɭɪɨɜɟɧɶ ɤɚɱɟɫɬɜɨ.
ȼ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɩɪɢ ɢɫɫɥɟɞɨɜɚɧɢɢ ɫɦɨɝɚ ɛɵɥ ɭɫɬɚɧɨɜɥɟɧ, ɱɬɨ ɨɫɧɨɜɧɵɦ ɮɚɤɬɨɪɨɦ, ɡɚɝɪɹɡɧɹɸɳɢɣ ɚɬɦɨɫɮɟɪɭ ɝɨɪɨɞɚ ɍɥɚɚɧɛɚɚɬɚɪ ɹɜɥɹɟɬɫɹ ɩɟɪɟɞɜɢɠɧɨɣ ɫɨɫɬɚɜ ɫ ɞɜɢɝɚɬɟɥɟɦ ɜɧɭɬɪɟɧɧɨɝɨ
ɫɝɨɪɚɧɢɹ, ɱɟɦ ɠɢɥɢɳɚ ɫ ɨɛɵɱɧɵɦ ɬɨɩɥɟɧɢɟɦ.
ɋɦɨɝ, ɜɵɛɪɨɳɟɧɧɵɣ ɨɬ ɚɜɬɨɦɨɛɢɥɹ ɜ ɚɬɦɨɫɮɟɪɭ ɜ 4 ɪɚɡɚ ɛɨɥɶɲɟ, ɱɟɦ ɨɬ ɨɛɴɟɤɬɚ ɫ ɨɛɵɱɧɵɦ
ɬɨɩɥɟɧɢɟɦ, ɢɥɢ ɡɚɧɢɦɚɟɬ 80 % ɨɬ ɨɛɳɟɝɨ ɡɚɝɪɹɡɧɟɧɢɹ [1]. Ⱥ ɬɚɤɠɟ ɭɬɜɟɪɠɞɟɧɨ, ɱɬɨ ɜ ɬɚɤɢɯ ɭɫɥɨɜɢɹɯ ɷɥɟɤɬɪɢɱɟɫɤɢɣ ɬɪɚɧɫɩɨɪɬ ɹɜɥɹɟɬɫɹ ɫɚɦɵɦ ɷɤɨɥɨɝɢɱɟɫɤɢɦ ɨɛɳɟɫɬɜɟɧɧɵɦ ɬɪɚɧɫɩɨɪɬɨɦ.
ɇɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɦɨɠɧɨ ɫɤɚɡɚɬɶ, ɱɬɨ ɩɪɢ ɨɪɝɚɧɢɡɚɰɢɢ ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɞɨɫɤɨɧɚɥɶɧɨ ɧɟ ɢɡɭɱɢɥɫɹ ɡɚɤɨɧ ɪɵɧɨɱɧɨɣ ɷɤɨɧɨɦɢɤɢ. ɇɵɧɟɲɧɚɹ ɫɢɬɭɚɰɢɹ ɜɵɝɥɹɞɢɬɫɹ ɬɚɤ, ɱɬɨ ɜ ɧɟɤɨɬɨɪɵɯ ɦɚɪɲɪɭɬɚɯ ɝɞɟ ɩɚɫɫɚɠɢɪɨɩɨɬɨɤ ɛɨɥɶɲɟ, ɱɢɫɥɨ ɚɜɬɨɛɭɫɨɜ ɢ ɬɪɨɥɥɟɣɛɭɫɨɜ ɩɪɟɜɵɲɚɟɬ ɞɨɡɜɨɥɟɧɧɨɝɨ ɱɢɫɥɚ, ɚ ɜ ɦɚɪɲɪɭɬɚɯ ɝɞɟ ɩɚɫɫɚɠɢɪɨɩɨɬɨɤ ɦɟɧɶɲɟ ɧɚɨɛɨɪɨɬ. ɂɡ-ɡɚ ɩɪɟɜɵɲɟɧɢɣ ɱɢɫɥɚ
ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ, ɨɫɨɛɟɧɧɨ ɤɚɫɚɸɳɢɯɫɹ ɚɜɬɨɛɭɫɨɜ, ɧɚ ɨɫɬɚɧɨɜɤɚɯ ɜɨɡɧɢɤɚɟɬ ɫɬɨɥɩɨɬɜɨɪɟɧɢɟ ɧɟ ɩɚɫɫɚɠɢɪɨɜ, ɚ ɚɜɬɨɛɭɫɨɜ. ɑɬɨɛɵ ɢɫɩɪɚɜɢɬɶ ɷɬɢ ɩɪɨɛɥɟɦɵ ɧɭɠɧɨ ɫɨɡɞɚɬɶ ɩɪɨɮɟɫɢɨɧɚɥɶɧɭɸ ɨɪɝɚɧɢɡɚɰɢɸ ɞɥɹ ɭɩɪɚɜɥɟɧɢɹ ɝɨɪɨɞɫɤɢɦɢ ɬɪɚɧɫɩɨɪɬɚɦɢ ɢɥɢ ɦɚɪɤɟɬɢɧɝɨɜɵɣ ɨɪɝɚɧ, ɤɨɬɨɪɵɟ
ɡɚɧɢɦɚɟɬɫɹ ɪɭɤɨɜɨɞɫɬɜɨɦ ɬɟɧɞɟɧɰɢɢ ɦɚɪɲɪɭɬɚ ɢ ɷɤɨɧɨɦɢɤɨɣ ɝɨɪɨɞɫɤɨɝɨ ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɢ ɩɥɚɧɢɪɨɜɤɨɣ. ɇɚ ɫɟɝɨɞɧɹɲɧɵɣ ɞɟɧɶ ɷɬɭ ɮɭɧɤɰɢɸ ɜɵɩɨɥɧɹɟɬ ɬɨɥɶɤɨ ɷɤɨɧɨɦɢɱɟɫɤɢɣ ɨɬɞɟɥ
ɩɪɢ ɝɨɪɨɞɫɤɨɦ ɫɨɜɟɬɟ. ɉɪɢ ɩɪɨɜɟɞɟɧɢɣ ɦɚɪɤɟɬɢɧɝɨɜɨɣ ɪɚɛɨɬɵ ɩɨ ɨɛɳɟɫɬɜɟɧɧɨɦɭ ɬɪɚɧɫɩɨɪɬɭ, ɨɫɨɛɟɧɧɨ ɩɨ ɷɥɟɤɬɪɢɱɟɫɤɨɦɭ ɧɚɞɨ ɭɱɢɬɵɜɚɬɶ ɦɧɟɧɢɟ ɢ ɬɪɟɛɨɜɚɧɢɟ ɩɚɫɫɚɠɢɪɨɜ ɢ ɧɚ ɨɫɧɨɜɚɧɢɣ ɷɬɢɯ
ɤɨɪɪɟɤɬɢɪɨɜɚɬɶ ɜɨɡɧɢɤɲɢɟ ɧɟɞɨɫɬɚɬɤɢ. ɉɨ ɦɧɟɧɢɚɹɦ ɚɜɬɨɪɨɜ ɦɚɪɤɟɬɢɧɝɨɜɵɣ ɨɪɝɚɧ ɝɨɪɨɞɫɤɨɝɨ
ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɞɨɥɠɟɧ ɛɵɬɶ ɦɨɳɧɵɦ ɢ ɦɚɧɺɜɪɟɧɧɵɦ.
ȼ ɫɟɧɬɹɛɪɟ 2013 ɝɨɞɚ ɩɨ ɢɧɢɰɢɚɬɢɜɟ ɪɭɤɨɜɨɞɫɬɜɚ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɛɵɥ ɨɩɪɨɫ ɨɬ 138
ɩɚɫɫɚɠɢɪɨɜ ɨ ɩɪɢɱɢɧɟ ɫɨɤɪɚɳɟɧɢɹ ɩɚɫɫɚɠɢɪɨɩɨɬɨɤɨɜ ɜ ɬɪɨɥɥɟɣɛɭɫɧɨɦ ɨɛɫɥɭɠɢɜɚɧɢɢ. Ɋɟɡɭɥɶɬɚɬ
ɩɨɤɚɡɚɥ ɫɥɟɞɭɸɳɢɟ: 73,3 % ɩɚɫɫɚɠɢɪɨɜ ɩɪɟɞɩɨɱɢɬɚɟɬ ɟɡɞɢɬɶ ɧɚ ɚɜɬɨɛɭɫɟ, 13,3 % ɩɚɫɫɚɠɢɪɨɜ ɩɪɟɞɩɨɱɢɬɚɟɬ ɟɡɞɢɬɶ ɧɚ ɬɪɨɥɥɟɣɛɭɫɟ, 13,3 % ɩɚɫɫɚɠɢɪɨɜ ɩɪɟɞɩɨɱɢɬɚɟɬ ɧɚ ɬɚɤɫɢ ɢɥɢ ɧɚ ɫɨɛɫɬɜɟɧɧɨɦ
ɩɪɟɞɜɢɠɧɨɦ ɫɪɟɞɫɬɜɟ, ɢ ɢɡ ɨɩɪɨɳɟɧɧɵɯ 60 % ɩɚɫɫɚɠɢɪɨɜ ɧɟ ɞɨɜɨɥɶɧɵ ɦɚɪɲɪɭɬɚɦ ɬɪɨɥɥɟɣɛɭɫɨɜ,
ɢɧɬɟɪɜɚɥɚɦɢ ɦɟɠɞɭ ɬɪɨɥɥɟɣɛɭɫɚɦɢ, ɢ ɢɡɧɨɳɟɧɧɵɦ ɭɫɬɚɪɟɜɲɢɟɦɢ ɬɪɨɥɥɟɣɛɭɫɚɦɢ, ɨɫɬɚɜɳɟɣɫɹ
39 % ɩɚɫɫɚɠɢɪɨɜ ɫɱɢɬɚɟɬɶ ɬɪɨɥɥɟɣɛɭɫ ɧɢɡɳɢɦ ɤɚɫɬɨɦ ɬɪɚɧɫɩɨɪɬɚ ɢ ɫɬɟɫɧɹɸɬɫɹ ɟɯɚɬɶ ɜ ɧɺɦ, 60 %
ɩɚɫɫɚɠɢɪɨɜ ɫɱɢɬɚɟɬ ɬɪɨɥɥɟɣɛɭɫ ɦɚɥɨɫɤɨɪɨɫɬɧɵɦ, ɩɨ ɫɪɚɜɧɟɧɢɸ ɫ ɞɪɭɝɢɦɢ ɜɢɞɚɦɢ ɨɛɳɟɫɬɜɟɧɧɨɝɨ
ɬɪɚɧɫɩɨɪɬɚ.
ȼ ɨɤɬɹɛɪɟ 1987 ɝɨɞɚ ɛɵɥɚ ɨɬɤɪɵɬɚ ɧɨɜɚɹ ɫɬɪɚɧɢɰɚ ɝɨɪɨɞɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɍɥɚɚɧɛɚɚɬɚɪɚ, ɛɵɥ
ɜɵɩɭɳɟɧ ɧɚ ɨɛɫɥɭɠɢɜɚɧɢɟ ɩɟɪɜɵɣ ɬɪɨɥɥɟɣɛɭɫ, ɫ ɬɟɯ ɩɨɪ ɨɧ ɫɥɭɠɢɬ ɛɟɡɨɬɤɚɡɧɚ ɩɚɫɫɚɠɢɪɚɦ ɫɬɨɥɢɰɵ. ɗɬɨɬ ɩɟɪɟɞɜɢɠɧɨɣ ɝɨɪɨɞɫɤɨɣ ɬɪɚɧɫɩɨɪɬ, ɤɚɤ ɢ ɞɪɭɝɢɟ ɜɢɞɵ ɬɪɚɧɫɩɨɪɬɚ ɢɦɟɟɬ ɫɜɨɢ ɧɟɞɨɫɬɚɬɤɢ
ɢ ɩɪɟɢɦɭɳɟɫɬɜɚ, ɧɨ ɭ ɬɪɨɥɥɟɣɛɭɫɚ ɟɫɬɶ ɛɨɥɶɲɨɟ ɛɭɞɭɳɟɟ ɢ ɞɨɥɝɨ ɛɭɞɟɬɶ ɫɥɭɠɢɬɶ ɩɚɫɫɚɠɢɪɚɦ
ɍɥɚɚɧɛɚɚɬɚɪɚ. ɉɨɷɬɨɦɭ ɩɪɟɞɥɨɠɟɧɚ ɦɚɪɤɟɬɢɧɝɨɜɚɹ ɩɪɨɝɪɚɦɦɚ ɞɚɥɶɧɟɣɲɟɝɨ ɪɚɡɜɢɬɢɹ ɝɨɪɨɞɫɤɨɝɨ
ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ.
2. Ɇɚɪɤɟɬɢɧɝɨɜɚɹ ɩɪɨɝɪɚɦɦɚ
ɇɚ ɨɫɧɨɜɟ ɨɩɵɬɚ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ ɢ ɤɚɞɪɨɜɵɯ ɪɚɛɨɱɢɯ ɧɭɠɧɨ ɫɨɡɞɚɬɶ ɭɫɥɨɜɢɸ ɞɥɹ
ɪɚɡɜɢɬɢɹ ɞɪɭɝɢɯ ɜɢɞɨɜ ɝɨɪɨɞɫɤɢɯ ɷɥɟɤɬɪɢɱɟɫɤɢɯ ɬɪɚɧɫɩɨɪɬɨɜ.
ɐɟɥɶ: ɐɟɥɶ ɩɪɨɝɪɚɦɦɵ ɨɫɧɚɳɚɬɶ ɫɬɚɛɢɥɶɧɨɟ ɪɚɡɜɢɬɢɟ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ.
ɍɥɭɱɲɢɬɶ ɬɟɯɧɢɱɟɫɤɢɟ ɭɫɥɨɜɢɹ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɩɚɪɤɚ.
ɋɨɡɞɚɬɶ ɭɫɥɨɜɢɟ ɜɵɫɨɤɨ ɤɚɱɟɫɬɜɟɧɧɨɝɨ ɨɛɫɥɭɠɢɜɚɧɢɹ ɩɪɢ ɩɟɪɟɜɨɡɤɟ ɩɚɫɫɚɠɢɪɨɜ
ɋɨɡɞɚɬɶ ɩɨɫɬɚɹɧɧɵɟ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ ɢ ɪɚɡɜɢɬɢɟ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɩɚɪɤɚ
Ⱦɨɜɟɫɬɢ ɪɚɡɜɢɬɢɟ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɩɚɪɤɚ ɢ ɷɤɫɩɥɭɚɬɚɰɢɸ ɧɚ ɦɚɪɲɪɭɬɚɯ, ɩɟɪɟɜɨɫɯɨɞɹɳɢɟ ɞɪɭɝɢɟ ɜɢɞɵ ɝɨɪɨɞɫɤɨɝɨ ɨɛɳɟɫɬɜɟɧɧɨɝɨ ɬɪɚɧɫɩɨɪɬɚ.
Ɉɛɟɫɩɟɱɢɬɶ ɩɪɨɮɟɫɫɢɨɧɚɥɶɧɵɦɢ ɤɚɞɪɚɦɢ ɞɥɹ ɩɟɪɟɯɨɞɚ ɧɚ ɪɵɧɨɱɧɭɸ ɷɤɨɧɨɦɢɤɭ
ɉɪɢ ɡɚɦɟɧɟ ɩɟɪɟɞɜɢɠɧɨɝɨ ɫɨɫɬɚɜɚ ɩɚɪɤɚ ɩɨɥɭɱɢɬɶ ɩɨɞɞɟɪɠɤɭ ɨɬ ɩɪɚɜɢɬɟɥɶɫɬɜɚ
293
Ʉɨɦɩɟɧɫɚɰɢɸ, ɤɨɬɨɪɭɸ ɝɨɫɭɞɚɪɫɬɜɚ ɩɥɚɬɢɬ ɞɥɹ ɩɟɪɟɜɨɡɤɢ ɩɨɠɟɥɵɯ, ɝɟɪɨɟɦ ɜɨɣɧɵ ɢ ɬɪɭɞɚ ɫɞɟɥɚɬɶ ɩɨɫɬɨɹɧɧɨ ɜɵɞɚɜɚɟɦɵɦ ɬɪɨɥɥɟɣɛɭɫɧɨɦɭ ɨɪɝɚɧɢɡɚɰɢɸ
Ɍɚɪɢɮɵ ɞɥɹ ɩɟɪɟɜɨɡɤɢ ɩɚɫɫɚɠɢɪɨɜ ɭɫɬɚɧɨɜɢɬɶ ɧɚ ɨɫɧɨɜɟ ɷɤɨɧɨɦɢɱɟɫɤɨ ɪɟɚɥɶɧɵɯ ɪɚɫɱɺɬɚɯ.
ȼɧɟɞɪɹɬɶ ɩɟɪɟɞɨɜɭɸ ɬɟɯɧɨɥɨɝɢɸ, ɷɤɨɧɨɦɧɨ ɪɚɫɯɨɞɭɸɳɭɸ ɷɥɟɤɬɪɢɱɟɫɤɭɸ ɷɧɟɪɝɢɸ.
3. ɗɬɚɩɵ ɩɪɢ ɢɫɩɨɥɧɟɧɢɢ ɩɪɨɝɪɚɦɦɵ
ɉɪɨɝɪɚɦɦɚ ɢɫɩɨɥɧɹɟɬɫɹ ɜ ɞɜɭɯ ɷɬɚɩɚɯ
ɉɟɪɜɵɣ ɷɬɚɩ: 2014–2017 ɝ.ɝ
Ⱦɥɹ ɷɮɮɟɤɬɢɜɧɨɣ ɪɚɛɨɬɵ ɨɪɝɚɧɢɡɚɰɢɢ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɩɚɪɤɚ ɜɧɟɞɪɹɬɶ ɧɨɜɵɣ ɩɪɢɧɰɢɩ ɩɪɚɜɨɜɨɝɨ ɚɤɬɚ.
ɗɤɨɧɨɦɢɱɟɫɤɢɦ ɪɚɫɱɺɬɨɦ ɭɫɬɚɧɨɜɢɬɶ ɨɛɨɫɧɨɜɚɧɧɭɸ ɰɟɧɭ ɧɚ ɨɛɫɥɭɠɢɜɚɧɢɟ ɢ ɫɨɤɪɚɬɢɬɶ ɥɢɲɧɢɟ ɡɚɬɪɚɬɵ.
ɋɨɡɞɚɬɶ ɤɨɦɩɥɟɤɫɧɭɸ ɫɯɟɦɭ ɨɛɫɥɭɠɢɜɚɧɢɹ ɢ ɩɟɪɟɞɜɢɠɟɧɢɹ ɝɨɪɨɞɫɤɨɝɨ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ.
Ɂɚɩɪɟɬɢɬɶ ɬɪɚɧɫɩɨɪɬɧɵɦ ɟɞɢɧɢɰɚɦ ɩɟɪɟɜɨɡɤɭ ɩɚɫɫɚɠɢɪɨɜ ɭɱɚɫɬɜɭɸɳɢɯ ɧɚ ɦɚɪɲɪɭɬɚɯ ɬɪɨɥɥɟɣɛɭɫɨɜ.
ɍɥɭɱɲɢɬɶ ɷɤɫɩɥɭɚɬɚɰɢɸ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɩɚɪɤɚ ɢ ɫɨɯɪɚɧɢɬɶ ɟɺ ɫɬɚɛɢɥɶɧɨɫɬɶ.
ȼɬɨɪɨɣ ɷɬɚɩ: 2017–2021 ɝ.ɝ
ɍɜɟɥɢɱɢɬɶ ɱɢɫɥɨ ɩɚɫɫɚɠɢɪɨɩɨɬɨɤɨɜ ɢ ɫɨɛɥɸɞɚɬɶ ɤɚɱɟɫɬɜɨ ɨɛɫɥɭɠɢɜɚɧɢɹ.
ɉɪɨɢɡɜɨɞɢɬɶ ɬɟɯɧɢɱɟɫɤɨɟ ɨɫɧɚɳɟɧɢɟ ɬɪɨɥɥɟɣɛɭɫɨɜ ɧɚ ɨɫɧɨɜɚɧɢɢ ɬɟɯɧɨɥɨɝɢɣ ɷɤɨɧɨɦɧɨ ɪɚɫɯɨɞɭɸɳɢɯ ɷɥɟɤɬɪɢɱɟɫɤɭɸ ɷɧɟɪɝɢɸ.
Ɂɚɦɟɧɢɬ ɫɬɚɪɵɯ ɬɪɨɥɥɟɣɛɭɫɨɜ ɧɚ ɧɨɜɵɟ ɩɨ ɩɪɢɧɰɢɩɭ, ɭɞɨɜɥɟɬɜɨɪɹɸɳɭɸ ɬɪɟɛɨɜɚɧɢɟ ɬɪɨɥɥɟɣɛɭɫɧɨɣ ɨɪɝɚɧɢɡɚɰɢɢ.
ɍɜɟɥɢɱɢɬɶ ɱɢɫɥɨ ɬɪɨɥɥɟɣɛɭɫɧɵɯ ɦɚɪɲɪɭɬɨɜ.
4. Ɏɢɧɚɧɫɢɪɨɜɚɧɢɟ ɩɪɨɝɪɚɦɦɵ
Ɏɢɧɚɧɫɢɪɨɜɚɧɢɟ ɬɪɨɥɥɟɣɛɭɫɧɨɣ ɨɪɝɚɧɢɡɚɰɢɢ ɩɪɨɢɡɜɨɞɢɬɫɹ ɩɨ ɫɥɟɞɭɸɳɟɣ ɮɨɪɦɟ.
Ɏɢɧɚɧɫɢɪɨɜɚɬɶ ɢɡ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɛɸɞɠɟɬɚ
Ɏɢɧɚɧɫɢɪɨɜɚɬɶ ɢɡ ɝɨɪɨɞɫɤɨɝɨ ɢ ɪɚɣɨɧɨɝɨ ɛɸɞɠɟɬɚ
ȼ ɪɚɦɤɚɯ ɡɚɤɨɧɚ ɢɫɩɨɥɶɡɨɜɚɬɶ ɜɫɟ ɜɨɡɦɨɠɧɵɟ ɜɚɪɢɚɧɬɵ ɫɚɦɨɮɢɧɚɧɫɢɪɨɜɚɧɢɹ.
5. Ɋɟɡɭɥɶɬɚɬ ɩɪɨɝɪɚɦɦɵ
ɑɬɨɛɵ ɤɨɧɬɪɨɥɢɪɨɜɚɬɶ ɜɵɩɨɥɧɟɧɢɟ ɞɜɭɯ ɷɬɚɩɧɨɣ ɩɪɨɝɪɚɦɦɵ, ɩɪɟɞɥɨɠɟɧ ɨɛɪɚɡɟɰ ɜ ɧɢɠɟ ɭɤɚɡɚɧɧɵɯ ɬɚɛɥɢɰɚɯ.
Ɍɚɛɥɢɰɚ 1
ɉɨɤɚɡɚɬɟɥɢ ɛɟɡ ɭɛɵɬɨɱɧɨɝɨ ɞɟɣɫɬɜɢɹ ɷɥɟɤɬɪɢɱɟɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ
ʋ
ɉɨɤɚɡɚɬɟɥɢ
1
2
3
4
ɍɪɨɜɟɧɶ ɤɨɦɩɟɧɫɚɰɢɢ ɨɛɫɥɭɠɢɜɚɧɢɹ ɩɚɫɫɚɠɢɪɨ ɩɟɪɟɜɨɡɨɤ
ɍɪɨɜɟɧɶ ɞɨɯɨɞɚ
ɋɪɟɞɧɹɹ ɫɬɨɢɦɨɫɬɶ ɩɪɢ ɩɟɪɟɜɨɡɤɟ ɨɞɧɨɝɨ ɩɚɫɫɚɠɢɪɚ
ɍɪɨɜɟɧɶ ɡɚɬɪɚɬ ɤɨɦɩɟɧɫɚɰɢɢ ɩɨ ɭɬɜɟɪɠɞɟɧɧɨɦɭ ɬɚɪɢɮɭ
ɟɞ. ɢɡɦɟɪɟɧɢɣ
%
%
ɬɭɝɪɢɤ
%
ɗɬɚɩɵ
2014–2017
2017–2021
94,3–98,0
100,0
1,4–2,0
3,0
200–250
250
26,6–29,7
30
Ɍɚɛɥɢɰɚ 2
ɉɨɤɚɡɚɬɟɥɢ ɞɥɹ ɨɛɟɫɩɟɱɟɧɢɹ ɛɟɡ ɭɛɵɬɨɱɧɨɣ ɪɚɛɨɬɵ ɬɪɨɥɥɟɣɛɭɫɧɨɣ ɨɪɝɚɧɢɡɚɰɢɢ
ɟɞ. ɢɡɦɟɪɟɧɢɣ
1 Ʉɨɥɢɱɟɫɬɜɨ ɩɟɪɟɞɜɢɠɧɨɝɨ ɫɨɫɬɚɜɚ ɡɚɤɨɧɱɢɜɲɢɣ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɵɣ ɩɪɨɛɟɝ
%
2
Ʉɨɥɢɱɟɫɬɜɨ ɧɨɜɵɯ ɬɪɨɥɥɟɣɛɭɫɨɜ
ɲ
3 ɑɢɫɥɨ ɨɫɧɚɳɺɧɧɵɯ ɧɨɜɵɦɢ ɬɟɯɧɨɥɨɝɢɹɦɢ ɢ ɜɨɫɬɚɧɨɜɥɟɧɵɯ ɬɪɨɥɥɟɣɛɭɫɨɜ
ɲ
4
Ʉɨɥɢɱɟɫɬɜɨ ɫɩɢɫɚɧɵɯ ɬɪɨɥɥɟɣɛɭɫɨɜ
ɲ
5
Ʉɨɷɮɮɢɰɢɟɧɬ ɷɤɫɩɥɭɚɬɚɰɢɢ ɩɚɪɤɚ
%
6
Ɂɚɬɪɚɬɚ ɷɥɟɤɬɪɢɱɟɫɤɨɣ ɷɧɟɪɝɢɢ ɧɚ ɨɞɢɧ ɤɢɥɨɦɟɬɪ
ɤȼɬ
7 ɋɷɤɨɧɨɦɥɟɧɧɚɹ ɷɥɟɤɬɪɢɱɟɫɤɚɹ ɷɧɟɪɝɢɹ ɩɪɢ ɜɧɟɞɪɟɧɢɣ ɧɨɜɨɣ ɬɟɯɧɨɥɨɝɢɢ
ɤȼɬ/ɱ
8
ɍɜɟɥɢɱɟɧɢɟ ɬɪɨɥɥɟɣɛɭɫɧɨɝɨ ɦɚɪɲɪɭɬɚ
ɤɦ
ɱɟɥɨɜɟɤ/
9
ɉɚɫɫɚɠɢɪɨ ɩɨɬɨɤ
ɦɢɧ
10
ɋɬɚɛɢɥɶɧɨɟ ɞɜɢɠɟɧɢɟ ɜ ɦɚɪɲɪɭɬɟ
%
ʋ
ɉɨɤɚɡɚɬɟɥɢ
ɗɬɚɩɵ
2014–2017
2017–2021
90–81
51
10
35
20
50
10
20
65,9–66,0
72,0
2,0–1,8
1,5
68,0–95,0
120,0
20
50
38,3–161,2
205,4
88,0–90,0
98,0
ȼɵɜɨɞ: ɇɚ ɫɟɝɨɞɧɹɲɧɵɣ ɞɟɧɶ ɨɤɨɥɨ 60 % ɬɪɨɥɥɟɣɛɭɫɨɜ ɬɟɯɧɢɱɟɫɤɢ ɢɡɧɨɳɟɧɧɨ, ɜɫɥɟɞɫɬɜɢɢ ɷɬɨɝɨ ɪɟɦɨɧɬ ɧɚ ɦɚɪɲɪɭɬɚɯ ɭɜɟɥɢɱɢɜɚɟɬɫɹ, ɤɨɬɨɪɵɣ ɨɱɟɧɶ ɱɭɜɫɬɜɢɬɟɥɶɧɨ ɜɥɢɹɟɬ ɧɚ ɩɚɫɫɚɠɢɪɨɩɨɬɨɤ.
ȼ 2012 ɝɨɞɭ ɨɞɧɢɦ ɬɪɨɥɥɟɣɛɭɫɨɦ ɛɵɥɨ ɨɛɫɥɭɠɟɧɨ 1,12 ɦɢɥɥɢɨɧ ɩɚɫɫɚɠɢɪɨɜ, ɚ ɜ 2013 ɝɨɞɭ ɫɬɚɥɨ
0,56 ɦɢɥɥɢɨɧɨɜ ɩɚɫɫɚɠɢɪɨɜ, ɱɬɨ ɨɡɧɚɱɚɟɬ ɩɚɫɫɚɠɢɪɨɩɨɬɨɤ ɫɨɤɪɚɬɢɥɫɹ ɜ ɞɜɚ ɪɚɡɚ. Ⱦɥɹ ɞɚɥɶɧɟɣɲɟɝɨ ɪɚɡɜɢɬɢɹ ɛɵɥ ɩɪɟɞɥɨɠɟɧ ɦɚɪɤɟɬɢɧɝɨɜɵɣ ɩɪɨɟɤɬ. ɉɪɢ ɨɫɭɳɟɫɬɜɥɟɧɢɢ ɩɟɪɜɨɝɨ ɷɬɚɩɚ ɦɚɪɤɟɬɢɧ294
ɝɨɜɨɝɨ ɩɪɨɟɤɬɚ ɨɬ 2014–2017 ɝɨɞɚ, ɷɤɫɩɥɭɚɬɚɰɢɹ ɩɚɪɤɚ ɨɛɧɨɜɢɬɫɹ ɧɚ 50 %, ɦɚɪɲɪɭɬ ɩɪɢɛɚɜɢɬɫɹ
ɨɬ ɨɞɧɨɝɨ ɞɨ ɱɟɬɵɪɺɯ ɥɢɧɢɣ, ɭɩɥɨɬɧɟɧɢɟ ɞɜɢɠɟɧɢɣ ɫɬɚɧɟɬ ɜ 2 ɪɚɡɚ ɛɨɥɶɲɟ, ɚ ɩɪɢɛɵɥɶ ɭɜɟɥɢɱɢɬɫɹ
ɞɨ 92–98 %. Ⱦɚɥɶɲɟ ɩɪɢ ɪɟɚɥɢɡɚɰɢɢ ɜɬɨɪɨɝɨ ɷɬɚɩɚ ɨɬ 2017–2020 ɝɨɞɚ ɮɨɪɦɢɪɭɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ
ɬɪɨɥɟɣɛɭɫɚɦ ɫɬɚɬɶ ɥɢɞɢɪɭɸɳɢɦ ɝɨɪɨɞɫɤɢɦ ɷɤɨɬɪɚɧɫɩɨɪɬɨɦ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
ɋɨɨɛɳɟɧɢɟ ɭɩɪɚɜɥɟɧɢɣ ɝɨɪɨɞɫɤɨɝɨ ɬɪɚɧɫɩɨɪɬɚ. ɍɥɚɚɧɛɚɚɬɚɪ. 2011–2013.
ɂɡ ɚɪɯɢɜɚ ɷɥɟɤɬɪɨ ɬɪɚɧɫɩɨɪɬɧɨɝɨ ɨɪɝɚɧɚ. ɍɥɚɚɧɛɚɚɬɚɪ. -2012 ɝɨɞ. -2013 ɝɨɞɚ.
Ȼɚɹɪɞɚɥɚɣ.Ʌ. Ɇɚɪɤɟɬɢɧɝ ɛɢɡɧɟɫɚ. ɍɥɚɚɧɛɚɚɬɚɪ. -2001. -ɋ. 150–202.
ɊȿɁɍɅɖɌȺɌɕ ɂɋɋɅȿȾɈȼȺɇɂə ɂɁɇɈɋɈȼ ȾȼɂȽȺɌȿɅȿɃ
ɌɊȺɄɌɈɊɈȼ ɊȺȻɈɌȺɘɓɂɏ ȼ ɁȿɆɅȿȾȿɅɂɂ ɆɈɇȽɈɅɂɂ
ɋɉȿɄɌɊɈɆȿɌɊɂɑȿɋɄɂɆ ɆȿɌɈȾɈɆ
ȾȺȼȺȺɋɍɊɗɇ Ƚ., ȽȺɇɌɍɅȽȺ Ƚ.,
Ɇɨɧɝɨɥɶɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɚɝɪɚɪɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ,
ȿ-ɩɨɱɬɚ: davaasuren_g@muls.edu.mn
1. Ɇɟɬɨɞɢɤɚ ɢɫɩɵɬɚɧɢɹ
ȼ ɩɟɪɜɨɦ ɷɬɚɩɟ ɧɚɲɟɣ ɢɫɫɥɟɞɨɜɚɧɢɣ ɧɚɦɢ ɩɪɨɜɟɞɟɧɵ ɩɨɥɟɜɵɟ ɷɤɫɩɟɪɢɦɟɧɬɵ ɩɨ ɨɩɪɟɞɟɥɟɧɢɸ
ɫɨɞɟɪɠɚɧɢɹ ɦɟɬɚɥɥɢɱɟɫɤɢɯ, ɦɢɧɟɪɚɥɢɱɟɫɤɢɯ ɢ ɞɪɭɝɢɯ ɱɚɫɬɢɰ ɧɚɯɨɞɹɳɢɯɫɹ ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ
ɞɜɢɝɚɬɟɥɟɣ ɨɞɧɨɣ ɢ ɬɨɠɟ ɦɚɪɤɚ ɬɪɚɤɬɨɪɨɜ ɑɟɥɥɟɧɠɟɪɚ ɆɌ595ȼ ɫ ɞɜɢɝɚɬɟɥɟɦ AGCO SISU ɫ ɪɚɡɥɢɱɧɵɦ ɫɪɨɤɨɦ ɷɤɫɩɥɭɚɬɚɰɢɢ /1, 2, 3 ɢ 4 ɝɨɞɚ/ ɪɚɛɨɬɚɸɳɢɯ ɜ ɩɨɥɟɜɵɯ ɪɚɛɨɬɚɯ ɜ ɰɟɧɬɪɚɥɶɧɨɣ
ɡɟɦɥɟɞɟɥɶɱɟɫɤɨɣ ɡɨɧɟ Ɇɨɧɝɨɥɢɢ. ɗɬɢ ɷɤɫɩɟɪɢɦɟɧɬɵ ɛɵɥɢ ɩɪɨɜɟɞɟɧɵ ɜ ɤɨɦɩɚɧɢɢ ɫ ɨɝɪɚɧɢɱɟɧɧɨɣ
ɨɬɜɟɬɫɜɟɧɧɨɫɬɢ ɄɈɈ “ɏɭɯ ɛɭɥɚɝ” ɀɚɪɝɚɥɚɧɬ ɫɭɦɨɧ, Ɍɭɜ ɚɣɦɚɝ. ȼ ɤɚɱɟɫɬɜɟ ɦɨɬɨɪɧɨɝɨ ɦɚɫɥɨ ɢɫɩɨɥɶɡɨɜɚɧ ɦɚɫɥɨ CAT 10W30.
Ɉɛɪɚɡɰɵ ɦɨɬɨɪɧɨɝɨ ɦɚɫɥɨ ɨɬɨɛɪɚɧɵ ɫ ɩɨɦɨɳɶɸ ɫɩɟɰɢɚɥɶɧɨɝɨ ɩɪɢɛɨɪɚ ɢɡ ɞɜɢɝɚɬɟɥɟɣ ɬɪɚɤɬɨɪɨɜ ɜ ɬɭɛɚɯ ɜɨ ɜɪɟɦɹ ɩɨɥɟɜɵɯ ɪɚɛɨɬ ɢ ɩɪɨɚɧɚɥɢɡɢɪɨɜɚɧɵ ɧɚ ɚɬɨɦɧɨɦ ɷɦɢɫɫɢɨɧɧɨɦ ɫɩɟɤɬɪɨɦɟɬɪɟ.
ɉɨ ɧɚɬɭɪɟ ɱɚɫɬɢɰɵ ɧɚɯɨɞɹɳɢɯɫɹ ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ ɪɚɫɫɦɚɬɪɢɜɚɸɬɫɹ ɧɚ ɫɥɟɞɭɸɳɢɟ ɬɪɢ ɮɪɚɤɰɢɢ; ɩɪɨɞɭɤɬɵ ɢɡɧɨɫɨɜ ɫɨɩɪɢɤɚɫɚɸɳɢɯɫɹ ɩɨɜɟɪɯɧɨɫɬɟɣ ɞɟɬɚɥɟɣ ɞɜɢɝɚɬɟɥɟɣ – ɦɟɬɚɥɥɢɱɟɫɤɢɟ ɱɚɫɬɢɰɵ, ɡɚɝɪɟɡɧɟɧɧɨɫɬɶ ɦɨɬɨɪɧɵɯ ɦɚɫɟɥ ɨɬ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ – ɱɚɫɬɢɰɵ ɩɵɥɟɣ, ɩɪɨɞɭɤɬɵ ɫɝɨɪɟɧɢɹ ɪɚɡɥɢɱɧɵɯ ɷɥɟɦɟɧɬɨɜ ɦɨɬɨɪɧɨɝɨ ɦɚɫɥɨ – ɧɚɝɚɪɵ.
2. Ɋɟɡɭɥɶɬɚɬɵ ɢɫɩɵɬɚɧɢɹ
ɉɨ ɪɟɡɭɥɶɬɚɬɨɦ ɩɨɥɟɜɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɫɬɪɨɟɧ ɝɪɚɮɢɤɢ ɢɡɦɟɧɟɧɢɹ ɫɨɞɟɪɠɚɧɢɹ ɦɟɬɚɥɥɢɱɟɫɤɢɯ ɢ ɞɪɭɝɢɯ ɫɦɟɫɟɣ ɧɚɯɨɞɹɲɢɯɫɹ ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɪɨɤɢ ɷɤɩɥɭɚɬɚɰɢɢ ɬɪɚɤɬɨɪɨɜ. ɇɚ ɫɥɟɞɭɸɳɢɦ ɪɢɫɭɧɤɟ ɩɨɤɚɡɚɧ ɢɡɦɟɧɟɧɢɹ ɫɨɞɟɪɠɚɧɢɹ ɦɟɬɚɥɥɢɱɟɫɤɢɯ ɫɦɟɫɟɣ ɜ ɬɨɦ ɱɢɫɥɟ
ɠɟɥɟɡɚ ɜ ɟɞɢɧɢɰɚɯ ppm (parts per million) ɢɥɢ 0,0001 %, ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ ɞɜɢɝɚɬɟɥɹ ɧɚɦɢ ɜɵɛɪɚɧɧɵɯ ɬɪɚɤɬɨɪɨɜ ɜ ɡɚɜɢɫɦɨɫɬɢ ɨɬ ɢɯ ɜɪɟɦɟɧɢ ɷɤɫɩɥɭɚɬɚɰɢɢ ɜ ɭɫɥɨɜɢɹɯ Ɇɨɧɝɨɥɢɢ.
Ɋɢɫ.1. ɋɨɞɟɪɠɚɧɢɟ ɱɚɫɬɢɰ ɠɟɥɟɡɚ (Fe) ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ
ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɪɨɤɢ ɷɤɩɥɭɚɬɚɰɢɢ ɞɜɢɝɚɬɟɥɹ, ppm
295
ɂɡ ɪɢɫɭɧɤɢ 1 ɜɢɞɧɨ, ɱɬɨ ɤɨɥɢɱɟɫɬɜɚ ɠɟɥɟɡɧɵɯ ɱɚɫɬɢɰ ɭɜɟɥɢɱɢɜɚɟɬɫɹ ɜ ɡɚɜɢɦɨɫɬɢ ɨɬ ɫɪɨɤɢ
ɷɤɩɥɭɚɬɚɰɢɢ ɢ ɦɨɠɧɨ ɪɚɫɫɭɠɞɚɬɶ ɱɬɨ ɢɡɧɨɫɵ ɫɨɩɪɢɤɚɫɚɸɳɢɯɫɹ ɩɨɜɟɪɧɨɫɬɟɣ ɞɟɬɚɥɟɣ ɞɜɢɝɚɬɟɥɹ
ɢɧɬɟɧɫɢɜɧɨ ɭɜɟɥɢɱɢɜɚɸɫɹ ɜ ɭɫɥɨɜɢɹɯ Ɇɨɧɝɨɥɢɢ ɢ ɬɚɤɠɟ ɧɚɦɢ ɨɛɪɚɛɨɬɚɧɨ ɦɚɬɟɦɚɬɢɱɟɫɤɢɣ ɦɨɞɟɥɶ
ɤɨɬɨɪɨɣ ɩɨɤɚɡɚɧɚ ɧɚ ɷɬɨɣ ɝɪɚɮɢɤɟ.
ȼ ɭɫɥɨɜɢɹɯ Ɇɨɧɝɨɥɢɢ ɫɜɹɡɢ ɫ ɡɚɫɭɳɥɢɜɨɫɬɢ ɜɨɡɞɭɯɚ ɜɨ ɜɪɟɦɹ ɩɨɫɟɜɧɵɯ ɢ ɩɨɱɜɨɨɛɪɚɛɚɬɵɸɳɢɯ
ɨɩɟɪɚɰɢɢ ɩɵɥɶ ɩɨɞɧɢɦɚɟɬɫɹ ɧɚ ɩɨɥɟ ɝɞɟ ɪɚɛɨɬɚɸɬ ɬɪɚɤɬɨɪɨɜ ɜɫɥɟɞɫɜɢɹ ɱɟɝɨ ɦɢɧɟɪɚɥɶɧɵɟ ɱɚɫɬɢɰɵ
ɞɨɫɬɚɸɬɫɹ ɜ ɞɜɢɝɚɬɟɥɶ ɱɟɪɟɡ ɜɨɡɞɭɯɨɱɢɫɬɢɬɟɥɟɣ ɞɜɢɝɚɬɟɥɟɣ ɜɧɭɬɪɟɧɧɨɝɨ ɫɝɨɪɚɧɢɹ. Ɉɫɧɨɜɵɜɚɹɫɶ
ɜɵɳɟɫɤɚɡɚɧɧɨɝɨ ɩɨ ɫɨɞɟɪɠɚɧɢɸ ɨɤɢɫɟɣ ɤɪɟɦɧɢɹ (SiO2) ɜ ɨɛɪɚɰɡɚɯ ɢɫɫɥɟɞɭɟɦɨɝɨ ɦɨɬɨɪɧɨɝɨ ɦɚɫɥɚ ɦɨɠɧɨ ɪɚɫɫɭɠɞɚɬɶ ɡɚɝɪɟɡɧɟɧɧɨɫɬɢ ɦɨɬɨɪɧɵɯ ɦɚɫɟɥ ɦɢɧɟɪɚɥɶɧɵɦɢ ɱɚɫɬɢɰɚɦɢ ɨɬ ɨɤɪɭɠɚɸɳɟɣ
ɫɪɟɞɵ ɝɞɟ ɪɚɛɨɬɚɸɬ ɞɜɢɝɚɬɟɥɟɣ ɬɪɚɤɬɨɪɨɜ. ɉɨɷɬɨɦɭ ɧɚɦɢ ɬɚɤɠɟ ɨɩɪɟɞɟɥɟɧɵ ɬɟɦ ɠɟ ɦɟɬɨɞɨɦ ɤɚɤ
ɦɟɬɚɥɥɢɱɟɫɤɢɯ ɷɥɟɦɟɧɬɨɜ, ɤɨɥɢɱɟɫɬɜɚ ɦɢɧɟɪɚɥɶɧɵɯ ɱɚɫɬɢɰ ɜ ɬɨɦ ɱɢɫɥɟ ɨɤɢɫɟɣ ɤɪɟɦɧɢɹ ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ ɢ ɩɨɫɬɪɨɟɧ ɝɪɚɮɢɤɚ ɩɨ ɪɟɡɭɥɶɬɚɬɨɦ ɢ ɩɪɟɞɫɬɚɜɥɟɧ ɧɚ ɫɥɟɞɭɸɳɢɦ ɪɢɫɭɧɤɟ.
Ɋɢɫ.2. ɋɨɞɟɪɠɚɧɢɟ ɱɚɫɬɢɰ ɤɪɟɦɧɢɹ (Si) ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ
ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɪɨɤɢ ɷɤɩɥɭɚɬɚɰɢɢ ɞɜɢɝɚɬɟɥɹ, ppm
Ʉɚɤ ɩɨɤɚɡɵɜɚɟɬ ɪɟɡɭɥɶɬɚɬɵ ɢɡɦɟɪɟɧɢɹ ɤɨɥɢɱɟɫɬɜɚ ɱɚɫɬɢɰ ɤɪɟɦɧɢɹ ɧɚɯɨɞɹɳɢɯɫɹ ɜ ɨɬɪɚɛɨɬɚɧɧɨɦ
ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ, ɩɨ ɜɪɟɦɟɧɢ ɷɤɫɩɥɭɚɬɚɰɢɢ ɱɚɫɬɢɰɵ ɤɪɟɦɧɢɹ, ɩɪɟɞɫɬɚɜɥɹɸɳɢɯ ɡɚɝɪɟɡɧɟɧɧɨɫɬɢ
ɦɨɬɨɪɧɵɯ ɦɚɫɟɥ ɨɬ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ ɭɜɟɥɢɱɢɜɚɸɬɫɹ ɜɫɥɟɞɬɜɢɹ ɱɟɝɨ ɢɡɧɨɫɵ ɞɟɬɚɥɟɣ ɫɨ ɫɦɚɡɤɨɣ
ɬɚɤɠɟ ɭɜɟɥɢɱɢɜɚɸɬɫɹ.
ȼɵɜɨɞɵ:
Ɋɟɡɭɥɶɬɚɬɵ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɤɚɡɵɜɚɸɬ ɱɬɨ ɢɡɧɨɫɵ ɫɨɩɪɢɤɚɫɚɸɳɢɯɫɹ ɩɨɜɟɪɯɧɨɫɬɟɣ ɞɟɬɚɥɟɣ ɞɜɢɝɚɬɟɥɹ ɜ ɪɚɛɬɚɸɳɢɯ ɩɨɥɟɜɵɯ ɭɫɥɨɜɢɹɯ Ɇɨɧɝɨɥɢɢ ɢɧɬɟɧɫɢɜɧɨ ɭɜɟɥɢɱɢɜɚɸɬɫɹ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɪɨɤɢ ɚ ɬɚɤɠɟ ɨɬ ɭɫɥɨɜɢɣ ɷɤɩɥɭɚɬɚɰɢɢ.
ɇɚ ɢɡɧɨɫɵ ɞɟɬɚɥɟɣ ɞɜɢɝɚɬɟɥɟɣ ɪɚɛɨɬɚɸɳɢɯ ɜ ɡɟɦɥɟɞɟɥɶɱɟɫɤɢɯ ɪɚɛɨɬ ɛɨɥɶɲɨɟ ɜɥɢɹɧɢɟ ɨɤɚɡɵɜɚɸɬ ɡɚɝɪɟɡɧɟɧɧɨɫɬɢ ɦɨɬɨɪɧɵɯ ɦɚɫɟɥ ɨɬ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ, ɱɬɨ ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɧɚɤɨɩɥɟɧɢɹ
ɱɚɫɬɢɰɵ ɤɪɟɦɧɢɹ ɧɚɯɨɞɹɲɢɯɫɹ ɜ ɦɨɬɨɪɧɨɦ ɦɚɫɥɟ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ:
ɑ.Ⱥɜɞɚɣ, Ɇ.ɒɚɪɚɚ, Ƚ.Ƚɚɧɬɭɥɝɚ.,ɍ.ɍɥɚɦɛɚɹɪ, Ⱦ.Ⱥɦɝɚɥɚɧ “ɋɦɚɡɨɱɧɵɟ ɦɚɬɟɪɢɚɥɵ” 2000.
ɑ.Ⱥɜɞɚɣ, Ƚ.Ƚɚɧɬɭɥɝɚ, Ɋ.Ɇɚɪɱɚɤ “ɇɚɡɧɚɱɟɧɢɟ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɬɨɩɥɢɜɚ ɫɦɚɡɨɱɧɵɯ ɢ ɨɯɥɚɠɞɚɸɳɢɯ ɜɟɳɟɫɬɜ” ɍɥɚɚɧɛɚɚɬɚɪ 2002 ɝ., 3.5 ɩ.ɥ.
B. Bhushan “Modern Tribology Handbook” vol. Two, CRC Press, 2001.
Ashley Mayer “Limits-the robots of oil analysis” Technical bulletin issue 48. 2010.
http://wearcheck.co.za/
1.
2.
3.
4.
5\
ɍȾɄ 621.43.001
ɂɋɉɈɅɖɁɈȼȺɇɂȿ ɄɈɆɉɖɘɌȿɊɇɈɃ ɆɈȾȿɅɂ ɉɊɂ ȾɂȺȽɇɈɋɌɂɊɈȼȺɇɂɂ ɌɊȺɄɌɈɊɇɕɏ ȾȼɂȽȺɌȿɅȿɃ
ȾɈȻɊɈɅɘȻɈȼ ɂ.ɉ., ɋȺȼɑȿɇɄɈ Ɉ.Ɏ.
ɎȽȻɇɍ ɋɢɛɢɪɫɤɢɣ ɮɢɡɢɤɨ-ɬɟɯɧɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ ɚɝɪɚɪɧɵɯ ɩɪɨɛɥɟɦ, ɇɨɜɨɫɢɛɢɪɫɤ,
Ɋɨɫɫɢɹ. E-mail: sof-oleg46@yandex.ru
Ⱦɢɚɝɧɨɫɬɢɪɨɜɚɧɢɟ ɬɪɚɤɬɨɪɧɵɯ ɞɜɢɝɚɬɟɥɟɣ ɜɧɭɬɪɟɧɧɟɝɨ ɫɝɨɪɚɧɢɹ (Ⱦȼɋ) ɨɫɧɨɜɚɧɨ ɧɚ ɢɡɦɟɪɟɧɢɢ ɞɟɬɟɪɦɢɧɢɪɨɜɚɧɧɵɯ ɢ ɜɟɪɨɹɬɧɨɫɬɧɵɯ ɩɚɪɚɦɟɬɪɨɜ ɪɚɛɨɱɢɯ ɩɪɨɰɟɫɫɨɜ ɞɜɢɝɚɬɟɥɹ, ɫɪɚɜɧɟɧɢɢ
296
ɢɯ ɩɨ ɤɚɤɨɦɭ-ɥɢɛɨ ɤɪɢɬɟɪɢɸ ɫ ɡɚɪɚɧɟɟ ɭɫɬɚɧɨɜɥɟɧɧɵɦɢ ɡɧɚɱɟɧɢɹɦɢ ɢ ɨɬɧɟɫɟɧɢɢ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ
ɤ ɨɩɪɟɞɟɥɟɧɧɨɦɭ ɤɥɚɫɫɭ ɩɨ ɦɢɧɢɦɭɦɭ ɦɟɪɵ ɛɥɢɡɨɫɬɢ ɤ ɷɬɨɦɭ ɤɥɚɫɫɭ. ɉɪɢ ɷɬɨɦ ɢɞɟɧɬɢɮɢɤɚɰɢɹ
ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ ɬɪɟɛɭɟɬ ɩɪɢɦɟɧɟɧɢɹ ɦɚɬɟɦɚɬɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ ɤɥɚɫɫɢɮɢɤɚɰɢɢ ɫɨɫɬɨɹɧɢɣ ɢ ɪɚɫɩɨɡɧɚɜɚɧɢɹ ɨɛɪɚɡɨɜ, ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɮɨɪɦɢɪɨɜɚɧɢɹ ɛɚɡ ɞɚɧɧɵɯ ɢ ɡɧɚɧɢɣ.
Ɋɟɡɭɥɶɬɚɬɵ ɩɪɨɜɟɞɟɧɧɵɯ ɜ ɋɢɛɎɌɂ ɫɨɜɦɟɫɬɧɨ ɫ ɇȽȺɍ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɡɜɨɥɢɥɢ ɨɛɨɫɧɨɜɚɬɶ
ɩɪɢɦɟɧɟɧɢɟ ɭɤɚɡɚɧɧɵɯ ɦɟɬɨɞɨɜ ɞɥɹ ɚɜɬɨɦɚɬɢɡɚɰɢɢ ɩɪɨɰɟɫɫɚ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɫɨɫɬɨɹɧɢɣ ɦɚɲɢɧ ɢ
ɦɟɯɚɧɢɡɦɨɜ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɢ ɭɩɪɚɜɥɹɸɳɢɯ ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ, ɫɨɡɞɚɬɶ ɢ ɪɚɡɜɢɜɚɬɶ ɢɡɦɟɪɢɬɟɥɶɧɭɸ ɷɤɫɩɟɪɬɧɭɸ ɫɢɫɬɟɦɭ Ⱦȼɋ (ɂɗɋȾ) [1–3].
ɉɨɜɵɲɟɧɢɸ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɪɢɦɟɧɟɧɢɹ ɂɗɋȾ ɜ ɫɨɫɬɚɜɟ ɚɞɚɩɬɢɜɧɨɝɨ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɝɨ
ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɤɨɦɩɥɟɤɫɚ ɢɫɩɵɬɚɧɢɹɦɢ (ȺɌɄɂ) Ⱦȼɋ [4–6] ɜ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɵɯ ɭɫɥɨɜɢɹɯ ɫɩɨɫɨɛɫɬɜɭɟɬ ɤɨɦɩɶɸɬɟɪɧɚɹ ɦɨɞɟɥɶ Ⱦȼɋ [7], ɩɨɡɜɨɥɹɸɳɚɹ ɧɚɫɬɪɚɢɜɚɬɶ ɩɚɪɚɦɟɬɪɵ ȺɌɄɂ ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɡɚɞɚɸɳɢɦ ɜɨɡɞɟɣɫɬɜɢɟɦ, ɤɨɬɨɪɨɦɭ ɞɨɥɠɟɧ ɫɨɨɬɜɟɬɫɬɜɨɜɚɬɶ ɩɨɞɥɟɠɚɳɢɣ ɞɢɚɝɧɨɫɬɢɪɨɜɚɧɢɸ ɢɫɩɵɬɭɟɦɵɣ ɞɜɢɝɚɬɟɥɶ.
ɇɚɩɪɢɦɟɪ, ɩɪɢ ɩɨɫɥɟɪɟɦɨɧɬɧɨɣ ɨɛɤɚɬɤɟ ɧɟɨɛɯɨɞɢɦɨ ɧɚɫɬɪɨɢɬɶ ɬɨɩɥɢɜɧɭɸ ɫɢɫɬɟɦɭ ɢɥɢ ɨɰɟɧɢɬɶ ɤɚɱɟɫɬɜɨ ɩɪɢɪɚɛɨɬɤɢ ɫɨɩɪɹɠɟɧɢɣ ɞɜɢɝɚɬɟɥɹ (ɭɪɨɜɟɧɶ ɦɨɦɟɧɬɚ ɬɪɟɧɢɹ) ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ
ɷɬɚɥɨɧɧɵɦɢ (ɦɨɞɟɥɶɧɵɦɢ) ɡɧɚɱɟɧɢɹɦɢ. ɋ ɭɱɟɬɨɦ ɢɡɦɟɪɟɧɧɵɯ ɡɧɚɱɟɧɢɣ ɩɚɪɚɦɟɬɪɨɜ Ⱦȼɋ ȺɌɄɂ
ɞɨɥɠɧɨ ɜɵɪɚɛɨɬɚɬɶ ɭɩɪɚɜɥɹɸɳɟɟ ɜɨɡɞɟɣɫɬɜɢɟ ɞɥɹ ɩɟɪɟɜɨɞɚ ɞɜɢɝɚɬɟɥɹ ɜ ɬɪɟɛɭɟɦɨɟ ɫɨɫɬɨɹɧɢɟ ɩɭɬɟɦ ɢɡɦɟɧɟɧɢɹ ɟɝɨ ɩɚɪɚɦɟɬɪɨɜ, ɪɟɠɢɦɨɜ ɪɚɛɨɬɵ ɢ ɞɪ.
ɇɟɨɛɯɨɞɢɦɨ ɧɚɫɬɪɨɢɬɶ ɩɚɪɚɦɟɬɪɵ ȺɌɄɂ ɬɚɤɢɦ ɨɛɪɚɡɨɦ, ɱɬɨɛɵ ɨɲɢɛɤɚ ɭɩɪɚɜɥɟɧɢɹ ɟ=ɭ-ɭɦĺ
min (ɪɢɫɭɧɨɤ, ɚ), ɝɞɟ ɭ ɢ ɭɦ – ɜɵɯɨɞɧɵɟ ɩɪɨɰɟɫɫɵ ɨɛɴɟɤɬɚ ɚɜɬɨɦɚɬɢɱɟɫɤɨɝɨ ɭɩɪɚɜɥɟɧɢɹ (ɈȺɍ) –
Ⱦȼɋ ɢ ɟɝɨ ɦɨɞɟɥɢ.
Ɋɢɫ. 1. ɋɬɪɭɤɬɭɪɧɚɹ ɫɯɟɦɚ ɚɞɚɩɬɢɜɧɨɣ ȺɌɄɂ ɫ ɷɬɚɥɨɧɧɨɣ ɤɨɦɩɶɸɬɟɪɧɨɣ ɦɨɞɟɥɶɸ (ɚ)
ɢ ɩɪɢɦɟɪ ɧɚɫɬɪɨɣɤɢ ɤɨɷɮɮɢɰɢɟɧɬɚ ɭɫɢɥɟɧɢɹ ɈȺɍ (ɛ)
Ⱥɥɝɨɪɢɬɦ ɧɚɫɬɪɨɣɤɢ ɩɚɪɚɦɟɬɪɨɜ ɨɩɪɟɞɟɥɹɟɬɫɹ ɭɪɚɜɧɟɧɢɟɦ
&
dq
dt
&
&
kɟ e gradq& e ,
&
ɝɞɟ q { q1 , ..., qn } – ɜɟɤɬɨɪ ɧɚɫɬɪɚɢɜɚɟɦɵɯ ɩɚɪɚɦɟɬɪɨɜ ȺɌɄɂ; kɟ – ɩɚɪɚɦɟɬɪ, ɨɩɪɟɞɟɥɹɸɳɢɣ
ɫɤɨɪɨɫɬɶ ɚɞɚɩɬɚɰɢɢ.
&
ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ ɨɲɢɛɤɢ ɭɩɋɨɫɬɚɜɥɹɸɳɢɟ ɜɟɤɬɨɪɚ gradq& e ɩɪɟɞɫɬɚɜɥɹɸɬ ɫɨɛɨɣ ɮɭɧɤɰɢɢ
&
ɪɚɜɥɟɧɢɹ ɩɨ ɨɬɧɨɲɟɧɢɸ ɤ ɧɚɫɬɪɚɢɜɚɟɦɵɦ ɩɚɪɚɦɟɬɪɚɦ q { q1 , ..., qn } . ȺɌɄɂ ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ
ɡɚɞɚɸɳɢɦ ɜɨɡɞɟɣɫɬɜɢɟɦ fɡ ɞɨɥɠɟɧ ɨɛɟɫɩɟɱɢɬɶ ɦɢɧɢɦɚɥɶɧɨɟ ɡɧɚɱɟɧɢɟ ɨɲɢɛɤɢ ɭɩɪɚɜɥɟɧɢɹ ɡɚ ɫɱɟɬ
ɜɵɪɚɛɨɬɤɢ ɬɪɟɛɭɟɦɨɝɨ ɭɩɪɚɜɥɹɸɳɟɝɨ ɜɨɡɞɟɣɫɬɜɢɹ u(t) ɧɚ ɈȺɍ. ɉɪɨɢɡɜɨɞɧɵɟ ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ
ɦɨɠɧɨ ɩɨɥɭɱɚɬɶ ɤɚɤ ɜɵɯɨɞɧɵɟ ɫɢɝɧɚɥɵ ɥɢɧɟɣɧɨɣ ɫɢɫɬɟɦɵ, ɜɨɡɛɭɠɞɚɟɦɨɣ
ɜɯɨɞɧɵɦɢ ɢ ɜɵɯɨɞɧɵɦɢ
&
ɫɢɝɧɚɥɚɦɢ ɨɛɴɟɤɬɚ. ɉɪɢ ɷɬɨɦ ɩɪɟɞɩɨɥɚɝɚɟɬɫɹ, ɱɬɨ ɩɚɪɚɦɟɬɪɵ
q
ɢɡɦɟɧɹɸɬɫɹ
ɡɧɚɱɢɬɟɥɶɧɨ ɦɟɞɥɟɧ&
ɧɟɟ ɞɪɭɝɢɯ ɩɟɪɟɦɟɧɧɵɯ ɈȺɍ. ɋɬɚɬɢɫɬɢɱɟɫɤɢɟ ɩɚɪɚɦɟɬɪɵ q ɩɪɨɰɟɫɫɨɜ ɧɚɫɬɪɚɢɜɚɸɬɫɹ ɚɧɚɥɨɝɢɱɧɨ
ɞɟɬɟɪɦɢɧɢɪɨɜɚɧɧɵɦ ɩɚɪɚɦɟɬɪɚɦ.
ɉɪɢɦɟɪ 1. Ⱥɞɚɩɬɢɜɧɚɹ ɧɚɫɬɪɨɣɤɚ ɤɨɷɮɮɢɰɢɟɧɬɚ ɭɫɢɥɟɧɢɹ ɈȺɍ (ɞɥɹ Ⱦȼɋ ɨɧ ɨɬɪɚɠɚɟɬ ɢɧɞɢɤɚɬɨɪɧɵɣ ɦɨɦɟɧɬ ɢɥɢ ɦɨɦɟɧɬ ɫɨɩɪɨɬɢɜɥɟɧɢɹ) (ɪɢɫɭɧɨɤ, ɛ). Ɇɨɞɟɥɶ ɢ ɈȺɍ ɯɚɪɚɤɬɟɪɢɡɭɸɬɫɹ ɩɟɪɟɞɚɬɨɱɧɨɣ ɮɭɧɤɰɢɟɣ Ʉ(s). Ɉɲɢɛɤɚ ɭɩɪɚɜɥɟɧɢɹ ɟ=y-yɦ=Ʉ(s)șfɡ-Ʉ(s)fɡ , ɝɞɟ s=d/dt – ɨɩɟɪɚɬɨɪ ɞɢɮɮɟɪɟɧɰɢɪɨɜɚɧɢɹ. Ɏɭɧɤɰɢɹ ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ
ɞɟ/ɞș=Ʉ(s)fɡ=yɦ.
Ⱥɥɝɨɪɢɬɦ ɧɚɫɬɪɨɣɤɢ ɩɚɪɚɦɟɬɪɚ:
dș/dt=-kɟyɦe.
ɉɪɢɦɟɪ 2. Ɉɛɴɟɤɬ ɢ ɦɨɞɟɥɶ (Ⱦȼɋ ɜ ɪɚɡɝɨɧɟ ɢɥɢ ɜɵɛɟɝɟ) ɨɩɢɫɵɜɚɸɬɫɹ ɭɪɚɜɧɟɧɢɹɦɢ
dɭ/dt=-ɚɭ+bu; dɭɦ /dt=-ɚɦɭɦ+bɦfɡ .
297
ɂɞɟɧɬɢɱɧɨɫɬɢ ɨɛɴɟɤɬɚ ɢ ɦɨɞɟɥɢ ɦɨɠɧɨ ɞɨɫɬɢɝɧɭɬɶ ɫ ɩɨɦɨɳɶɸ ɭɩɪɚɜɥɹɸɳɟɝɨ ɜɨɡɞɟɣɫɬɜɢɹ ɢ=krr-kɭy ɩɪɢ ɭɫɥɨɜɢɢ, ɱɬɨ ɤɨɷɮɮɢɰɢɟɧɬɵ ɭɫɢɥɟɧɢɹ kr ɢ ky ɜɵɛɪɚɧɵ ɫɥɟɞɭɸɳɢɦ ɨɛɪɚɡɨɦ:
kr=bɦ /b; ky=(ɚɦ-a)/b. ɋ ɭɱɟɬɨɦ ɷɬɨɝɨ ɢɦɟɟɦ
dɭ/dt=-ɚɭ+bu=-ɚɭ-bkyɭ+bkrfɡ
Ɍɚɤ ɤɚɤ ɧɟɢɡɜɟɫɬɧɵ ɩɚɪɚɦɟɬɪɵ ɨɛɴɟɤɬɚ ɚ ɢ b, ɬɨ ɞɥɹ ɩɨɥɭɱɟɧɢɹ ɪɟɚɥɢɡɭɟɦɵɯ ɩɪɚɜɢɥ ɧɚɫɬɪɨɣɤɢ ɩɚɪɚɦɟɬɪɨɜ ȺɌɄɂ ɧɟɨɛɯɨɞɢɦɨ, ɧɚɩɪɢɦɟɪ, ɩɚɪɚɦɟɬɪ b ɜɤɥɸɱɢɬɶ ɜ ɤɨɷɮɮɢɰɢɟɧɬ ɭɫɢɥɟɧɢɹ
ɩɪɢ ɚɞɚɩɬɚɰɢɢ k, ɚ ɭɫɢɥɟɧɢɟ, ɫɨɨɬɜɟɬɫɬɜɭɸɳɟɟ ɪɚɜɧɨɜɟɫɢɸ, ɞɨɥɠɧɨ ɭɞɨɜɥɟɬɜɨɪɹɬɶ ɭɫɥɨɜɢɸ:
ɚ+bky=ɚɦ . Ɍɨɝɞɚ ɩɪɚɜɢɥɨ ɧɚɫɬɪɨɣɤɢ ɩɚɪɚɦɟɬɪɨɜ ɩɪɢɦɟɬ ɜɢɞ:
dkr /dt=-k[bɦ fɡ /ɚɬ]ɟ; dkɭ /dt=k[bɦ ɭ /ɚɬ]ɟ.
ɉɪɢɦɟɧɟɧɢɟ ɜ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɵɯ ɭɫɥɨɜɢɹɯ ɚɞɚɩɬɢɜɧɨɝɨ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɤɨɦɩɥɟɤɫɚ ɢɫɩɵɬɚɧɢɹɦɢ Ⱦȼɋ, ɢɦɟɸɳɟɝɨ ɜ ɫɨɫɬɚɜɟ ɤɨɦɩɶɸɬɟɪɧɭɸ ɦɨɞɟɥɶ Ⱦȼɋ, ɩɨɡɜɨɥɹɟɬ
ɩɨɜɵɫɢɬɶ ɬɨɱɧɨɫɬɶ ɢ ɨɩɟɪɚɬɢɜɧɨɫɬɶ ɨɩɪɟɞɟɥɟɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ ɢ ɟɝɨ ɨɬɞɟɥɶɧɵɯ
ɫɢɫɬɟɦ, ɫɧɢɡɢɬɶ ɜɪɟɦɹ ɢ ɬɪɭɞɨɟɦɤɨɫɬɶ ɢɫɩɵɬɚɧɢɣ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ⱥɥɶɬ ȼ.ȼ. ɂɡɦɟɪɢɬɟɥɶɧɚɹ ɷɤɫɩɟɪɬɧɚɹ ɫɢɫɬɟɦɚ ɞɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɞɜɢɝɚɬɟɥɟɣ ɜɧɭɬɪɟɧɧɟɝɨ ɫɝɨɪɚɧɢɹ// ɉɪɢɛɨɪɵ ɢ ɫɢɫɬɟɦɵ ɭɩɪɚɜɥɟɧɢɹ: ʋ 12.- 1998.ɋ. 56-59.
ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ. Ʉɥɚɫɫɢɮɢɤɚɰɢɹ ɫɨɫɬɨɹɧɢɹ ɨɛɴɟɤɬɨɜ ɫɬɚɬɢɫɬɢɱɟɫɤɢɦɢ ɦɟɬɨɞɚɦɢ ɫ
ɩɨɦɨɳɶɸ ɢɡɦɟɪɢɬɟɥɶɧɨɣ ɷɤɫɩɟɪɬɧɨɣ ɫɢɫɬɟɦɵ // Ɇɟɬɨɞɵ ɢ ɬɟɯɧɢɱɟɫɤɢɟ ɫɪɟɞɫɬɜɚ ɢɫɫɥɟɞɨɜɚɧɢɣ ɮɢɡɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ: Cɛ. ɧɚɭɱ. ɬɪ. / ɊȺɋɏɇ. ɋɢɛ. ɨɬɞ-ɧɢɟ. ɋɢɛɎɌɂ – ɇɨɜɨɫɢɛɢɪɫɤ,
2001. – ɋ. 70 – 81.
Ⱥɥɶɬ ȼ.ȼ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ɉɥɶɲɟɜɫɤɢɣ ɋ.ɇ. Ɍɟɯɧɢɱɟɫɤɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ ɦɚɲɢɧ ɢ ɦɟɯɚɧɢɡɦɨɜ ɜ ȺɉɄ//Ɋɨɫɫɟɥɶɯɨɡɚɤɚɞɟɦɢɹ, ɋɢɛɢɪɫɤɨɟ ɪɟɝɢɨɧɚɥɶɧɨɟ
ɨɬɞɟɥɟɧɢɟ, Ƚɇɍ ɋɢɛɎɌɂ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2013. – 523 ɫ.
ɋɚɜɱɟɧɤɨ Ɉ.Ɏ. Ⱥɜɬɨɦɚɬɢɡɚɰɢɹ ɭɩɪɚɜɥɟɧɢɹ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɶɸ ɬɪɚɤɬɨɪɧɵɯ ɞɜɢɝɚɬɟɥɟɣ //Ⱥɜɬɨɦɚɬɢɡɚɰɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ: ɦɚɬ. ɦɟɠɞ. ɧɚɭɱɧ.-ɬɟɯɧ. ɤɨɧɮ.- Ɇ.: ɊȺɋɏɇ, Ƚɇɍ ȼɂɆ,
2004. – ɑ. 1. – ɋ. 296-305.
Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., ɋɚɜɱɟɧɤɨ Ɉ.Ɏ. Ɋɚɫɲɢɪɟɧɢɟ ɜɨɡɦɨɠɧɨɫɬɟɣ ɢɡɦɟɪɢɬɟɥɶɧɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɤɨɦɩɥɟɤɫɚ ɷɤɫɩɟɪɬɢɡɵ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ: Ⱦɜɢɝɚɬɟɥɟɫɬɪɨɟɧɢɟ – ʋ 2, 2004.- ɋ. 25- 27.
ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ɉɥɶɲɟɜɫɤɢɣ ɋ.ɇ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ. ɂɧɮɨɪɦɚɰɢɨɧɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɨɩɪɟɞɟɥɟɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɬɪɚɤɬɨɪɧɵɯ ɞɜɢɝɚɬɟɥɟɣ // Ɇɟɯɚɧɢɡɚɰɢɹ ɢ ɷɥɟɤɬɪɢɮɢɤɚɰɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ. –
2010 . – ʋ 11 . –ɋ. 27–30.
Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., ɋɚɜɱɟɧɤɨ Ɉ. Ɏ., Ⱥɥɶɬ ȼ. ȼ., Ɉɥɶɲɟɜɫɤɢɣ ɋ. ɇ. Ɋɚɡɪɚɛɨɬɤɚ ɤɨɦɩɶɸɬɟɪɧɨɣ ɧɚɫɬɪɚɢɜɚɟɦɨɣ ɦɨɞɟɥɢ ɞɜɢɝɚɬɟɥɹ ɜɧɭɬɪɟɧɧɟɝɨ ɫɝɨɪɚɧɢɹ / ȼɵɱɢɫɥɢɬɟɥɶɧɵɟ ɬɟɯɧɨɥɨɝɢɢ. – 2013.– Ɍ.18, ʋ 6.– ɋ. 54–
61.
ȼɈɉɊɈɋ ɈȻ ɂɋɉɈɅɖɁɈȼȺɇɂɂ ɉɊɈɂɁȼɈȾɋɌȼȿɇɇɈȽɈ
ɈȻɈɊɍȾɈȼȺɇɂə ɁȿɊɇȺ
(ɇȺ ɉɊɂɆȿɊȿ ȾȺɊɏȺɇ-ɍɍɅ ȺɃɆȺɄȺ, ɆɈɇȽɈɅɂə)
ȾɈɊɀȽɈɌɈȼ Ʌ., ȺɁɀȺɊȽȺɅ Ɍ., ȻȺɌȻȺəɊ ɇ.,
Ȼɢɡɧɟɫ-ɲɤɨɥɚ Ⱥɝɪɨɷɤɨɥɨɝɢɢ ɂɧɫɬɢɬɭɬɚ Ɋɚɫɬɟɧɢɣ ɢ ɋɟɥɶɫɤɨɝɨ ɏɨɡɹɣɫɬɜɚ
ɩɪɢ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɨɦ ɍɧɢɜɟɪɫɢɬɟɬɟ ɋɟɥɶɫɤɨɝɨ ɏɨɡɹɣɫɬɜɚ. Ʉɚɮɟɞɪɚ ɢɧɠɟɧɟɪɢɢ,
ɝ. Ⱦɚɪɯɚɧ, Ɇɨɧɝɨɥɢɹ. Gotov108@gmail.comAzjargal.eng@gmail.com
Ʉɪɚɬɤɨɟ ɫɨɞɟɪɠɚɧɢɟ
Ⱦɥɹ ɬɨɝɨ, ɱɬɨɛɵ ɩɨɤɚɡɚɬɶ ɭɪɨɜɟɧɶ ɩɪɢɧɚɞɥɟɠɧɨɫɬɟɣ ɢ ɬɟɯɧɢɱɟɫɤɢɯ ɩɨɬɪɟɛɧɨɫɬɟɣ, ɧɭɠɧɨ ɭɱɢɬɵɜɚɬɶ ɢ ɩɪɢɧɢɦɚɬɶ ɜɨ ɜɧɢɦɚɧɢɟ ɧɵɧɟɲɧɢɟ ɭɫɥɨɜɢɹ ɢ ɜɪɟɦɟɧɚ. ȼ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɭɪɨɜɧɹ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɩɪɟɞɩɪɢɹɬɢɢ ɢ ɝɪɚɠɞɚɧ, ɛɵɥ ɩɪɨɜɟɞɟɧ ɜɵɛɨɪɨɱɧɵɣ ɨɩɪɨɫ ɦɟɫɬɧɵɯ 115 ɩɪɟɞɩɪɢɹɬɢɢ ɫ ɩɥɨɳɚɞɶɸ 50–3500 ɝɚ, ɞɥɹ ɬɨɝɨ, ɱɬɨɛɵ ɩɨɤɚɡɚɬɶ ɜ ɤɚɤɨɦ ɨɛɴɟɦɟ ɢɫɩɨɥɶɡɭɟɬɫɹ ɬɟɯɧɢɤɚ.
ɗɬɨ ɞɚɟɬ ɜɨɡɦɨɠɧɨɫɬɶ ɨɰɟɧɢɬɶ ɧɵɧɟɲɧɟɟ ɫɨɫɬɨɹɧɢɟ ɩɨɥɶɡɨɜɚɧɢɹ ɬɟɯɧɢɤɢ ɜ ɩɪɟɞɩɪɢɹɬɢɯ ɫɟɥɶɫɤɨɝɨ-ɯɨɡɹɣɫɬɜɚ, ɚ ɬɚɤ ɠɟ,ɦɟɧɹɸɲɢɣɫɹ ɪɚɡɦɟɪ ɫɟɥɶɯɨɡɭɝɨɞɢɣ ɢ ɬɟɯɧɢɱɟɫɤɨɝɨ ɩɨɬɟɧɰɢɚɥɚ ɦɨɝɭɬ
ɛɵɬɶ ɢɫɩɨɥɶɡɨɜɚɧɵ ɞɥɹ ɩɥɚɧɢɪɨɜɚɧɢɹ ɬɟɯɧɢɱɟɫɤɨɣ ɪɟɮɨɪɦɵ ɜ ɛɭɞɭɳɟɦ.
Ʉɥɸɱɟɜɨɟ ɫɥɨɜɚ: ɉɪɟɞɩɪɢɹɬɢɟ, ɬɟɯɧɢɱɟɫɤɢɟ ɩɨɬɪɟɛɧɨɫɬɢ, ɨɩɰɢɢ, ɞɨɯɨɞɧɨɫɬɶ, ɷɮɮɟɤɬɢɜɧɨɫɬɶ,
ɧɚɩɪɚɜɥɟɧɢɟ ɫɥɟɞɨɜɚɧɢɹ.
ȼɜɟɞɟɧɢɟ
298
Ɂɟɪɧɨ ɡɚɧɢɦɚɟɬ ɞɨɦɢɧɢɪɭɸɳɟɟ ɩɨɥɨɠɟɧɢɟ ɫɪɟɞɢ ɭɪɨɠɚɟɜ ɫɟɥɶɫɤɨɝɨ-ɯɨɡɹɣɫɬɜɚ ɜ Ⱦɚɪɯɚɧ-ɍɭɥ
ɚɣɦɚɤɟ. ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ, ɩɪɢɨɪɢɬɟɬɧɨɣ ɰɟɥɶɸ ɫɟɥɶɫɤɨ-ɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɹɜɥɹɟɬɫɹ ɭɜɟɥɢɱɟɧɢɟ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ, ɨɫɨɛɟɧɧɨ ɩɲɟɧɢɰɵ ɢ ɭɥɭɱɲɟɧɢɟ ɟɟ ɤɚɱɟɫɬɜɚ. Ɍɚɤ ɠɟ, ɜɨɩɪɨɫɵ ɚɝɪɨɬɟɯɧɢɤɢ ɞɨɥɠɧɵ ɛɵɬɶ ɪɟɲɟɧɵ ɡɚ ɫɱɟɬ ɭɥɭɱɲɟɧɢɣ ɧɚ ɨɫɧɨɜɟ ɪɟɡɭɥɶɬɚɬɨɜ ɧɚɭɱɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ.
Ȼɵɥɢ ɩɪɨɜɟɞɟɧɵ ɢɫɫɥɟɞɨɜɚɧɢɹ, ɱɬɨɛɵ ɜɵɹɜɢɬɶ ɧɚ ɤɚɤɨɦ ɷɬɚɩɟɧɚɯɨɞɢɬɫɹ ɬɟɯɧɢɱɟɫɤɚɹ ɪɟɮɨɪɦɚ
ɤɪɭɩɧɟɣɲɢɯɡɟɪɧɨɜɵɯ ɤɨɦɩɚɧɢɢ Ⱦɚɪɯɚɧ-ɍɭɥ ɚɣɦɚɤɚ, ɚ ɬɚɤ ɠɟ, ɭɡɧɚɬɶ ɤɚɤɢɟ ɩɪɟɞɥɨɠɟɧɢɹ ɫɭɳɟɫɬɜɭɸɬ ɩɨ ɪɟɲɟɧɢɸ ɜ ɞɚɥɶɧɟɣɲɟɦ ɷɬɢɯ ɜɨɩɪɨɫɨɜ.
Ɇɟɬɨɞɵ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɐɟɥɶɸ ɢɫɫɥɟɞɨɜɚɧɢɹ ɹɜɥɹɟɬɫɹ ɨɩɪɟɞɟɥɟɧɢɟ ɭɪɨɜɧɹ ɫɩɪɨɫɚ ɢ ɩɪɟɞɥɨɠɟɧɢɹ ɧɚ ɬɟɯɧɢɤɭ ɜ ɨɛɥɚɫɬɢ
ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ. ɉɪɢ ɪɚɫɱɟɬɟ ɛɵɥɢ ɢɫɩɨɥɶɡɨɜɚɧɵ ɧɨɪɦɵ ɢ ɧɨɪɦɚɬɢɜɵ ɡɟɪɧɨɜɵɯ ɩɪɟɞɩɪɢɹɬɢɢ,
ɚ ɬɚɤɠɟ, ɬɟɯɧɢɱɟɫɤɢɣ ɩɪɨɝɪɟɫɫ, ɨɫɜɟɳɟɧɧɵɣ ɜ ɢɫɩɪɚɜɥɟɧɧɵɯ ɧɨɪɦɚɬɢɜɚɯ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɂɫɫɥɟɞɨɜɚɧɢɟ ɩɥɨɳɚɞɢ ɢ ɭɪɨɠɚɹ ɩɪɟɞɩɪɢɹɬɢɢ:
Ⱦɥɹ ɬɨɝɨ, ɱɬɨɛɵ ɨɫɜɟɬɢɬɶ ɜɨɩɪɨɫɵ, ɫ ɤɨɬɨɪɵɦɢ ɫɬɚɥɤɢɜɚɸɬɫɹ ɩɪɟɞɩɪɢɹɬɢɹ, ɡɚɧɢɦɚɸɳɢɟɫɹ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɦɢ ɩɪɨɢɡɜɨɞɫɬɜɚɦɢ, ɛɵɥ ɩɪɨɜɟɞɟɧ ɫɪɚɜɧɢɬɟɥɶɧɵɣ ɚɧɚɥɢɡ ɢɫɫɥɟɞɭɟɦɵɯ ɩɪɟɞɩɪɢɹɬɢɢ ɩɨ ɦɚɫɲɬɚɛɚɦ ɩɪɨɢɡɜɨɞɫɬɜɚ (ɧɚ 1 ɝɚ) ɢ ɬɟɯɧɢɱɟɫɤɨɣ ɩɨɞɞɟɪɠɤɢ, ɫɝɪɭɩɩɢɪɨɜɚɜ ɢɯ ɩɨ ɨɛɴɟɦɭ ɩɨɫɟɜɧɨɣ ɩɥɨɳɚɞɢ.
ȼ ɬɚɛɥɢɰɟ 1 ɩɪɢɜɟɞɟɧɵ ɫɜɟɞɟɧɢɹ ɨ ɩɨɫɟɜɧɨɣ ɢ ɨɛɨɪɨɬɧɨɣ ɩɥɨɳɚɞɢ
Ɍɚɛɥɢɰɚ 1
ɉɨɫɟɜɧɚɹ ɢ ɨɛɨɪɨɬɧɚɹ ɩɥɨɳɚɞɢ ɩɪɟɞɩɪɢɹɬɢɢ
ɇɚɢɦɟɧɨɜɚɧɢɟ ɩɪɟɞɩɪɢɹɬɢɹ
1
ɐɚɣɞɚɦ ɭɝԧԧɠ “ɈɈɈ”
2
Ⱦɚɪɯɚɧ ɬɨɨɪɨɦɬ “ɈɈɈ”
3
Ɍԛɦɷɧ ɛɭɭɞɚɣ “ɈɈɈ”
4
Ƚɚɡɚɪ ԧɝԧԧɠ “ɈɈɈ”
5
ɀɚɪɝɚɥɚɧɬ ɛԧɯ“ɈɈɈ”
6
Ɍɷɪɦɷɧ “ɈɈɈ”
7
Ȼɟɫɬԧɦԧɪɬ “ɈɈɈ”
8
ɍɪɝɚɰ ɞɚɥɚɣ “ɈɈɈ”
9
ɇɚɪɫ ɷɷɠ “ɈɈɈ”
10
ɐɚɣɞɚɦ ɭɪɝɚɰ “ɈɈɈ”
11
ɒԛԛɞɷɪɬ ɰɚɪɚɦ “ɈɈɈ”
12
Ȼɚɹɪ ԧɝԧԧɠ “ɈɈɈ”
ɂɫɬɨɱɧɢɤ: ɢɫɫɥɟɞɨɜɚɧɢɟ ɚɜɬɨɪɨɜ
Ɉɛɳɚɹ ɨɛɨɪɨɬɧɚɹ ɩɥɨɳɚɞɶ /ɝɚ/
1432
1156
1268,5
3415
498,8
241,5
496,2
170
478
381
599,7
231,7
ɉɨɫɟɜɧɚɹ ɩɥɨɳɚɞɶ
939
645
727,5
2200
326,8
121,5
276,2
100
197
381
329,7
113
ɂɡ ɨɛɳɟɣ ɫɥɨɠɧɨɫɬɢ 115 ɩɪɟɞɩɪɢɹɬɢɣ, ɜɟɞɭɸɳɢɯ ɞɟɹɬɟɥɶɧɨɫɬɶ ɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ, ɩɪɢɦɟɪɧɨ 48 ɩɪɨɰɟɧɬɨɜ ɡɚɧɢɦɚɸɬ ɩɪɟɞɫɬɚɜɢɬɟɥɢ ɦɚɥɨɝɨ ɛɢɡɧɟɫɚ ɢ ɮɢɡɢɱɟɫɤɢɟ ɥɢɰɚ ɫ
50–100 ɝɚ ɩɥɨɳɚɞɶɸ.
Ɏɟɪɦɟɪɫɤɢɟ ɩɪɟɞɩɪɢɹɬɢɹ ɩɨ ɡɚɧɢɦɚɸɳɟɣ ɩɥɨɳɚɞɢ
ɂɫɬɨɱɧɢɤ: Ɉɛɳɟɟ ɩɪɟɞɫɬɚɜɥɟɧɢɟ ɨ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ, 2014.
ɇɚ ɨɫɧɨɜɚɧɢɢ ɞɢɚɝɪɚɦɦɵ 1 ɦɨɠɧɨ ɫɞɟɥɚɬɶ ɜɵɜɨɞ, ɱɬɨ ɛɨɥɶɲɢɧɫɬɜɨ ɮɟɪɦɟɪɨɜ ɢ ɝɪɚɠɞɚɧ ɡɚɢɧɬɟɪɟɫɨɜɚɧɵ ɜ ɪɚɡɜɢɬɢɢ ɫɟɥɶɫɤɨ-ɯɨɡɹɣɫɬɜɨɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ, ɧɨ ɜ ɫɢɥɭ ɢɯ ɪɟɝɢɨɧɚɥɶɧɨɣ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ, ɩɨɱɜɵ, ɬɟɯɧɨɥɨɝɢɣ ɩɪɨɡɜɨɞɫɬɜɚ, ɫɨɨɬɜɟɬɫɬɜɭɸɳɟɣ ɤ ɤɥɢɦɚɬɢɱɟɫɤɢɦ ɭɫɥɨɜɢɹɦ,
ɧɟɯɜɚɬɤɢ ɬɟɯɧɢɤɢ ɢ ɧɢɡɤɨɝɨ ɭɪɨɜɧɹ ɮɢɧɚɧɫɢɪɨɜɚɧɢɹ, ɨɧɨ (ɫɟɥɶɫɤɨ-ɯɨɡɹɣɫɬɜɟɧɧɨɟ ɩɪɨɢɡɜɨɞɫɬɜɨ)
ɧɟ ɪɚɡɜɢɜɚɟɬɫɹ ɞɨɥɠɧɵɦ ɨɛɪɚɡɨɦ.
299
ȼ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ, ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ ɪɟɠɢɦ ɫ ɧɟɤɨɬɨɪɨɣ ɫɬɨɪɨɧɵ ɧɚɪɭɲɚɟɬɫɹ, ɬɟɯɧɢɱɟɫɤɨɟ
ɩɨɥɶɡɨɜɚɧɢɟ ɢ ɪɟɮɨɪɦɚ ɩɪɟɩɹɬɫɬɜɭɸɬ ɪɚɡɜɢɬɢɸ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ.
Ɍɚɛɥɢɰɚ 2
Ʉɥɚɫɫɢɮɢɤɚɰɢɹ ɩɪɟɞɩɪɢɹɬɢɢ, ɭɱɚɫɬɜɭɸɳɢɯ ɜ ɢɫɫɥɟɞɨɜɚɧɢɢ (ɩɨ ɩɥɨɳɚɞɢ)
Ɋɚɡɦɟɪ ɩɥɨɳɚɞɢ /ɜ ɝɟɤɬɚɪɚɯ(ɝɚ)/
100–500 ɝɚ
500–1000 ɝɚ
1000–3000 ɝɚ
3000- ɞɷɷɲ ɝɚ
ɀɚɪɝɚɥɚɧɬ ɛԧɯ “ɈɈɈ”
ɒԛԛɞɷɪɬ ɰɚɪɚɦ “ɈɈɈ”
ɐɚɣɞɚɦ ԧɝԧԧɠ “ɈɈɈ”
Ƚɚɡɚɪ ԧɝԧԧɠ “ɈɈɈ”
Ɍɷɪɦɷɧ “OOO”
Ȼɟɫɬԧɦԧɪɬ “OOO”
ɍɪɝɚɰ ɞɚɥɚɣ “OOO”
ɇɚɪɫ ɷɷɠ “OOO”
ɐɚɣɞɚɦ ɭɪɝɚɰ “OOO”
Ȼɚɹɪ ԧɝԧԧɠ “OOO”
ɂɫɬɨɱɧɢɤ: ɂɫɫɥɟɞɨɜɚɧɢɟɚɜɬɨɪɨɜ
Ⱦɚɪɯɚɧ ɬɨɨɪɨɦɬ “OOO”
Ɍԛɦɷɧ ɛɭɭɞɚɣ “OOO”
Ɉɫɧɨɜɧɨɣ ɰɟɥɶɸ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɜ ɫɨɜɪɟɦɟɧɧɵɯ ɭɫɥɨɜɢɹɯ ɹɜɥɹɟɬɫɹ ɩɨɜɵɲɟɧɢɟ ɭɪɨɠɚɣɧɨɫɬɢ. ɋɭɳɟɫɬɜɭɟɬ ɪɹɞ ɮɚɤɬɨɪɨɜ, ɜɥɢɹɳɢɯ ɧɚ ɭɪɨɠɚɣɧɨɫɬɶ, ɧɨ ɨɫɧɨɜɧɨɣ ɭɩɨɪ ɛɵɥ
ɫɞɟɥɚɧ ɧɚ ɬɨ, ɱɬɨɛɵ ɜɵɹɜɢɬɶ ɤɚɤ ɜɥɢɹɸɬ ɬɟɯɧɨɥɨɝɢɹ ɢ ɬɟɯɧɢɱɟɫɤɢɟ ɨɩɰɢɢ.
ɋɪɟɞɧɟ-ɝɨɞɨɜɨɣ ɭɪɨɠɚɣɢ ɧɚ 1 Ƚɚ ɩɪɟɞɩɪɢɹɬɢɢ, ɭɱɚɜɫɬɭɸɳɢɯ ɜ ɢɫɫɥɟɞɨɜɚɧɢɢ (ɬɚɛɥ. 3).
Ɍɚɛɥɢɰɚ 3
Ɉɛɶɟɦ ɭɪɨɠɚɹ ɩɪɟɞɩɪɢɹɬɢɢ ɫ ɝɚ ɩɥɨɳɚɞɢ
1
2
3
4
5
6
7
ɇɚɢɦɟɧɨɜɚɧɢɟ
ɩɪɟɞɩɪɢɹɬɢɹ
ɐɚɣɞɚɦ ԧɝԧԧɠ “OOO”
Ⱦɚɪɯɚɧ ɬɨɨɪɨɦɬ “OOO”
Ɍԛɦɷɧ ɛɭɭɞɚɣ “OOO”
Ƚɚɡɚɪ ԧɝԧԧɠ “OOO”
ɀɚɪɝɚɥɚɧɬ ɛԧɯ “OOO”
Ɍɷɪɦɷɧ “OOO”
Ȼɟɫɬԧɦԧɪɬ “OOO”
8
ɍɪɝɚɰ ɞɚɥɚɣ “OOO”
2012
2013
2014
8.0
7.0
6.0
0.0
5.0
3.0
3.5
13.0
15.0
18.0
18.0
16.0
15.0
15.0
12.0
13.5
14.0
22.0
13.5
14.0
13.0
ɋɪɟɞɧɢɣ ɭɪɨɠɚɣ
ɧɚ 1 ɝɚ
14.3
15.1
16.0
20
10.1
14.0
13.8
170
4.0
13.0
15.2
14.0
478
381
599,7
231,7
2.0
8.0
0.0
1.0
11.0
20.0
12.0
12.0
10.0
20.0
12.0
10.0
11.0
19.3
11.3
11.0
Ɋɚɡɦɟɪ
ɩɥɨɳɚɞɢ /ɝɚ/
1432
1156
1268,5
3415
498,8
241,5
496,2
9
ɇɚɪɫ ɷɷɠ “OOO”
10
ɐɚɣɞɚɦ ɭɪɝɚɰ “OOO”
11
ɒԛԛɞɷɪɬ ɰɚɪɚɦ “OOO”
12
Ȼɚɹɪ ԧɝԧԧɠ “OOO”
ɂɫɬɨɱɧɢɤ: ɇɨɜɨɫɬɢ ɭɪɨɠɚɹ, 2014.
Ɍɚɛɥɢɰɚ 4
ɋɪɚɜɧɢɬɟɥɶɧɨɟ ɢɫɫɥɟɞɨɜɚɧɢɟ ɩɪɟɞɩɪɢɹɬɢɢ ɩɨ ɩɨɫɟɜɚɦ ɧɚ 1 ɝɚ
ɇɚɢɦɟɧɨɜɚɧɢɟ ɩɪɟɞɩɪɢɹɬɢɹ
1
2
Ɉɬ 1000 ɝɚ ɩɥɨɳɚɞɶɸ
ɋ 100–500 ɝɚ ɩɥɨɳɚɞɶɸ
ɋɪɟɞɧɹɹ ɩɨɫɟɜɧɚɹ ɩɥɨɳɚɞɶ
/ɝɚ/
1817
387
ɋɪɟɞɧɹɹ ɭɪɨɠɚɧɨɫɬɶ ɝɚ /ɰɧ/
16.35
13.06
ɂɫɬɨɱɧɢɤ: ɢɫɫɥɟɞɨɜɚɧɢɟ ɚɜɬɨɪɨɜ
ɉɪɢɜɟɞɟɧɧɚɹ ɜɵɲɟ ɬɚɛɥɢɰɚ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɭ ɦɚɥɵɯ ɩɪɢɞɩɪɢɹɬɢɣ ɫ 100–500 ɝɚ ɩɥɨɳɚɞɶɸ ɭɪɨɠɚɣ ɫ ɝɟɤɬɚɪɚ ɛɵɥ ɫɨɛɪɚɧ ɧɚ 3,3 ɰɟɧɬɧɟɪɚ ɢɥɢ ɧɚ 20,1 % ɦɟɧɶɲɟ. Ɉɬɧɨɫɢɬɟɥɶɧɨ ɧɢɡɤɢɣ ɭɪɨɜɟɧɶ
ɭɪɨɠɚɹ ɧɚ ɝɟɤɬɚɪ ɩɪɢɜɨɞɢɬ ɤ ɩɨɬɟɪɹɦ, ɬɚɤ ɠɟ, ɦɨɠɧɨ ɫɞɟɥɚɬɶ ɜɵɜɨɞ, ɱɬɨ ɫɩɨɫɨɛɫɬɜɨɜɚɥɢ ɷɬɨɦɭɞɟɮɢɰɢɬ ɩɪɨɦɵɲɥɟɧɧɵɯ ɬɟɯɧɨɥɨɝɢɢ ɢ ɬɟɯɧɢɱɟɫɤɢɯ ɩɪɢɧɚɞɥɟɠɧɨɫɬɟɣ.
ɋɨɫɬɨɹɧɢɟ ɞɟɮɢɰɢɬɚ ɬɟɯɧɢɱɟɫɤɢɯ ɩɪɢɧɚɞɥɟɠɧɨɫɬɟɣ: ɇɭɠɧɨ, ɩɪɟɠɞɟ ɜɫɟɝɨ, ɫɞɟɥɚɬɶ ɩɪɢɨɪɢɬɟɬɧɵɦ ɜɨɩɪɨɫ ɨɛ ɨɛɹɡɚɬɟɥɶɧɨɣ ɫɨɨɬɜɟɬɫɬɜɢɢ ɬɟɯɧɢɤɢ ɢ ɬɟɯɧɨɥɨɝɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫ ɪɟɝɢɨɧɚɥɶɧɵɦɢ
ɭɫɥɨɜɢɹɦɢ (ɩɨɱɜɟɧɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɟ ɭɫɥɨɜɢɹ, ɩɪɢɪɨɞɧɵɟ ɭɫɥɨɜɢɹ) ɩɪɟɞɫɬɚɜɢɬɟɥɟɣ ɦɚɥɵɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɩɪɟɞɩɪɢɹɬɢɢ. Ɉɫɧɨɜɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɡɚɤɥɸɱɚɟɬɫɹ ɜ ɬɟɯɧɨɥɨɝɢɢ ɩɨɞɝɨɬɨɜɤɢ ɩɨɱɜɵ ɢ ɩɨɫɟɜ ɩɟɪɟɞ ɩɨɫɚɞɤɨɣ, ɬɟɯɧɨɥɨɝɢɢ ɭɯɨɞɚ, ɬɟɯɧɨɥɨɝɢɢ ɩɨ ɫɛɨɪɭ ɭɪɨɠɚɹ.
ɗɬɨ ɜɫɟ ɞɨɥɠɧɨ ɛɵɬɶ ɫɞɟɥɚɧɨ ɫ ɩɨɦɨɳɶɸ ɫɩɟɰɢɚɥɢɡɢɪɨɜɚɧɧɨɣ ɬɟɯɧɢɤɨɣ.
300
ɂɫɫɥɟɞɨɜɚɧɢɟ ɬɟɯɧɢɤɢ ɩɪɟɞɩɪɢɹɬɢɢ
ȼ ɬɚɛɥɢɰɟ 5 ɩɨɤɚɡɚɧ ɩɪɢɟɦɥɢɦɵɣ ɪɚɡɦɟɪ ɩɥɨɳɚɞɢ ɩɨɥɶɡɨɜɚɧɢɹ, ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɥɨɲɚɞɢɧɵɯ
ɫɢɥ /ɥ.ɫ./ ɬɪɚɤɬɨɪɨɜ ɩɪɟɞɩɪɢɹɬɢɢ, ɭɱɚɜɫɬɜɭɸɳɢɯ ɜ ɢɫɫɥɟɞɨɜɚɧɢɢ.
Ɍɚɛɥɢɰɚ 5
Ʉɨɥɢɱɟɫɬɜɨ ɬɪɚɤɬɨɪɨɜ /ɥ.ɫ./
130–175 ɥ.ɫ.
230–300 ɥ.ɫ.
7 ɲɬ
3 ɲɬ
ɉɪɢɟɦɥɢɦɵɣ ɪɚɡɦɟɪ ɩɥɨɳɚɞɢ ɩɨɥɶɡɨɜɚɧɢɹ /ɝɚ/
400
700
1000
ɂɫɬɨɱɧɢɤ: ɂɫɫɥɟɞɨɜɚɧɢɟ ɚɜɬɨɪɨɜ
80–120 ɥ.ɫ.
9 ɲɬ
ɨɬ 375 ɥ.ɫ.
2 ɲɬ
2000 ɝɚ
ȿɫɥɢ ɜɡɹɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɨɛɨɪɭɞɨɜɚɧɢɹ ɞɥɹ ɩɟɪɟɪɚɛɨɬɤɢ ɩɨɱɜɵ ɢ ɫɟɹɥɤɢ ɡɟɪɧɨɜɵɟ:
Ɍɚɛɥɢɰɚ 6
Ɉɛɨɪɭɞɨɜɚɧɢɹ ɞɥɹ ɩɟɪɟɪɚɛɨɬɤɢ ɩɨɱɜɵ
12 ɲɬ
ɉɪɢɟɦɥɢɦɨɟ ɡɧɚɱɟɧɢɟ ɩɨɥɶɡɨɜɚɧɢɹ
1000ɦ
Ⱦɥɢɧɚ ɩɥɨɳɚɞɢ 600–1000ɦ,
Ʉɭɥɶɬɢɜɚɰɢɹ
ɋɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ
ɬɟɯɧɢɤɚ
ɉɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɫɦɟɧɵ, ɝɚ
Ɍɪɚɤɬɨɪ
ɏɌɁ-150Ʉ-09
175 ɥ.ɫ.
Ȼɟɥɚɪɭɫ 1221
130 ɥ.ɫ.
Ʌɢɞɟɪ -6ɇ
(12–14 ɫɦ)
Ʌɢɞɟɪ -4
(12–14 ɫɦ)
Ɍɨɩɥɢɜɨ ɤɝ/ɝɚ
ɇɟɞɟɥɶɧɚɹ ɧɨɪɦɚ
47.2–49.2
2.9
500 ɝɚ
31.8–33.0
3.22
340 ɝɚ
ɉɪɢɟɦɥɢɦɨɟ ɡɧɚɱɟɧɢɟ ɩɨɥɶɡɨɜɚɧɢɹ
ɉɨɫɟɜ
ɋɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ
ɬɟɯɧɢɤɚ
ɉɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɫɦɟɧɵ, ɝɚ
Ɍɪɚɤɬɨɪ
ɋɟɹɥɤɢ ɡɟɪɧɨɜɵɟ
32 ɲɬ
Ɍɨɩɥɢɜɨ ɤɝ/ɝɚ
ɏɌɁ-150Ʉ-09
3x ɋɄɉ-2.1
43.8–45.8
175 ɥ.ɫ.
Ȼɟɥɚɪɭɫ 1221
2 x ɋɄɉ-2.1
28.4-30.1
130 ɥ.ɫ.
Case 425
Bourgault
85–90
ɂɫɬɨɱɧɢɤ: Ⱦɨɤɬɨɪ ɫɟɥɶɫɤɨɝɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɧɚɭɤ, ɩɪɨɮɟɫɫɨɪ ɑ. Ȼɹɦɛɚɞɨɪɠ.
ɇɟɞɟɥɶɧɚɹ ɧɨɪɦɚ
2.1
480
4.3
300
6.9
1260
ɗɤɫɩɥɭɚɬɚɰɢɹ ɬɟɯɧɢɤɢ ɫɟɥɶɫɤɨɝɨɯɨɡɹɣɫɬɜɚ ɢ ɜɨɩɪɨɫɵ ɧɚɝɪɭɡɤɢ.
ɋɨɝɥɚɫɧɨ ɩɪɟɞɫɬɚɜɥɟɧɧɨɣ ɜɵɲɟ ɬɚɛɥɢɰɟ, ɧɭɠɧɨ ɩɪɚɜɢɥɶɧɨ ɩɪɨɜɨɞɢɬɶ ɫɛɨɪɤɭ ɬɪɚɤɬɨɪɚ ɢ ɦɚɲɢɧ.
ȿɫɥɢ ɩɨɤɚɡɚɬɶ ɜ ɬɚɛɥɢɰɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɡɟɪɧɨɭɛɨɪɨɱɧɵɯ ɤɨɦɛɚɣɧɨɜ ɩɪɟɞɩɪɢɹɬɢɢ, ɭɱɚɜɫɬɜɨɜɚɜɲɢɯ ɜ ɢɫɫɥɟɞɨɜɚɧɢɢ:
Ɍɚɛɥɢɰɚ 7
Ɇɚɪɤɚ ɤɨɦɛɚɣɧɚ
ɋɄ-5 “ɇɢɜɚ ɷɮɮɟɤɬ”
JD1076
ɋɪɟɞɧɹɹ ɫɤɨɪɨɫɬɶ ɪɚɛɨɬɵ, ɤɦ/ɱɚɫ
9.48
9.4
ȼɵɩɨɥɧɟɧɢɟ, ɝɚ/ɰ
2.9
3.3
Ɋɚɫɯɨɞ ɬɨɩɥɢɜɚ ɤɝ/ɝɚ
8.8
8.3
ɂɫɬɨɱɧɢɤ: Ⱦɨɤɬɨɪ ɫɟɥɶɫɤɨɝɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɧɚɭɤ, ɩɪɨɮɟɫɫɨɪ ɑ. Ȼɹɦɛɚɞɨɪɠ. ɗɤɫɩɥɭɚɬɚɰɢɹ ɬɟɯɧɢɤɢ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɢ ɜɨɩɪɨɫɵ ɧɚɝɪɭɡɤɢ.
ȼ ɬɚɛɥɢɰɟ 8 ɩɨɤɚɡɚɧ ɤɨɦɛɢɧɢɪɨɜɚɧɧɵɣ ɚɧɚɥɢɡ ɢɫɩɨɥɶɡɨɜɚɧɢɹ (ɧɚ ɨɫɧɨɜɚɧɢɢ ɬɚɛɥɢɰɵ 7).
Ɍɚɛɥɢɰɚ 8
ɇɚɢɦɟɧɨɜɚɧɢɟ ɦɚɲɢɧɵ
Ɍɪɚɤɬɨɪ
50
Ȼɟɥɚɪɭɫ
20ɍɄ
Ʉɭɥɶɬɢɜɚɬɨɪ
ɉɗ-3.8
ɋɟɹɥɤɚ
Ʉɉ-2.1
Ԛɪ ɬɚɪɢɚ ɯɭɪɚɚɯ ɤɨɦɛɚɣɧ
-
Ɋɚɡɦɟɪ ɩɥɨɳɚɞɢ ɩɨɫɟɜɚ, ɝɚ
700
1000
ɏɌɁ-150Ʉ-09
Ȼɟɥɚɪɭɫ 1221
ɏɌɁ-150Ʉ-09
Ȼɟɥɚɪɭɫ 1221
Ʌɢɞɟɪ-6
Ʌɢɞɟɪ-4
Ʌɢɞɟɪ-6
Ʌɢɞɟɪ-4
3 x ɋɄɉ-2.1
3 x ɋɄɉ-2.1
6 x ɋɄɉ-2.1
ɋɄ-5
2 x ɋɄ-5
2 x ɋɄ-5
“ɇɢɜɚ ɷɮɮɟɤɬ”
“ɇɢɜɚ ɷɮɮɟɤɬ”
“ɇɢɜɚ ɷɮɮɟɤɬ”
400
2000
Case 425
Morris
Morris
4 x JD1076
ɂɫɬɨɱɧɢɤ: Ⱦɨɤɬɨɪ ɫɟɥɶɫɤɨɝɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɧɚɭɤ, ɩɪɨɮɟɫɫɨɪ ɑ. Ȼɹɦɛɚɞɨɪɠ. ɗɤɫɩɥɭɚɬɚɰɢɹ ɬɟɯɧɢɤɢ ɫɟɥɶɫɤɨɝɨɯɨɡɹɣɫɬɜɚ ɢ ɜɨɩɪɨɫɵ ɧɚɝɪɭɡɤɢ.
301
ȼɕȼɈȾɕ:
1. Ɍɟɯɧɢɱɟɫɤɭɸ ɪɟɮɨɪɦɭ ɫɥɟɞɭɟɬ ɜɵɛɢɪɚɬɶ, ɢɫɯɨɞɹ ɢɡ ɦɧɨɝɢɯ ɮɚɤɬɨɪɨɜ, ɬɚɤɢɯ ɤɚɤ – ɩɨɱɜɚ, ɤɥɢɦɚɬɢɱɟɫɤɢɟ ɭɫɥɨɜɢɹ, ɠɢɜɨɬɧɨɜɨɞɫɬɜɨ ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɨ.
2. Ɍɟɯɧɢɤɚ, ɤɨɬɨɪɚɹ ɢɫɩɨɥɶɡɭɟɬɫɹ ɩɨ Ʉɚɧɚɞɫɤɨɣ ɬɟɯɧɨɥɨɝɢɢ ɢɦɟɟɬ ɜɵɫɨɤɭɸ ɷɮɮɟɤɬɢɜɧɨɫɬɶ, ɩɨɷɬɨɦɭ ɜɵɩɨɥɧɟɧɢɟ ɪɚɛɨɬ ɜ ɚɝɪɨɬɟɯɧɢɱɟɫɤɨɦ ɜɪɟɦɟɧɢ ɜ 2.5–2.7 ɪɚɡ ɛɨɥɶɲɟ, ɱɟɦ ɬɟɯɧɢɤɢ ɪɨɫɫɢɣɫɤɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ.
3. ȿɫɥɢ ɨɞɢɧ (1 ɲɬ) ɬɪɚɤɬɨɪ ɦɚɪɤɢ Case ɥɢɛɨ John Deere ɫ ɦɨɳɧɨɫɬɶɸ ɨɬ 375 ɥ.ɫ. ɫɦɨɠɟɬ ɜɵɩɨɥɧɹɬɶ ɪɚɛɨɬɭ ɜ 2000 ɝɚ ɩɥɨɳɚɞɢ ɩɨɫɟɜɚ ɢ ɤɭɥɶɬɢɜɚɰɢɢ, ɬɨ ɜ ɬɚɤɨɣ ɠɟ ɩɨ ɪɚɡɦɟɪɭ ɩɥɨɳɚɞɢ ɦɨɝɭɬ
ɜɵɩɨɥɧɢɬɶ ɪɚɛɨɬɭ ɬɪɢ (3 ɲɬ) ɬɪɚɤɬɨɪɚ ɫ ɦɨɳɧɨɫɬɶɸ 175 ɥ.ɫ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ:
1.
2.
3.
4.
5.
ɀ. ɌΟɦɷɧ “Ԛɪ ɬɚɪɢɚɧɵ ɭɪɝɚɦɚɥ ɬɚɪɢɚɥɚɯ ɰɨɦɯɨɬɝɨɫɨɧ ɬɟɯɧɢɤ ɬɟɯɧɨɥɨɝɢɣɧ ԛɧɞɷɫɥɷɥ” /ɫɨɜɟɬɵ/
ɍȻ.2005
ɑ. Ȼɹɦɛɚɞɨɪɠ ” Ƚɚɡɚɪ ɬɚɪɢɚɥɚɧɞ ɧɷɜɬɷɪɫɷɧ ɬɟɯɧɢɤɢɣɧ ɚɲɢɝɥɚɥɬ, ɚɱɚɚɥɚɥɵɧ ɛɚɣɞɚɥ” (ɗɤɫɩɥɭɚɬɚɰɢɹ
ɬɟɯɧɢɤɢ ɫɟɥɶɫɤɨɝɨɯɨɡɹɣɫɬɜɚ ɢ ɜɨɩɪɨɫɵ ɧɚɝɪɭɡɤɢ) ɍȻ. 2013
Ȼ. ɆΫɧɯɛɚɬ “ɂɧɠɟɧɟɪ ɬɟɯɧɨɥɨɝɢ” ɫɷɬɝԛԛɥ (ɠɭɪɧɚɥ), ɍȻ.2015
ɑ. Ȼɹɦɛɚɞɨɪɠ “Ƚɚɡɚɪ ɬɚɪɢɚɥɚɧɝɢɣɧ ɦɟɯɚɧɢɤɠɭɭɥɚɥɬ” (Ɇɟɯɚɧɢɡɚɰɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ), ɍȻ. 1999
ɊȺɋɏɊɎ, ɆɉɌɊɎ. “Ɇɟɬɨɞɢɤɚ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɭɫɥɨɜɧɵɯ ɤɨɷɮɮɢɰɢɟɧɬɨɜ ɩɟɪɟɜɨɞɚ ɬɪɚɤɬɨɪɨɜ, ɡɟɪɧɨɭɛɨɪɨɱɧɵɯ ɢ ɤɨɪɦɨɭɛɨɪɨɱɧɵɯ ɤɨɦɛɚɣɧɨɜ ɜ ɷɬɚɥɨɧɧɵɟ ɟɞɢɧɢɰɵ ɩɪɢ S ɨɩɪɟɞɟɥɟɧɢɢ ɧɨɪɦɚɬɢɜɨɜ ɢɯ ɩɨɬɪɟɛɧɨɫɬɢ” Ɇ.:2009
ɍȾɄ 631. 316. 02
ɄɈɅɖɐȿȼɕȿ ɊȺȻɈɑɂȿ ɈɊȽȺɇɕ ɂ ɂɏ ɉɊɂɆȿɇȿɇɂȿ
ȼ ɋȿɅɖɋɄɈɏɈɁəɃɋɌȼȿɇɇɈɆ ɆȺɒɂɇɈɋɌɊɈȿɇɂɂ
ɄɈɅɂɇɄɈ ɉ.ȼ.,
ɈȺɈ «ɋɢɛɢɪɫɤɢɣ Ⱥɝɪɨɩɪɨɦɵɲɥɟɧɧɵɣ Ⱦɨɦ»,
əɄɈȼɅȿȼ ɇ.ɋ.,
ɎȽȻɇɍ «ɋɢɛɢɪɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɦɟɯɚɧɢɡɚɰɢɢ
ɢ ɷɥɟɤɬɪɢɮɢɤɚɰɢɢ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ», 630501, ɇɨɜɨɫɢɛɢɪɫɤɚɹ ɨɛɥɚɫɬɶ,
ɩ. Ʉɪɚɫɧɨɨɛɫɤ, e-mail: yakovlev-46@inbox.ru
Ɉɱɢɫɬɤɚ ɩɨɥɟɣ ɨɬ ɫɨɪɧɹɤɨɜ ɢ ɜɵɪɚɜɧɢɜɚɧɢɟ ɢɯ ɩɨɜɟɪɯɧɨɫɬɢ, ɩɨɫɥɟ ɩɨɫɟɜɚ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ,
ɹɜɥɹɸɬɫɹ ɨɞɧɨɣ ɢɡ ɜɚɠɧɵɯ ɡɚɞɚɱ ɩɨɱɜɨɨɛɪɚɛɚɬɵɜɚɸɳɢɯ ɢ ɩɨɫɟɜɧɵɯ ɚɝɪɟɝɚɬɨɜ. Ⱦɥɹ ɷɬɨɣ ɰɟɥɢ
ɩɪɢɦɟɧɹɸɬɫɹ ɪɚɡɥɢɱɧɨɝɨ ɜɢɞɚ ɛɨɪɨɧɵ, ɤɚɬɤɢ, ɫɩɟɰɢɚɥɶɧɵɟ ɜɵɪɚɜɧɢɜɚɬɟɥɢ ɢ ɞɪɭɝɢɟ ɩɪɢɫɩɨɫɨɛɥɟɧɢɹ. ɇɚɢɛɨɥɶɲɟɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɟ ɩɨɥɭɱɢɥɢ ɤɚɬɤɢ, ɤɨɬɨɪɵɟ ɦɨɝɭɬ ɜɵɱɺɫɵɜɚɬɶ ɫɨɪɧɹɤɢ, ɡɚɫɵɩɚɬɶ
ɛɨɪɨɡɞɵ ɢ ɭɛɢɪɚɬɶ ɝɪɟɛɧɢ, ɨɫɬɚɜɥɟɧɧɵɟ ɚɝɪɟɝɚɬɚɦɢ ɩɨɫɥɟ ɩɪɨɯɨɞɚ ɢɯ ɪɚɛɨɱɢɯ ɨɪɝɚɧɨɜ. ȼ ɷɬɨɦ
ɩɥɚɧɟ ɧɚɢɛɨɥɶɲɢɣ ɢɧɬɟɪɟɫ ɢɫɫɥɟɞɨɜɚɬɟɥɢ ɩɪɨɹɜɥɹɸɬ ɤ ɤɨɥɶɱɚɬɵɦ ɤɚɬɤɚɦ, ɤɚɤ ɤ ɧɚɢɛɨɥɟɟ ɭɧɢɜɟɪɫɚɥɶɧɵɦ ɪɚɛɨɱɢɦ ɨɪɝɚɧɚɦ, ɤɨɬɨɪɵɟ ɩɪɢɦɟɧɹɸɬɫɹ ɧɚ ɩɨɱɜɨɨɛɪɚɛɚɬɵɜɚɸɳɢɯ ɚɝɪɟɝɚɬɚɯ Ʌɢɞɟɪ ɢ
ɩɨɫɟɜɧɵɯ ɦɚɲɢɧɚɯ Ɉɛɶ (ɪɢɫ.1).
Ɋɢɫ. 1. ɉɨɱɜɨɨɛɪɚɛɚɬɵɜɚɸɳɢɣ ɚɝɪɟɝɚɬ «Ʌɢɞɟɪ-7.2» ɢ ɩɨɫɟɜɧɚɹ ɦɚɲɢɧɚ «Ɉɛɶ-4-ɁɌ»
302
Ʉɨɥɶɱɚɬɵɣ ɤɚɬɨɤ ɫɨɫɬɨɢɬ ɢɡ ɨɬɞɟɥɶɧɵɯ ɤɨɥɟɰ, ɜɵɩɨɥɧɟɧɧɵɯ ɜ ɮɨɪɦɟ ɭɫɟɱɟɧɧɨɝɨ ɤɨɧɭɫɚ, ɤɨɬɨɪɵɟ ɫ ɨɩɪɟɞɟɥɺɧɧɵɦ ɲɚɝɨɦ ɫɨɛɪɚɧɵ ɜ
ɛɚɬɚɪɟɢ ɭɫɬɚɧɨɜɥɟɧɧɵɟ ɧɚ ɚɝɪɟɝɚɬɟ ɩɨɞ ɭɝɥɨɦ
ɚɬɚɤɢ. ɉɪɢ ɞɜɢɠɟɧɢɢ ɚɝɪɟɝɚɬɚ ɤɨɥɶɰɨ ɡɚɯɜɚɬɵɜɚɟɬ ɜɧɭɬɪɟɧɧɟɣ ɩɨɜɟɪɯɧɨɫɬɶɸ ɱɚɫɬɶ ɩɨɱɜɵ ɢ ɩɟɪɟɦɟɳɚɟɬ ɟɺ ɜ ɫɬɨɪɨɧɭ, ɩɪɢ ɷɬɨɦ ɫɪɟɡɚɟɬ ɝɪɟɛɟɧɶ, ɜɵɞɟɪɝɢɜɚɟɬ ɫɨɪɧɹɤɢ ɢ ɡɚɫɵɩɚɟɬ
ɛɨɪɨɡɞɭ (ɪɢɫ. 2). ɉɨɷɬɨɦɭ ɧɟɨɛɯɨɞɢɦɨ, ɱɬɨɛɵ
ɤɨɥɶɰɚ ɤɚɬɤɚ ɧɟ ɨɫɬɚɜɥɹɥɢ ɧɚ ɩɨɥɟ ɧɟɨɛɪɚɛɨɬɚɧɧɵɯ ɦɟɫɬ [1, 2].
ɏɚɪɚɤɬɟɪ ɞɟɣɫɬɜɢɹ ɤɨɥɶɰɚ ɤɚɬɤɚ ɧɚ ɩɨɱɜɭ
Ɋɢɫ. 2. ɉɟɪɟɦɟɳɟɧɢɟ ɩɨɱɜɵ ɤɨɥɶɰɚɦɢ ɤɚɬɤɚ
ɭ ɤɨɥɶɰɟɜɨɣ ɛɨɪɨɧɵ, ɩɟɪɟɞɧɢɣ ɤɚɬɨɤ ɭɫɬɚɧɨɜɥɟɧ
ɡɚɜɢɫɢɬ ɨɬ ɟɝɨ ɝɟɨɦɟɬɪɢɱɟɫɤɢɯ ɪɚɡɦɟɪɨɜ, ɭɝɥɚ
ɫ ɭɝɥɨɦ ɚɬɚɤɢ ɜɥɟɜɨ, ɡɚɞɧɢɣ ɜɩɪɚɜɨ
ɚɬɚɤɢ ɢ ɫɤɨɪɨɫɬɢ ɞɜɢɠɟɧɢɹ ɦɚɲɢɧɵ. ɉɪɢ
ɞɜɢɠɟɧɢɢ ɤɚɠɞɨɟ ɤɨɥɶɰɨ ɜɵɪɟɡɚɟɬ ɩɥɚɫɬ, ɨɫɬɚɜɥɹɹ ɠɟɥɨɛɱɚɬɵɦ ɞɧɨ ɛɨɪɨɡɞɵ. ȼɵɫɨɬɚ ɝɪɟɛɧɟɣ ɦɟɠɞɭ ɠɟɥɨɛɤɚɦɢ, ɤɨɬɨɪɵɟ ɨɛɪɚɡɭɸɬɫɹ ɩɨ ɞɧɭ
ɛɨɪɨɡɞɵ, ɡɚɜɢɫɢɬ ɨɬ ɞɢɚɦɟɬɪɚ ɤɨɥɶɰɚ ɤɚɬɤɚ D, ɪɚɫɫɬɨɹɧɢɹ ɦɟɠɞɭ ɤɨɥɶɰɚɦɢ b1 ɢ ɭɝɥɚ ɚɬɚɤɢ Ȗ,
h
D 1
D 2 b12 ˜ ctg 2g ,
2 2
ɝɞɟ h – ɜɵɫɨɬɚ ɝɪɟɛɧɟɣ, ɦ; Ȗ – ɭɝɨɥ ɚɬɚɤɢ ɤɚɬɤɚ, ɝɪɚɞ; b1 – ɪɚɫɫɬɨɹɧɢɟ ɦɟɠɞɭ ɤɨɥɶɰɚɦɢ ɤɚɬɤɚ, ɦ;
D – ɞɢɚɦɟɬɪ ɤɚɬɤɚ, ɦ.
Ɋɚɫɫɬɨɹɧɢɟ ɦɟɠɞɭ ɝɪɟɛɧɹɦɢ ɹɜɥɹɟɬɫɹ ɩɪɨɟɤɰɢɟɣ ɯɨɪɞɵ ɨɤɪɭɠɧɨɫɬɢ ɤɨɥɶɰɚ ɤɚɬɤɚ ɧɚ ɩɥɨɫɤɨɫɬɶ
ɩɟɪɩɟɧɞɢɤɭɥɹɪɧɭɸ ɯɨɞɭ ɦɚɲɢɧɵ ɢ ɨɩɪɟɞɟɥɹɟɬɫɹ ɢɡ ɝɟɨɦɟɬɪɢɱɟɫɤɨɝɨ ɫɨɨɬɧɨɲɟɧɢɹ:
ɫ
2sin g ˜ h ˜ ( D h) ,
ɝɞɟ ɫ – ɪɚɫɫɬɨɹɧɢɟ ɦɟɠɞɭ ɝɪɟɛɧɹɦɢ, ɦ.
ɋɥɟɞɨɜɚɬɟɥɶɧɨ, ɤɨɥɶɰɚ ɤɚɬɤɚ ɞɨɥɠɧɵ ɪɚɫɩɨɥɚɝɚɬɶɫɹ ɬɚɤ, ɱɬɨɛɵ ɧɟ ɩɪɨɩɭɫɤɚɬɶ ɫɨɪɧɹɤɢ ɢ ɧɟ ɨɫɬɚɜɥɹɬɶ ɜɵɫɨɤɢɯ ɝɪɟɛɧɟɣ. Ⱦɥɹ ɷɬɨɣ ɰɟɥɢ ɤɚɬɤɢ ɪɚɫɩɨɥɚɝɚɸɬɫɹ ɜ ɞɜɚ ɪɹɞɚ. ɉɪɢ ɞɜɢɠɟɧɢɢ ɚɝɪɟɝɚɬɚ
ɤɨɥɶɰɚ ɤɚɬɤɚ ɡɚɞɧɟɝɨ ɪɹɞɚ ɞɨɥɠɧɵ ɩɟɪɟɤɪɵɜɚɬɶ ɫɥɟɞ ɤɨɥɟɰ ɩɟɪɟɞɧɟɝɨ ɪɹɞɚ, ɫɪɟɡɚɬɶ ɝɪɟɛɧɢ ɢ ɜɵɞɺɪɝɢɜɚɬɶ ɫɨɪɧɹɤɢ.
Ʉɨɥɶɰɟɜɵɟ ɤɚɬɤɢ ɡɚ ɨɞɢɧ ɩɪɨɯɨɞ ɦɨɝɭɬ ɭɛɢɪɚɬɶ ɞɨ 95 % ɫɨɪɧɹɤɨɜ, ɜɵɱɟɫɵɜɚɬɶ ɞɚɠɟ ɨɫɨɬ ɢ ɩɵɪɟɣ ɢ ɩɪɢ ɷɬɨɦ ɜɵɪɚɜɧɢɜɚɬɶ ɩɨɜɟɪɯɧɨɫɬɶ ɩɨɥɹ.
ɇɚ ɨɫɧɨɜɟ ɪɟɡɭɥɶɬɚɬɨɜ ɢɫɫɥɟɞɨɜɚɧɢɹ ɈȺɈ «ɋɢɛɢɪɫɤɢɣ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɵɣ ɞɨɦ» ɪɚɡɪɚɛɨɬɚɧɵ
ɤɨɥɶɰɟɜɵɟ ɛɨɪɨɧɵ «Ʌɢɞɟɪ-ȻɄɆ-3,6» ɢ «Ʌɢɞɟɪ-ȻɄɋ-8», ɤɨɬɨɪɵɟ ɢɦɟɸɬ ɪɚɛɨɱɢɟ ɨɪɝɚɧɵ ɜ ɜɢɞɟ
ɤɨɥɶɰɚ ɜ ɮɨɪɦɟ ɭɫɟɱɟɧɧɨɝɨ ɤɨɧɭɫɚ ɞɢɚɦɟɬɪɨɦ 0,7 ɦ, ɫ ɲɚɝɨɦ ɭɫɬɚɧɨɜɤɢ 0,19 ɦ ɢ ɭɝɥɨɦ ɚɬɚɤɢ 250.
Ʉɨɥɶɰɟɜɵɟ ɛɨɪɨɧɵ «Ʌɢɞɟɪ-ȻɄɆ-3,6» ɢ «Ʌɢɞɟɪ-ȻɄɋ-8» ɹɜɥɹɸɬɫɹ ɧɨɜɨɣ ɪɚɡɪɚɛɨɬɤɨɣ ɈȺɈ
«ɋȺȾ», ɭ ɤɨɬɨɪɵɯ ɪɚɛɨɱɢɟ ɨɪɝɚɧɵ ɜɵɩɨɥɧɟɧɵ ɜ ɜɢɞɟ ɤɨɥɶɰɚ, ɢɦɟɸɳɟɝɨ ɮɨɪɦɭ ɭɫɟɱɟɧɧɨɝɨ ɤɨɧɭɫɚ
[1]. Ȼɨɪɨɧɚ «Ʌɢɞɟɪ-ȻɄɆ-3,6» ɹɜɥɹɟɬɫɹ ɦɨɞɭɥɟɦ ɞɥɹ ɫɨɫɬɚɜɥɟɧɢɹ ɚɝɪɟɝɚɬɨɜ ɫ ɪɚɛɨɱɟɣ ɲɢɪɢɧɨɣ 7,2;
10,8; 14,4 ɢ 16,0 ɦɟɬɪɨɜ, ɛɨɪɨɧɚ «Ʌɢɞɟɪ-ȻɄɋ-8» ɫɤɥɚɞɵɜɚɸɳɚɹɫɹ ɞɥɹ ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɢ (ɪɢɫ.3).
Ɋɢɫ. 3. Ȼɨɪɨɧɚ ɤɨɥɶɰɟɜɚɹ ɫɟɤɰɢɨɧɧɚɹ «Ʌɢɞɟɪ-ȻɄɋ-8»
303
Ɉɫɨɛɟɧɧɨɫɬɢ ɤɨɧɫɬɪɭɤɰɢɢ ɛɨɪɨɧ ɡɚɤɥɸɱɚɟɬɫɹ ɜ ɬɨɦ, ɱɬɨ ɤɨɧɢɱɟɫɤɢɟ ɤɨɥɶɰɚ ɭɫɬɚɧɨɜɥɟɧɵ ɫ ɭɝɥɨɦ ɚɬɚɤɢ 250, ɩɪɢ ɞɜɢɠɟɧɢɢ ɚɝɪɟɝɚɬɚ ɨɧɢ ɜɪɚɳɚɸɬɫɹ ɢ ɫɤɨɥɶɡɹɬ ɩɨ ɩɨɥɸ ɜ ɧɚɩɪɚɜɥɟɧɢɢ ɯɨɞɚ
ɚɝɪɟɝɚɬɚ, ɩɪɢ ɷɬɨɦ ɫɨɪɧɹɤɢ ɡɚɳɟɦɥɹɸɬɫɹ ɦɟɠɞɭ ɤɨɥɶɰɨɦ ɢ ɩɨɱɜɨɣ ɧɟ ɫɪɟɡɚɸɬɫɹ, ɚ ɜɵɞɺɪɝɢɜɚɸɬɫɹ
ɢɡ ɩɨɱɜɵ ɫ ɤɨɪɧɹɦɢ.
ɍɧɢɤɚɥɶɧɨɫɬɶ ɤɨɧɫɬɪɭɤɰɢɢ ɪɚɛɨɱɢɯ ɨɪɝɚɧɨɜ ɩɨɡɜɨɥɹɟɬ ɞɨɫɬɢɱɶ ɯɨɪɨɲɟɣ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɩɪɢ ɜɵɫɨɤɨɦ ɤɚɱɟɫɬɜɟ ɜɵɩɨɥɧɹɟɦɨɣ ɪɚɛɨɬɵ ɢ ɧɢɡɤɨɦ ɪɚɫɯɨɞɟ ɬɨɩɥɢɜɚ (ɬɚɛɥ.1). ɉɪɟɞɥɚɝɚɟɦɵɟ
ɦɚɲɢɧɵ ɢ ɚɝɪɟɝɚɬɵ ɫɨɜɦɟɳɚɸɬ ɧɟɫɤɨɥɶɤɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɨɩɟɪɚɰɢɣ ɢ ɩɨɡɜɨɥɹɸɬ ɯɨɡɹɣɫɬɜɚɦ ɩɟɪɟɣɬɢ ɧɚ ɧɨɜɵɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ ɭɪɨɜɟɧɶ ɪɟɫɭɪɫɨɫɛɟɪɟɝɚɸɳɢɯ ɬɟɯɧɨɥɨɝɢɣ, ɫɭɳɟɫɬɜɟɧɧɨ ɩɨɜɵɲɚɸɳɢɣ ɪɟɧɬɚɛɟɥɶɧɨɫɬɶ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ.
Ɍɚɛɥɢɰɚ 1
Ⱥɝɪɨɬɟɯɧɢɱɟɫɤɢɟ ɢ ɷɧɟɪɝɟɬɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ «Ʌɢɞɟɪ-ȻɄɆ-3,6» ɢ «Ʌɢɞɟɪ-ȻɄɋ-8»
ɩɨ ɞɚɧɧɵɦ ɎȽȻɍ «ɉɨɜɨɥɠɫɤɚɹ ɢ Ⱥɥɬɚɣɫɤɚɹ Ɇɂɋ»
Ɂɧɚɱɟɧɢɟ ɩɨɤɚɡɚɬɟɥɹ
ɉɨɤɚɡɚɬɟɥɶ
Ʌɢɞɟɪ ȻɄɆ-3,6
Ɏɨɧ
Ʌɢɞɟɪ ȻɄɋ-8
Ɇɚɪɤɚ ɬɪɚɤɬɨɪɚ
ɩɚɪ
ɉɨɜɨɥɠɫ
ɤɚɹ Ɇɂɋ
ɆɌɁ-82
ɫɬɟɪɧɹ
ɉɨɜɨɥɠɫɤɢɣ
ɇɂɂɋɋ
ɆɌɁ-82
Ɋɚɛɨɱɚɹ ɫɤɨɪɨɫɬɶ, ɤɦ/ɱ
10,0
ɒɢɪɢɧɚ ɡɚɯɜɚɬɚ, ɦ
3,6
Ƚɥɭɛɢɧɚ ɨɛɪɚɛɨɬɤɢ, ɫɦ
8,4
Ɇɟɫɬɨ ɢɫɩɵɬɚɧɢɹ
ɩɚɪ
Ⱥɥɬɚɣɫɤɚɹ
Ɇɂɋ
Ɍ-150Ʉ
ɫɬɟɪɧɹ
ɈɈɈ
«Ʉɨɥɨɫ»
Ʉ-701Ɍ
12,0
9,7
11,9
3,6
7,7
7,6
6,3
7,9
6,5
ɋɬɚɧɞɚɪɬɧɨɟ ɨɬɤɥɨɧɟɧɢɟ, ɫɦ
1,1
1,2
0,76
1,44
Ƚɪɟɛɧɢɫɬɨɫɬɶ ɩɨɥɹ, ɫɦ
1,8
1,2
1,6
1,9
ȼɵɱɺɫɵɜɚɧɢɟ ɫɨɪɧɹɤɨɜ, %
95,4
-
93,3
-
ɋɨɯɪɚɧɟɧɢɟ ɫɬɟɪɧɢ, %
-
39,7
-
44,7
Ɍɹɝɨɜɨɟ ɫɨɩɪɨɬɢɜɥɟɧɢɟ ɦɚɲɢɧɵ, ɤɇ
12,0
13,8
22,24
26,25
ɍɞɟɥɶɧɨɟ ɬɹɝɨɜɨɟ ɫɨɩɪɨɬɢɜɥɟɧɢɟ ɦɚɲɢɧɵ, ɤɇ/ɦ
3,3
3,8
2,89
3,45
ɍɞɟɥɶɧɵɣ ɪɚɫɯɨɞ ɬɨɩɥɢɜɚ ɡɚ ɜɪɟɦɹ ɪɚɛɨɬɵ, ɤɝ/ɝɚ
3,58
2,95
3,14
3,21
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
əɤɨɜɥɟɜ, ɇ.ɋ. ɉɟɪɟɦɟɳɟɧɢɟ ɩɨɱɜɵ ɤɨɥɶɰɨɦ ɤɨɥɶɱɚɬɨɝɨ ɤɚɬɤɚ / ɇ.ɋ. əɤɨɜɥɟɜ, ɉ.ȼ. Ʉɨɥɢɧɤɨ // ɋɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɟ ɦɚɲɢɧɵ ɢ ɬɟɯɧɨɥɨɝɢɢ. – 2013.- ʋ 3.- ɋ.32– 35.
əɤɨɜɥɟɜ, ɇ.ɋ. ȼɡɚɢɦɨɞɟɣɫɬɜɢɟ ɤɨɥɶɰɟɜɨɝɨ ɤɚɬɤɚ ɫ ɩɨɱɜɨɣ / ɇ.ɋ. əɤɨɜɥɟɜ, ɉ.ȼ. Ʉɨɥɢɧɤɨ // ɋɢɛ. ɜɟɫɬɧ.
ɫ.-ɯ. ɧɚɭɤɢ.- 2012.- ʋ 5 – 6. – ɋ. 95 – 100.
ȺɇȺɅɂɁ ɎȺɄɌɈɊɈȼ, ȼɅɂəɘɓɂɏ
ɇȺ ɉɈɄȺɁȺɌȿɅɂ ɂɋɉɈɅɖɁɈȼȺɇɂə
ɆȺɒɂɇɇɈ-ɌɊȺɄɌɈɊɇɈȽɈ ȺȽɊȿȽȺɌȺ (ɆɌȺ)
ɅɏȺȽȼȺɋɍɊȿɇ ɋ., ȻəɆȻȺȾɈɊɀ ɑ.,
Ɇɨɧɝɨɥɶɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɚɝɪɚɪɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ, Ɇɨɧɝɨɥɢɹ,
khagvana_9966@yahoo.com
Ⱥɧɧɨɬɚɰɢɹ. ɇɚɦɢ ɛɵɥɢ ɩɪɨɜɟɞɟɧɵ ɯɪɨɧɨɦɟɬɪɚɠɧɵɟ ɧɚɛɥɸɞɟɧɢɹ ɧɚ ɬɚɤɢɯ ɩɨɫɟɜɧɵɯ ɚɝɪɟɝɚɬɚɯ,
ɤɚɤ CASE IH 535HD+BOURGAOLT3310+TANK6350, JD9420+MORRIS 7240 ɢ ɧɚ ɭɛɨɪɨɱɧɵɯ ɤɨɦɛɚɣɧɚɯ JD 1076, Ⱦɨɦɢɧɚɬɨɪ 150, Ⱦɨɦɢɧɚɬɨɪ 130.Ɋɚɫɫɦɚɬɪɢɜɚɟɦɵɟ ɫɥɭɱɚɣɧɵɟ ɹɜɥɟɧɢɹ ɨɬɧɨɫɹɬɫɹ
ɤ Ɇɚɪɤɨɜɫɤɢɦ ɩɪɨɰɟɫɫɚɦ ɢ ɞɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɡɚɤɨɧɨɜ ɢɯ ɪɚɫɩɪɟɞɟɥɟɧɢɹ ɛɵɥɢ ɩɪɢɦɟɧɟɧɵ ɡɚɤɨɧɵ
ɉɭɚɫɫɨɧɚ, ɷɤɫɩɨɧɟɧɬɚ, ɧɨɪɦɚɥɶɧɨɝɨ ɢ ɥɨɝɧɨɪɦɚɥɶɧɨɝɨ ɪɚɫɩɪɟɞɟɥɟɧɢɹ. ɉɨɜɬɚɪɧɨɫɬɶ ɨɩɵɬɨɜ ɫɨɫɬɚɜɥɹɥɢ ɜ ɩɪɟɞɟɥɚɯ ɨɬ 82 ɞɨ 217.[3,ɫ.40–51].
Ʉɥɸɱɟɜɵɟ ɫɥɨɜɚ: ɪɚɛɨɱɟɣ ɫɤɨɪɨɫɬɢ, ɚɧɚɥɢɡ,ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ, ɪɟɫɭɪɫɵ
ɐɟɥɶ ɢɫɫɥɟɞɨɜɚɧɢɹ. ɐɟɥɶɸ ɞɚɧɧɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɹɜɥɹɟɬɫɹ ɜɵɹɜɥɟɧɢɟ ɪɟɫɭɪɫɨɜ ɞɥɹ ɩɨɜɵɲɟɧɢɹ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɆɌȺ ɩɭɬɟɦ ɢɡɭɱɟɧɢɹ ɮɚɤɬɨɪɨɜ, ɜɥɢɹɸɳɢɯ ɧɚ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɫɦɟɧɧɨɝɨ
ɜɪɟɦɟɧɢ.
304
Ɇɟɬɨɞɢɤɚ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɉɪɨɜɟɞɟɧɢɟ ɯɪɨɧɨɦɟɬɪɚɠɧɵɯ ɧɚɛɥɸɞɟɧɢɣ ɧɚ ɩɨɥɟɜɵɯ ɪɚɛɨɬɚɯ
Ⱥɧɚɥɢɡ ɢ ɨɰɟɧɤɚ ɪɟɡɭɥɶɬɚɬɨɜ ɢɫɫɥɟɞɨɜɚɧɢɣ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɦɚɬɟɦɚɬɢɤɨ-ɫɬɚɬɢɫɬɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ
Ɍɟɨɪɟɬɢɱɟɫɤɨɟ ɨɛɨɫɧɨɜɚɧɢɟ
ɉɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ (Wc) ɫɦɟɧɧɨɝɨ ɜɪɟɦɟɧɢ ɆɌȺ-ɮɭɧɤɰɢɹ ɡɚɜɢɫɹɳɚɹ ɨɬ ɪɚɛɨɱɟɣ ɲɢɪɢɧɵ ɡɚɯɜɚɬɚ (Bp), ɫɪɟɞɧɟɣ ɪɚɛɨɱɟɣ ɫɤɨɪɨɫɬɢ (Vp) ɢ ɨɬ ɤɨɷɮɮɢɰɢɟɧɬɚ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɫɦɟɧɧɨɝɨ ɜɪɟɦɟɧɢ (IJ)
(1)
Ʉɨɷɮɮɢɰɢɟɧɬ (IJ) ɡɚɜɢɫɢɬ ɨɬ ɮɨɪɦɵ ɨɪɝɚɧɢɡɚɰɢɢ ɩɨɥɟɜɵɯ ɪɚɛɨɬ, ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɢ ɬɟɯɧɢɱɟɫɤɨɣ
ɧɚɞɟɠɧɨɫɬɢ ɆɌȺ ɢ ɨɬ ɞɪɭɝɢɯ ɦɧɨɝɢɯ ɮɚɤɬɨɪɨɜ ɢ ɟɝɨ ɡɧɚɱɟɧɢɟ ɤɨɥɟɛɥɟɬɫɹ ɜ ɲɢɪɨɤɢɯ ɩɪɟɞɟɥɚɯ.
(2)
Ɂɞɟɫɶ:
– ɜɪɟɦɹ ɩɨɜɨɪɨɬɚ ɆɌȺ ɧɚ ɤɪɚɸ ɩɨɥɹ,
–ɜɪɟɦɹ ɭɫɬɪɚɧɟɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɧɟɢɫɩɪɚɜɧɨɫɬɟɣ,
–ɜɪɟɦɹ ɩɪɨɜɟɞɟɧɢɹ ɟɠɟɞɧɨɜɧɨɝɨ ɌɈ,
-ɜɪɟɦɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɫɥɭɠɢɜɚɧɢɹ,
–ɜɪɟɦɹ ɭɫɬɪɚɧɟɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɧɟɢɫɩɪɚɜɧɨɫɬɟɣ ɢ ɨɬɤɚɡɨɜ,
– ɜɪɟɦɹ ɫɜɹɡɚɧɧɨɟ ɫ ɨɪɝɚɧɢɡɚɰɢɟɣ ɪɚɛɨɬɵ
Ɉɬɫɸɞɚ ɫɥɟɞɭɟɬ, ɱɬɨ ɞɥɹ ɜɵɹɜɥɟɧɢɹ ɪɟɫɭɪɫɨɜ ɩɨɜɵɲɟɧɢɹ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɆɌȺ ɧɟɨɛɯɨɞɢɦɨ ɨɩɪɟɞɟɥɢɬɶ ɡɚɤɨɧɨɦɟɪɧɨɫɬɢ ɢɡɦɟɧɟɧɢɹ ɨɫɧɨɜɧɵɯ ɮɚɤɬɨɪɨɜ.
ȼ ɪɚɛɨɬɟ ɤɚɧɞ.ɬɟɯ.ɧɚɭɤ Ȼ.Ɇɭɧɯɛɚɬɚ ɩɪɟɞɫɬɚɜɥɟɧ ɪɟɡɭɥɶɬɚɬ ɢɫɫɥɟɞɨɜɚɧɢɹ ɤɚɪɬɨɮɟɥɟɩɨɫɚɞɨɱɧɨɝɨ
ɚɝɪɟɝɚɬɚ (ɆɌɁ-80+ɄɋɆ-4)[5,ɫ.30–56].
Ɉɧ ɨɬɦɟɱɚɟɬ, ɱɬɨ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɜɪɟɦɟɧɢ ɩɨɜɨɪɨɬɚ ɚɝɪɟɝɚɬɚ ɩɨɞɱɢɧɹɸɬɫɹ ɫɬɟɩɟɧɧɨɣ ɮɭɧɤɰɢɢ, ɚ ɧɚ ɭɛɨɪɨɱɧɨɦ ɚɝɪɟɝɚɬɟ ɡɚɤɨɧɨɦɟɪɧɨɫɬɢ ɢɡɦɟɧɟɧɢɹ ɜɵɲɟ ɢɡɥɨɠɟɧɧɵɯ ɮɚɤɬɨɪɨɜ ɢ ɟɳɟ ɜɤɥɸɱɚɹ ɜɪɟɦɹ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɨɞɧɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɩɪɨɫɬɚɹ ɩɨɞɱɢɧɹɸɬɫɹ ɷɤɫɩɨɧɟɧɰɢɚɥɶɧɨɦɭ ɡɚɤɨɧɭ.
ɇɚ ɨɫɧɨɜɟ ɩɪɨɜɟɞɟɧɧɵɯ ɧɚ ɩɨɫɟɜɧɵɯ ɚɝɪɟɝɚɬɚɯ (Ⱥɝɪɨɬɪɚɤ-150+3*ɋɄɉ-2,1 ɢ ɞɪ) ɢɫɫɥɟɞɨɜɚɧɢɣ
ɞɨɤɬɨɪ ɑ.ɐɷɜɷɝɠɚɜ ɞɟɥɚɟɬ ɜɵɜɨɞ, ɱɬɨ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɨɞɧɨɝɨ ɪɚɛɨɱɟɝɨ ɯɨɞɚ, ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɩɨɜɨɪɨɬɚ ɚɝɪɟɝɚɬɚ ɧɚ ɤɨɧɰɟ ɩɨɥɹ, ɢ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɧɟɨɛɯɨɞɵɦɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ
ɩɪɨɫɬɨɹ ɩɨɞɱɢɧɹɟɬɫɹ ɷɤɫɩɨɧɟɧɰɢɚɥɶɧɨɦɭ ɡɚɤɨɧɭ, ɚ ɫɪɟɞɧɹɹ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɨɞɧɨɝɨ ɪɚɛɨɱɟɝɨ
ɜɪɟɦɟɧɢ ɩɨɞɱɢɧɹɟɬɫɹ ɧɨɪɦɚɥɶɧɨɦɭ ɡɚɤɨɧɭ [7,ɫ. 25-48].
ɇɚɦɢ ɨɩɪɟɞɟɥɟɧɵ ɫɥɟɞɭɸɳɢɟ ɩɨɤɚɡɚɬɟɥɢ ɩɨɫɟɜɧɨɝɨ ɢ ɭɛɨɪɨɱɧɨɝɨ ɚɝɪɟɝɚɬɚ
Ʉɨɷɮɮɢɰɢɟɧɬ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɫɦɟɧɧɨɝɨ ɜɪɟɦɟɧɢ
ɋɪɟɞɧɹɹ ɪɚɛɨɱɚɹ ɫɤɨɪɨɫɬɶ ɚɝɪɟɝɚɬɚ
Ɋɚɛɨɱɚɹ ɲɢɪɢɧɚ ɡɚɯɜɚɬɚ
ɉɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɡɚɩɪɚɜɤɢ ɛɭɧɤɟɪɚ ɫɟɹɥɤɢ ɢ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɜɵɝɪɭɡɤɢ ɡɟɪɧɚ ɢɡ ɛɭɧɤɟɪɚ
ɉɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɩɨɜɨɪɨɬɚ ɚɝɪɟɝɚɬɚ ɜ ɤɨɧɰɟ ɡɚɝɨɧɚ.
Ⱦɥɹ ɧɚɩɪɢɦɟɪɚ ɩɪɟɞɫɬɚɜɥɹɸ ɪɟɡɭɥɶɬɚɬɵ ɷɤɫɩɟɪɢɦɟɧɬɨɜ ɩɨ ɢɡɭɱɟɧɢɸ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɵɯ ɩɨɤɚɡɚɬɟɥɟɣ ɩɨɫɟɜɧɵɯ ɚɝɪɟɝɚɬɨɜ JD9420+MORRIS 7240.
Ɋɢɫ. 1. Ɂɚɤɨɧɨɦɟɪɧɨɫɬɶ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɜɪɟɦɟɧɢ ɩɨɜɨɪɨɬɚ
ɩɨɫɟɜɧɨɝɨ ɚɝɪɟɝɚɬɚ JD9420+MORRIS 7240 (ɞɥɢɧɚ ɝɨɧɚ 1500 ɦ)
305
Ɋɢɫ. 2. Ɂɚɤɨɧɨɦɟɪɧɨɫɬɶ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɨɫɧɨɜɧɨɝɨ ɪɚɛɨɱɟɝɨ ɜɪɟɦɟɧɢ
ɩɨɫɟɜɧɨɝɨ ɚɝɪɟɝɚɬɚ JD9420+MORRIS 7240 (ɞɥɢɧɚ ɝɨɧɚ 1500 ɦ)
Ɋɢɫ. 3. Ɂɚɤɨɧɨɦɟɪɧɨɫɬɶ ɢɡɦɟɧɟɧɢɹ ɫɪɟɞɧɟɣ ɪɚɛɨɱɟɣ ɫɤɨɪɨɫɬɢ
ɩɨɫɟɜɧɨɝɨ ɚɝɪɟɝɚɬɚ JD9420+MORRIS 7240 (ɩɪɢ ɞɥɢɧɚ ɝɨɧɚ 1500 ɦ)
Ɋɢɫ. 4. Ɋɚɛɨɬɚ ɩɨɫɟɜɧɵɯ ɚɝɪɟɝɚɬɨɜ ɜɨ ɜɪɟɦɹ ɷɤɫɩɟɪɢɦɟɧɬɚ.(2013 ɝ)
Ɋɢɫ. 5. ɋɸɠɟɬɵ ɩɪɨɜɟɞɟɧɢɹ ɩɨɥɟɜɵɯ ɢɡɦɟɪɟɧɢɣ
306
ȼɕȼɈȾɕ:
ȼɵɫɨɤɨ ɦɨɳɧɵɟ ɤɨɥɟɫɧɵɟ ɬɪɚɤɬɨɪɵ, ɤɨɬɨɪɵɟ ɢɦɟɸɬ ɛɨɥɶɲɨɣ ɡɚɩɚɫ ɤɪɭɬɹɳɟɝɨ ɦɨɦɟɧɬɚ, ɩɪɢ
ɜɵɩɨɥɧɟɧɢɢ ɩɨɥɟɜɵɯ ɪɚɛɨɬ ɪɚɛɨɬɚɸɬ ɧɚ ɪɚɜɧɨɦɟɪɧɨɣ ɫɤɨɪɨɫɬɢ (ɧɨɪɦɚɥɶɧɨɣ ɡɚɤɨɧ), ɡɚɤɨɧɨɦɟɪɧɨɫɬɢ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɩɨɜɨɪɨɬɚ ɚɝɪɟɝɚɬɟ ɧɚ ɤɨɧɰɟ ɡɚɝɨɧɚ ɢ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɨɞɧɨɝɨ ɯɨɞɚ
ɨɫɧɨɜɧɨɝɨ ɪɚɛɨɱɟɝɨ ɜɪɟɦɟɧɢ ɩɨɞɱɢɧɹɸɬɫɹ ɡɚɤɨɧɭ ɪɟɞɤɢɯ ɫɨɛɵɬɢɣ (ɡɚɤɨɧɭ ɉɭɚɫɫɨɧɚ).
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɢɹ ɯɪɨɧɨɦɟɬɪɚɠɧɵɯ ɧɚɛɥɸɞɟɧɢɣ ɨɩɪɟɞɟɥɟɧɵ ɨɫɧɨɜɧɵɟ ɩɚɪɚɦɟɬɪɵ ɪɚɫɫɦɚɬɪɢɜɚɟɦɵɯ ɫɥɭɱɚɣɧɵɯ ɩɪɨɰɟɫɫɨɜ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
3.
4.
5.
6.
7.
Ȼɭɹɧɞɷɥɝɷɪ Ⱦ. “Ɉɛɨɫɧɨɜɚɧɢɟ ɫɪɟɞɫɬɜɚ ɦɟɯɚɧɢɡɚɰɢɢ ɜɨɡɞɟɥɵɜɚɧɢɹ ɤɚɪɬɥɮɟɥɹ ɜ ɭɫɥɨɜɢɹɯ ɐɟɧɬɪɚɥɶɧɨɣ
ɡɟɦɥɟɞɟɥɶɱɟɫɤɨɣ ɡɨɧɵ ɆɇɊ”: // Ⱦɢɫ. ...ɤɚɧɞ.ɬɟɯɧ.ɧɚɭɤ.-Ɇ.:Ɇɂɂɋɉ, 1983 ɝ.
Ȼɹɦɛɚɞɨɪɠ ɑ. “Ɉɫɧɨɜɵ ɩɨɫɬɪɨɟɧɢɹ ɚɞɚɩɬɢɜɧɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ ɩɪɨɢɡɜɨɞɟɫɬɜɚ ɡɟɪɧɚ ɜ
ɭɫɥɨɜɢɹɯ Ɇɨɧɝɨɥɢɢ” 1995 ɝ. Ⱦɢɫɫ. ɇɚ ɫɨɢɫɤɚɧɢɟ ɭɱɟɧɨɟ ɫɬɟɩɟɧɢ ɞɨɤɬɨɪɚ ɬɟɯɧɢɱɟɫɤɢɯ ɧɚɭɤ.
Ƚɪɟɲɧɢɤɨɜ. ȼ.Ⱥ. “ɋɬɚɬɢɱɟɫɤɢɟ ɦɟɬɨɞɵ ɨɛɪɚɛɨɬɤɢ ɷɦɩɢɪɢɱɟɫɤɢɯ ɞɚɧɧɵɯ” 1978 ɝ
“ɂɫɩɵɬɚɧɢɟ ɫɟɥɶɯɨɡ. ɬɟɯɧɢɤɢ” Ɇɟɬɨɞɵ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɨ – ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɨɰɟɧɤɢ. ȽɈɋɌ Ɋ 52778 –
2007 ɝ
ɆΫɧɯɛɚɬ Ȼ. “Ɍԧɦɫ ɬɚɪɢɚɥɚɯ ɦɟɯɚɧɢɤɠɫɚɧ ɬɟɯɧɨɥɨɝɢ, ɬɟɯɧɢɤ ɯɷɪɷɝɫɷɥ ɫɨɧɝɨɯ ԛɧɞɷɫɥɷɥ” 2006 ɝ, Ⱦɢɫ.
...ɤɚɧɞ.ɬɟɯɧ.ɧɚɭɤ.
ɉɪɢɦɟɪɧɵɟ ɧɨɪɦɵ ɩɨ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɢ ɪɚɫɯɨɞɚɦ ɬɨɩɥɢɜɚ ɫɟɥɶɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɬɟɯɧɢɤɢ, ɤɨɬɨɪɚɹ
ɜɧɟɞɪɹɟɬɫɹ ɜ ɫɟɥɶɫɤɨɟ ɯɨɡɹɣɫɬɜɨ. ɍɥɚɧɛɚɬɨɪ. 2010 ɝ. (ɧɚ ɦɨɧɝɨɥɶɫɤɨɦ ɹɡɵɤɟ).
ɐɷɜɷɝɠɚɜ ɑ. “ɏԧɪɫ ɷɥɞɷɧɲԛԛɥɷɯ ԛɪ ɬɷɷɜɷɪɥɷɯ ԛɪɥɷɯ ɭɝɫɪɚɚɧɵ ɩɚɪɚɦɟɬɪ ɚɠɥɵɧ ɝɨɪɢɦɵɧ ԛɧɞɷɫɥɷɥ”
2012 ɝ, Ⱦɢɫ. ...ɤɚɧɞ.ɬɟɯɧ.ɧɚɭɤ.
ɗɪɞɷɧɷɬɭɹɚ Ȼ. Ɉɛɨɫɧɨɜɚɧɢɟ ɬɟɯɧɨɥɨɝɢɢ ɢ ɤɨɦɩɥɟɤɫɚ ɦɚɲɢɧ ɞɥɹ ɜɨɡɞɟɥɵɜɚɧɢɹ ɤɚɪɬɨɮɟɥɹ ɜ ɭɫɥɨɜɢɹɯ
Ɇɨɧɝɨɥɢɢ. Ⱥɜɬɪɟɮɟɪɚɬ ɧɚ ɫɨɢɫɤɚɧɢɟ ɭɱɟɧɨɣ ɫɬɟɩɟɧɢ ɤɬɧ. Ɇɨɫɤɜɚ. 2006 ɝ.
ɍȾɄ 635.535
ɈɐȿɇɄȺ ɉɈɌȿɇɐɂȺɅɖɇɈɃ ɍɄɈɊȿɇəȿɆɈɋɌɂ
ɁȿɅȬɇɕɏ ɑȿɊȿɇɄɈȼ ɈȻɅȿɉɂɏɂ
ɉɈ ɂɏ ɗɅȿɄɌɊɂɑȿɋɄɂɆ ɋȼɈɃɋɌȼȺɆ
Ɇɂɇȿȿȼ ȼ.ȼ., ȺɅȿɃɇɂɄɈȼ Ⱥ.Ɏ., ɉɈɌȺɇɂɇ ȼ.Ƚ.,
ɎȽȻɇɍ ɋɢɛɢɪɫɤɢɣ ɮɢɡɢɤɨ-ɬɟɯɧɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ ɚɝɪɚɪɧɵɯ ɩɪɨɛɥɟɦ,
Ʉɪɚɫɧɨɨɛɫɤ, Ɋɨɫɫɢɹ, e-mail: fti2009@yandex.ru
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɪɢ ɡɟɥɺɧɨɦ ɱɟɪɟɧɤɨɜɚɧɢɢ ɨɬɛɪɚɤɨɜɤɚ ɩɨɫɚɞɨɱɧɨɝɨ ɦɚɬɟɪɢɚɥɚ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɩɨɫɥɟ ɭɤɨɪɟɧɟɧɢɹ ɱɟɪɟɧɤɨɜ. Ⱥ ɬɚɤ ɤɚɤ ɱɚɫɬɶ ɫɚɠɟɧɰɟɜ ɛɪɚɤɭɟɬɫɹ, ɬɨ ɩɨɥɭɱɚɟɬɫɹ, ɱɬɨ ɱɚɫɬɶ ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɯ ɦɚɬɟɪɢɚɥɶɧɵɯ ɪɟɫɭɪɫɨɜ ɡɚɬɪɚɱɢɜɚɟɬɫɹ ɛɟɡɪɟɡɭɥɶɬɚɬɧɨ, ɢ ɩɪɢ ɨɩɪɟɞɟɥɺɧɧɵɯ ɩɨɬɟɪɹɯ
ɩɪɨɢɡɜɨɞɫɬɜɨ ɫɬɚɧɨɜɢɬɫɹ ɧɟɪɟɧɬɚɛɟɥɶɧɵɦ (ɨɫɨɛɟɧɧɨ ɜ ɩɪɨɦɵɲɥɟɧɧɵɯ ɩɥɨɞɨɩɢɬɨɦɧɢɤɚɯ, ɤɨɝɞɚ
ɤɨɥɢɱɟɫɬɜɨ ɫɚɠɟɧɰɟɜ ɢɫɱɢɫɥɹɟɬɫɹ ɫɨɬɧɹɦɢ ɬɵɫɹɱ) [1]. Ɉɬɛɪɚɤɨɜɤɚ ɱɟɪɟɧɤɨɜ ɧɚ ɪɚɧɧɢɯ ɫɬɚɞɢɹɯ, ɬɨ
ɟɫɬɶ ɞɨ ɭɤɨɪɟɧɟɧɢɹ, ɩɨɡɜɨɥɢɥɚ ɛɵ ɩɨɜɵɫɢɬɶ ɭɪɨɜɟɧɶ ɪɟɧɬɚɛɟɥɶɧɨɫɬɢ. ɂɡɜɟɫɬɟɧ ɫɩɨɫɨɛ ɞɢɚɝɧɨɫɬɢɤɢ ɭɤɨɪɟɧɹɟɦɨɫɬɢ ɱɟɪɟɧɤɨɜ ɩɨ ɫɨɨɬɧɨɲɟɧɢɸ ɪɚɡɦɟɪɨɜ ɤɨɥɶɰɚ ɤɨɪɵ ɢ ɤɨɥɶɰɚ ɤɫɢɥɟɦɵ ɱɟɪɟɧɤɚ
[2]. ɉɨɤɚɡɚɧɨ, ɱɬɨ ɷɬɨ ɫɨɨɬɧɨɲɟɧɢɟ ɞɨɥɠɧɨ ɛɵɬɶ ɪɚɜɧɨ ɢɥɢ ɛɨɥɶɲɟ ɟɞɢɧɢɰɵ, ɬɚɤ ɤɚɤ ɩɪɢ ɫɨɨɬɧɨɲɟɧɢɢ ɦɟɧɟɟ 0,78 ɡɟɥɺɧɵɟ ɱɟɪɟɧɤɢ ɧɟ ɭɤɨɪɟɧɹɸɬɫɹ. ɇɟɞɨɫɬɚɬɨɤ ɫɩɨɫɨɛɚ – ɛɨɥɶɲɚɹ ɬɪɭɞɨɺɦɤɨɫɬɶ
ɨɩɪɟɞɟɥɟɧɢɹ ɩɚɪɚɦɟɬɪɚ, ɜ ɪɟɡɭɥɶɬɚɬɟ ɱɟɝɨ ɫɩɨɫɨɛ ɧɟ ɩɪɢɝɨɞɟɧ ɞɥɹ ɷɤɫɩɪɟɫɫ-ɞɢɚɝɧɨɫɬɢɤɢ.
ɐɟɥɶɸ ɞɚɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɹɜɥɹɟɬɫɹ ɨɛɨɫɧɨɜɚɧɢɟ ɷɤɫɩɪɟɫɫ-ɦɟɬɨɞɚ ɨɰɟɧɤɢ ɩɨɬɟɧɰɢɚɥɶɧɨɣ
ɭɤɨɪɟɧɹɟɦɨɫɬɢ ɫɪɟɡɚɧɧɵɯ ɡɟɥɺɧɵɯ ɱɟɪɟɧɤɨɜ ɩɨ ɢɯ ɷɥɟɤɬɪɢɱɟɫɤɢɦ ɫɜɨɣɫɬɜɚɦ, ɨɛɟɫɩɟɱɢɜɚɸɳɟɝɨ
ɪɚɧɧɸɸ ɞɢɚɝɧɨɫɬɢɤɭ, ɩɨɜɵɲɚɸɳɟɝɨ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɩɪɨɰɟɞɭɪɵ ɤɨɧɬɪɨɥɹ ɢ, ɤɚɤ ɫɥɟɞɫɬɜɢɟ,
ɪɟɧɬɚɛɟɥɶɧɨɫɬɶ ɩɥɨɞɨɩɢɬɨɦɧɢɤɨɜ.
ɂɫɫɥɟɞɨɜɚɧɢɹ ɨɫɧɨɜɚɧɵ ɧɚ ɬɨɦ, ɱɬɨ ɮɭɧɤɰɢɨɧɚɥɶɧɨɟ ɫɨɫɬɨɹɧɢɟ ɪɚɫɬɢɬɟɥɶɧɨɣ ɬɤɚɧɢ ɨɩɪɟɞɟɥɹɟɬɫɹ, ɜ ɬɨɦ ɱɢɫɥɟ ɢ ɷɥɟɤɬɪɢɱɟɫɤɢɦɢ ɩɪɨɰɟɫɫɚɦɢ [3], ɚ ɬɚɤɠɟ ɧɚ ɲɢɪɨɤɨɦ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɢ ɷɥɟɤɬɪɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ ɨɰɟɧɤɢ ɫɜɨɣɫɬɜ ɪɚɫɬɢɬɟɥɶɧɵɯ ɢ ɠɢɜɨɬɧɵɯ ɬɤɚɧɟɣ (ɤɨɧɞɭɤɬɨɦɟɬɪɢɱɟɫɤɨɝɨ, ɩɨɥɹɪɢɡɚɰɢɨɧɧɨɝɨ ɢ ɦɟɬɨɞɚ ɢɦɩɟɞɚɧɫɧɨɣ ɫɩɟɤɬɪɨɫɤɨɩɢɢ) [4,5,6,7]. ɂɡɜɟɫɬɧɨ, ɱɬɨ ɱɟɦ ɛɨɥɟɟ ɦɨɥɨɞɨɣ
ɢ ɡɞɨɪɨɜɨɣ ɹɜɥɹɟɬɫɹ ɬɤɚɧɶ ɪɚɫɬɟɧɢɹ, ɬɟɦ ɫɢɥɶɧɟɟ ɩɪɨɹɜɥɹɸɬɫɹ ɺɦɤɨɫɬɧɵɟ ɫɜɨɣɫɬɜɚ ɟɺ ɦɟɦɛɪɚɧ ɢ
ɬɟɦ ɛɨɥɶɲɟ ɪɚɡɧɢɰɚ ɦɟɠɞɭ ɡɧɚɱɟɧɢɹɦɢ ɦɨɞɭɥɟɣ ɢɦɩɟɞɚɧɫɨɜ, ɢɡɦɟɪɟɧɧɵɯ ɧɚ ɧɢɡɤɨɣ ɢ ɜɵɫɨɤɨɣ
ɱɚɫɬɨɬɚɯ [8].
307
Ɇɟɬɨɞɢɤɚ ɢɫɫɥɟɞɨɜɚɧɢɣ ɛɚɡɢɪɭɟɬɫɹ ɧɚ ɦɟɬɨɞɟ ɢɦɩɟɞɚɧɫɧɨɣ ɫɩɟɤɬɪɨɫɤɨɩɢɢ, ɩɪɟɢɦɭɳɟɫɬɜɨɦ
ɤɨɬɨɪɨɝɨ ɹɜɥɹɟɬɫɹ ɜɵɫɨɤɚɹ ɞɨɫɬɨɜɟɪɧɨɫɬɶ ɜ ɨɩɪɟɞɟɥɟɧɢɢ ɪɚɡɧɨɨɛɪɚɡɧɵɯ ɩɨɤɚɡɚɬɟɥɟɣ ɤɚɱɟɫɬɜɚ
ɩɪɨɞɭɤɬɨɜ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɢ ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ, ɬɚɤ ɤɚɤ ɢɫɩɨɥɶɡɭɟɦɵɟ ɧɚɩɪɹɠɟɧɢɹ (ɦɟɧɟɟ
50 ɦȼ) ɧɟ ɜɧɨɫɹɬ ɫɭɳɟɫɬɜɟɧɧɵɯ ɢɡɦɟɧɟɧɢɣ ɜ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ, ɩɪɨɬɟɤɚɸɳɢɟ ɜ ɛɢɨɥɨɝɢɱɟɫɤɢɯ ɨɛɴɟɤɬɚɯ, ɢ ɧɟ ɩɨɜɪɟɠɞɚɸɬ ɢɯ, ɚ ɬɚɤɠɟ ɜɨɡɦɨɠɧɨɫɬɶ ɪɟɚɥɢɡɚɰɢɢ ɧɚ ɟɝɨ ɨɫɧɨɜɟ ɧɟɷɧɟɪɝɨɺɦɤɢɯ ɩɟɪɟɧɨɫɧɵɯ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɤɨɧɬɪɨɥɹ [9]. ɂɫɫɥɟɞɨɜɚɬɟɥɶɫɤɚɹ ɭɫɬɚɧɨɜɤɚ, ɫɨɫɬɨɢɬ ɢɡ
ɰɢɮɪɨɜɵɯ ɢɡɦɟɪɢɬɟɥɟɣ ɞɟɣɫɬɜɢɬɟɥɶɧɨɣ ɢ ɦɧɢɦɨɣ ɱɚɫɬɟɣ ɢɦɩɟɞɚɧɫɚ, ɪɚɛɨɬɚɸɳɢɯ ɧɚ ɮɢɤɫɢɪɨɜɚɧɧɵɯ ɱɚɫɬɨɬɚɯ 1 ɤȽɰ (ȿ7–8) ɢ 1 ɆȽɰ (ȿ7–12). ȼ ɤɚɱɟɫɬɜɟ ɩɟɪɜɢɱɧɵɯ ɩɪɟɨɛɪɚɡɨɜɚɬɟɥɟɣ ɜɯɨɞɧɵɯ ɫɢɝɧɚɥɨɜ ɜɵɛɪɚɧɵ ɤɨɥɶɰɟɜɵɟ ɝɢɛɤɢɟ ɷɥɟɤɬɪɨɞɵ ɗɋɈ-1 ɩɪɨɢɡɜɨɞɫɬɜɚ ɮɢɪɦɵ «ɇɟɣɪɨɫɨɮɬ» (Ɋɨɫɫɢɹ) ɢ
ɷɥɟɤɬɪɨɩɪɨɜɨɞɧɚɹ ɤɥɟɹɳɚɹ ɩɚɫɬɚ «ɍɇɂɉȺɋɌȺ» ɩɪɨɢɡɜɨɞɫɬɜɚ ɈɈɈ «Ƚɟɥɶɬɟɤ-Ɇɟɞɢɤɚ» (Ɋɨɫɫɢɹ),
ɤɨɬɨɪɚɹ ɢɫɩɨɥɶɡɨɜɚɥɚɫɶ ɞɥɹ ɭɦɟɧɶɲɟɧɢɹ ɤɨɧɬɚɤɬɧɨɝɨ ɫɨɩɪɨɬɢɜɥɟɧɢɹ ɦɟɠɞɭ ɷɥɟɤɬɪɨɞɚɦɢ ɢ ɩɨɜɟɪɯɧɨɫɬɶɸ ɱɟɪɟɧɤɨɜ. Ɋɚɫɫɬɨɹɧɢɟ ɦɟɠɞɭ ɤɨɥɶɰɟɜɵɦɢ ɷɥɟɤɬɪɨɞɚɦɢ ɩɪɢ ɡɚɤɪɟɩɥɟɧɢɢ ɢɯ ɧɚ ɱɟɪɟɧɤɟ
ɫɨɫɬɚɜɥɹɥɨ 20 ɦɦ.
ȼ ɤɚɱɟɫɬɜɟ ɷɥɟɤɬɪɨɮɢɡɢɱɟɫɤɢɯ ɩɚɪɚɦɟɬɪɨɜ ɪɚɫɬɢɬɟɥɶɧɨɣ ɬɤɚɧɢ ɹɝɨɞ ɢ ɱɟɪɟɧɤɨɜ ɨɛɥɟɩɢɯɢ, ɨɩɪɟɞɟɥɹɟɦɵɯ ɦɟɬɨɞɨɦ ɩɪɹɦɵɯ ɢɡɦɟɪɟɧɢɣ, ɜɵɛɪɚɧɵ ɚɤɬɢɜɧɚɹ ɩɪɨɜɨɞɢɦɨɫɬɶ G ɢ ɩɚɪɚɥɥɟɥɶɧɚɹ ɪɟɚɤɬɢɜɧɚɹ ɫɨɫɬɚɜɥɹɸɳɚɹ ɜ ɮɨɪɦɟ ɺɦɤɨɫɬɢ C . Ɇɨɞɭɥɶ ɢɦɩɟɞɚɧɫɚ Z ( f ) , ɨɬɧɨɲɟɧɢɹ ɦɨɞɭɥɟɣ ɢɦɩɟɞɚɧɫɨɜ K (Z ) ɧɚ ɱɚɫɬɨɬɚɯ f 1 ɢ f 2 ɨɩɪɟɞɟɥɹɥɢɫɶ ɩɭɬɺɦ ɤɨɫɜɟɧɧɵɯ ɢɡɦɟɪɟɧɢɣ ɩɨ ɮɨɪɦɭɥɚɦ:
Z( f )
ɝɞɟ B ( f )
= 1 ɆȽɰ).
1
(1) K ( Z )
B( f )
Z ( f1 )
,
Z( f2 )
(2)
G 2 (6,28 fC ) 2 – ɦɨɞɭɥɶ ɩɨɥɧɨɣ ɩɪɨɜɨɞɢɦɨɫɬɢ; f – ɱɚɫɬɨɬɚ ( f 1 = 1 ɤȽɰ ɢɥɢ f 2
Ⱦɥɹ ɩɪɨɜɟɞɟɧɢɹ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɨɫɭɳɟɫɬɜɥɹɥɚɫɶ ɫɪɟɡɤɚ ɡɟɥɺɧɵɯ ɱɟɪɟɧɤɨɜ
ɨɛɥɟɩɢɯɢ ɜ ɤɨɥɢɱɟɫɬɜɟ 100 ɲɬɭɤ (ɝɟɧɟɪɚɥɶɧɚɹ ɫɨɜɨɤɭɩɧɨɫɬɶ) ɫ ɨɞɧɨɝɨ ɞɟɪɟɜɚ (ɞɥɹ ɢɫɤɥɸɱɟɧɢɹ
ɜɥɢɹɧɢɹ ɫɨɪɬɚ ɢ ɫɬɟɩɟɧɢ ɪɚɡɜɢɬɨɫɬɢ ɪɚɫɬɟɧɢɹ). ɑɟɪɟɧɤɢ ɦɚɪɤɢɪɨɜɚɥɢɫɶ ɩɨ ɧɨɦɟɪɚɦ ɫ ɩɨɦɨɳɶɸ
ɛɢɪɨɤ ɢ ɜɨɞɨɫɬɨɣɤɨɝɨ ɦɚɪɤɟɪɚ. Ɍɚɤ ɤɚɤ ɢɫɯɨɞɧɵɟ ɞɚɧɧɵɟ ɢɡɦɟɪɟɧɢɣ ɚɤɬɢɜɧɨɣ ɩɪɨɜɨɞɢɦɨɫɬɢ G ɢ
ɺɦɤɨɫɬɢ C ɨɞɧɨɝɨ ɢ ɬɨɝɨ ɠɟ ɱɟɪɟɧɤɚ ɢɡ-ɡɚ ɧɟɫɬɚɛɢɥɶɧɨɫɬɢ ɢɦɩɟɞɚɧɫɚ ɤɨɧɬɚɤɬɚ ɧɨɫɹɬ ɫɥɭɱɚɣɧɵɣ
ɯɚɪɚɤɬɟɪ, ɩɪɟɞɜɚɪɢɬɟɥɶɧɨ ɩɨɞɬɜɟɪɠɞɚɥɚɫɶ ɢɯ ɩɪɢɧɚɞɥɟɠɧɨɫɬɶ ɧɨɪɦɚɥɶɧɨɦɭ ɡɚɤɨɧɭ ɪɚɫɩɪɟɞɟɥɟɧɢɹ. ɉɪɨɜɟɪɤɚ ɩɪɨɜɨɞɢɥɚɫɶ ɩɨ ɫɨɫɬɚɜɧɨɦɭ ɤɪɢɬɟɪɢɸ ɫ ɭɪɨɜɧɟɦ ɡɧɚɱɢɦɨɫɬɢ q = 2 % ɢ ɱɢɫɥɨɦ
ɢɡɦɟɪɟɧɢɣ n = 20 ɩɨ ɦɟɬɨɞɢɤɟ, ɩɪɢɜɟɞɺɧɧɨɣ ɜ [10]. Ⱦɚɥɟɟ ɩɪɢ ɩɨɥɨɠɢɬɟɥɶɧɨɦ ɢɫɯɨɞɟ ɩɪɨɜɟɪɤɢ
ɢɡɦɟɪɟɧɢɹ ɷɥɟɤɬɪɨɮɢɡɢɱɟɫɤɢɯ ɩɚɪɚɦɟɬɪɨɜ ɤɚɠɞɨɝɨ ɷɥɟɦɟɧɬɚ (ɱɟɪɟɧɤɚ) ɝɟɧɟɪɚɥɶɧɨɣ ɫɨɜɨɤɭɩɧɨɫɬɢ
ɩɪɨɜɨɞɢɥɢɫɶ ɜ ɬɪɺɯ ɩɨɜɬɨɪɧɨɫɬɹɯ. Ɋɟɡɭɥɶɬɚɬɵ ɢɡɦɟɪɟɧɢɣ ɢ ɞɨɜɟɪɢɬɟɥɶɧɵɟ ɝɪɚɧɢɰɵ ɩɨɝɪɟɲɧɨɫɬɢ
ɢɡɦɟɪɟɧɢɣ ɩɪɢ ɞɨɜɟɪɢɬɟɥɶɧɨɣ ɜɟɪɨɹɬɧɨɫɬɢ Ɋ = 0,95 ɨɩɪɟɞɟɥɹɥɢɫɶ ɞɥɹ ɝɪɭɩɩɵ ɩɪɹɦɵɯ ɢɡɦɟɪɟɧɢɣ
ɩɨ ɦɟɬɨɞɢɤɟ [10], ɚ ɤɨɫɜɟɧɧɵɯ – ɩɨ ɦɟɬɨɞɢɤɟ [11]. ɉɨɫɤɨɥɶɤɭ ɩɚɪɚɦɟɬɪɵ ɢɦɩɟɞɚɧɫɚ ɡɚɜɢɫɹɬ ɧɟ
ɬɨɥɶɤɨ ɨɬ ɮɢɡɢɨɥɨɝɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɱɟɪɟɧɤɨɜ, ɚ ɟɳɺ ɢ ɨɬ ɢɯ ɪɚɡɦɟɪɨɜ, ɬɨ ɞɥɹ ɭɦɟɧɶɲɟɧɢɹ ɢɯ
ɜɥɢɹɧɢɹ ɜ ɤɚɱɟɫɬɜɟ ɢɧɮɨɪɦɚɬɢɜɧɨɝɨ ɩɚɪɚɦɟɬɪɚ ɜɵɛɪɚɧɨ ɨɬɧɨɲɟɧɢɟ ɦɨɞɭɥɟɣ ɢɦɩɟɞɚɧɫɨɜ K (Z ) ,
ɪɚɫɫɱɢɬɚɧɧɵɯ ɩɨ ɮɨɪɦɭɥɚɦ (1) ɢ (2). ɉɨɫɥɟ ɢɡɦɟɪɟɧɢɣ ɚɤɬɢɜɧɨɣ ɩɪɨɜɨɞɢɦɨɫɬɢ G ɢ ɺɦɤɨɫɬɢ C
ɱɟɪɟɧɤɢ ɜɵɫɚɠɢɜɚɥɢɫɶ ɜ ɬɟɩɥɢɰɟ. ɉɨɫɥɟ ɭɤɨɪɟɧɟɧɢɹ ɱɟɪɟɧɤɨɜ ɨɫɟɧɶɸ ɩɪɨɢɡɜɨɞɢɥɚɫɶ ɢɯ ɫɨɪɬɢɪɨɜɤɚ ɦɟɬɨɞɨɦ ɷɤɫɩɟɪɬɧɨɣ ɨɰɟɧɤɢ ɩɨ ɪɚɡɜɢɬɨɫɬɢ ɤɨɪɧɟɜɨɣ ɫɢɫɬɟɦɵ ɧɚ ɱɟɬɵɪɟ ɝɪɭɩɩɵ (ɭɤɨɪɟɧɢɜɲɢɟɫɹ ɱɟɪɟɧɤɢ 1-ɝɨ, 2-ɝɨ, 3-ɝɨ ɫɨɪɬɨɜ ɢ ɧɟɭɤɨɪɟɧɢɜɲɢɟɫɹ ɱɟɪɟɧɤɢ). ɇɚɥɢɱɢɟ ɤɨɪɪɟɥɹɰɢɢ ɦɟɠɞɭ
ɫɨɪɬɧɨɫɬɶɸ ɱɟɪɟɧɤɨɜ ɢ ɷɥɟɤɬɪɨɮɢɡɢɱɟɫɤɢɦɢ ɩɚɪɚɦɟɬɪɚɦɢ ɢɯ ɪɚɫɬɢɬɟɥɶɧɵɯ ɬɤɚɧɟɣ ɨɩɪɟɞɟɥɹɥɨɫɶ
ɫɬɚɬɢɫɬɢɱɟɫɤɨɣ ɨɛɪɚɛɨɬɤɨɣ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɞɚɧɧɵɯ ɤɚɠɞɨɣ ɝɪɭɩɩɵ ɦɟɬɨɞɚɦɢ ɬɟɨɪɢɢ ɜɟɪɨɹɬɧɨɫɬɟɣ ɢ ɦɚɬɟɦɚɬɢɱɟɫɤɨɣ ɫɬɚɬɢɫɬɢɤɢ.
Ɋɟɡɭɥɶɬɚɬɵ ɩɪɨɜɟɪɤɢ ɝɢɩɨɬɟɡɵ ɨ ɧɨɪɦɚɥɶɧɨɫɬɢ ɪɚɫɩɪɟɞɟɥɟɧɢɹ ɪɟɡɭɥɶɬɚɬɨɜ ɢɡɦɟɪɟɧɢɹ ɩɪɨɜɨɞɢɦɨɫɬɢ G ɢ ɺɦɤɨɫɬɢ C ɱɟɪɟɧɤɨɜ ɩɨ ɫɨɫɬɚɜɧɨɦɭ ɤɪɢɬɟɪɢɸ [10] ɩɪɢɛɨɪɚɦɢ ȿ7–8 ɢ ȿ7–12 ɩɪɢɜɟɞɟɧɵ
ɜ ɬɚɛɥ. 1. ȼ ɪɟɡɭɥɶɬɚɬɟ ɫɨɪɬɢɪɨɜɤɢ 100 ɱɟɪɟɧɤɨɜ ɩɨɫɥɟ ɢɯ ɭɤɨɪɟɧɟɧɢɹ ɝɪɭɩɩɚ 1-ɝɨ ɫɨɪɬɚ ɧɚɫɱɢɬɵɜɚɥɚ 41 ɲɬɭɤɭ, 2-ɝɨ ɫɨɪɬɚ – 38 ɲɬɭɤ, 3-ɝɨ ɫɨɪɬɚ – 5 ɲɬɭɤ ɢ ɧɟɭɤɨɪɟɧɢɜɲɢɯɫɹ – 10 ɲɬɭɤ. ȼ ɩɪɨɰɟɫɫɟ
ɭɤɨɪɟɧɟɧɢɹ ɧɚ 6-ɬɢ ɱɟɪɟɧɤɚɯ ɛɵɥɢ ɭɬɟɪɹɧɵ ɛɢɪɤɢ, ɢ ɷɬɢ ɱɟɪɟɧɤɢ ɧɟ ɭɱɢɬɵɜɚɥɢɫɶ. ɉɨ ɞɚɧɧɵɦ
ɬɪɺɯɤɪɚɬɧɵɯ ɢɡɦɟɪɟɧɢɣ ɚɤɬɢɜɧɨɣ ɩɪɨɜɨɞɢɦɨɫɬɢ G ɢ ɺɦɤɨɫɬɢ C , ɩɪɨɢɡɜɟɞɺɧɧɵɯ ɞɨ ɭɤɨɪɟɧɟɧɢɹ,
ɛɵɥɢ ɜɵɱɢɫɥɟɧɵ ɦɚɬɟɦɚɬɢɱɟɫɤɢɟ ɨɠɢɞɚɧɢɹ ɢɦɩɟɞɚɧɫɨɜ K (Z ) ɩɨ ɮɨɪɦɭɥɚɦ (1) ɢ (2) ɞɥɹ ɤɚɠɞɨɝɨ
ɱɟɪɟɧɤɚ ɜɫɟɯ ɱɟɬɵɪɺɯ ɝɪɭɩɩ.
ɉɪɨɜɟɪɤɚ ɧɨɪɦɚɥɶɧɨɫɬɢ ɪɚɫɩɪɟɞɟɥɟɧɢɹ ɪɟɡɭɥɶɬɚɬɨɜ ɢɡɦɟɪɟɧɢɣ ɤɨɷɮɮɢɰɢɟɧɬɚ K (Z ) ɜɧɭɬɪɢ
ɤɚɠɞɨɣ ɝɪɭɩɩɵ, ɚ ɬɚɤɠɟ ɫɬɚɬɢɫɬɢɱɟɫɤɢɟ ɯɚɪɚɤɬɟɪɢɫɬɢɤɢ ɡɚɤɨɧɚ ɪɚɫɩɪɟɞɟɥɟɧɢɹ ɢ ɫɬɚɬɢɫɬɢɱɟɫɤɢɟ
ɨɰɟɧɤɢ ɩɨɝɪɟɲɧɨɫɬɢ ɤɨɷɮɮɢɰɢɟɧɬɚ K (Z ) ɞɥɹ ɤɚɠɞɨɣ ɝɪɭɩɩɵ ɨɩɪɟɞɟɥɟɧɵ ɫ ɩɨɦɨɳɶɸ ɫɬɚɬɢɫɬɢɱɟɫɤɨɝɨ ɦɨɞɭɥɹ «Descriptive Statistics» ɜɧɭɬɪɢ ɞɢɫɩɟɪɫɢɨɧɧɨɝɨ ɚɧɚɥɢɡɚ [13] ɩɪɢ ɝɪɭɩɩɢɪɨɜɤɟ ɩɨ
5. Ɋɟɡɭɥɶɬɚɬɵ ɩɪɟɞɫɬɚɜɥɟɧɵ ɜ ɬɚɛɥ. 2. ɂɡ ɞɚɧɧɵɯ ɬɚɛɥɢɰɵ 2 ɜɢɞɧɨ, ɱɬɨ ɦɚɬɟɦɚɬɢɱɟɫɤɢɟ ɨɠɢɞɚɧɢɹ
308
ɤɨɷɮɮɢɰɢɟɧɬɚ K (Z ) ɱɟɪɟɧɤɨɜ ɭɦɟɧɶɲɚɸɬɫɹ ɩɪɢ ɫɧɢɠɟɧɢɢ ɢɯ ɤɚɱɟɫɬɜɚ, ɚ ɞɨɜɟɪɢɬɟɥɶɧɵɣ ɢɧɬɟɪɜɚɥ ɤɨɷɮɮɢɰɢɟɧɬɚ K (Z ) ɧɟɭɤɨɪɟɧɢɜɲɢɯɫɹ ɱɟɪɟɧɤɨɜ ɧɟ ɩɟɪɟɤɪɵɜɚɟɬɫɹ ɫ ɞɨɜɟɪɢɬɟɥɶɧɵɦɢ ɢɧɬɟɪɜɚɥɚɦɢ ɱɟɪɟɧɤɨɜ 1-ɝɨ ɢ 2-ɝɨ ɫɨɪɬɨɜ. ɋɥɟɞɨɜɚɬɟɥɶɧɨ, ɩɭɬɺɦ ɢɡɦɟɪɟɧɢɹ ɤɨɷɮɮɢɰɢɟɧɬɚ K (Z ) ɦɨɠɧɨ
ɨɫɭɳɟɫɬɜɢɬɶ ɪɚɧɧɸɸ ɨɬɛɪɚɤɨɜɤɭ ɩɨɬɟɧɰɢɚɥɶɧɨ ɧɟɩɪɢɝɨɞɧɵɯ ɱɟɪɟɧɤɨɜ.
Ɍɚɛɥɢɰɚ 1
Ɋɟɡɭɥɶɬɚɬɵ ɩɪɨɜɟɪɤɢ ɝɢɩɨɬɟɡɵ ɨ ɧɨɪɦɚɥɶɧɨɫɬɢ ɪɚɫɩɪɟɞɟɥɟɧɢɹ ɪɟɡɭɥɶɬɚɬɨɜ ɢɡɦɟɪɟɧɢɹ
ɉɚɪɚɦɟɬɪ
G
ɑɚɫɬɨɬɚ
ɇɢɠɧɹɹ
ɝɪɚɧɢɰɚ
ɤɪɢɬɟɪɢɹ 1
G
1 ɆȽɰ
C
ȼɟɪɯɧɹɹ ɝɪɚɧɢɰɚ
ɤɪɢɬɟɪɢɹ 1
Ɂɧɚɱɟɧɢɟ
ɤɪɢɬɟɪɢɹ 2
Ɂɧɚɱɟɧɢɟ
ɧɨɪɦɵ
ɤɪɢɬɟɪɢɹ 2
9,688
> 7,750
0,063
> 0,041
17,04
> 13,85
2,387
> 1,505
0,869
1 ɤȽɰ
C
Ɂɧɚɱɟɧɢɟ
ɤɪɢɬɟɪɢɹ 1
0,898
0,695
0.785
0,900
0,727
Ɂɧɚɱɟɧɢɹ ɫɬɚɬɢɫɬɢɱɟɫɤɢɯ ɨɰɟɧɨɤ ɩɨɝɪɟɲɧɨɫɬɢ ɨɩɪɟɞɟɥɟɧɢɹ ɤɨɷɮɮɢɰɢɟɧɬɚ
ɩɪɢ ɞɨɜɟɪɢɬɟɥɶɧɨɣ ɜɟɪɨɹɬɧɨɫɬɢ Ɋ = 0,95
ɉɚɪɚɦɟɬɪ
K (Z )
K (Z )
Ɍɚɛɥɢɰɚ 2
ɱɟɪɟɧɤɨɜ
Ʉɚɱɟɫɬɜɨ
ɱɟɪɟɧɤɚ
(ɫɨɪɬ)
Ʉɨɥɢɱɟɫɬɜɨ
ɱɟɪɟɧɤɨɜ
Ɇɚɬ.
ɨɠɢɞɚɧɢɟ
ɋɪɟɞɧɟɟ
ɤɜɚɞɪɚɬɢɱ.
ɨɬɤɥɨɧɟɧɢɟ ɦɚɬ.
ɨɠɢɞ.
ɇɢɠɧɹɹ
ɝɪɚɧɢɰɚ
ɞɨɜɟɪɢɬ.
ɢɧɬɟɪɜɚɥɚ
ȼɟɪɯɧɹɹ
ɝɪɚɧɢɰɚ
ɞɨɜɟɪɢɬ.
ɢɧɬɟɪɜɚɥɚ
1
41
7,06
0,20
6,86
7,26
2
38
6,81
0,22
6,59
7,03
3
5
6,40
0,52
5,88
6,92
ɇɟɭɤɨɪɟɧ.
10
5,85
0,10
5,75
5,95
ɇɢɡɤɭɸ ɧɚɞɺɠɧɨɫɬɶ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɱɟɪɟɧɤɨɜ 3-ɝɨ ɫɨɪɬɚ ɦɨɠɧɨ ɨɛɴɹɫɧɢɬɶ ɦɚɥɵɦ ɨɛɴɺɦɨɦ
ɜɵɛɨɪɤɢ (5 ɲɬɭɤ), ɩɨɝɪɟɲɧɨɫɬɶɸ ɷɤɫɩɟɪɬɧɨɣ ɨɰɟɧɤɢ ɢ ɛɨɥɶɲɨɣ ɜɟɥɢɱɢɧɨɣ ɢɧɫɬɪɭɦɟɧɬɚɥɶɧɨɣ
ɫɨɫɬɚɜɥɹɸɳɟɣ ɩɨɝɪɟɲɧɨɫɬɢ ɢɡɦɟɪɟɧɢɹ ɤɨɷɮɮɢɰɢɟɧɬɚ K (Z ) .
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
Ⱥɥɚɞɢɧɚ Ɉ.ɇ. Ɉɩɬɢɦɢɡɚɰɢɹ ɬɟɯɧɨɥɨɝɢɢ ɡɟɥɺɧɨɝɨ ɱɟɪɟɧɤɨɜɚɧɢɹ ɫɚɞɨɜɵɯ ɪɚɫɬɟɧɢɣ // ɂɡɜɟɫɬɢɹ ɌɋɏȺ. –
ȼɵɩ. 4. – 2013. – ɋ. 5–22.
ɋɨɥɨɜɶɟɜɚ Ⱥ.ȿ. ɇɚɭɱɧɵɟ ɨɫɧɨɜɵ ɩɢɬɨɦɧɢɤɨɜɨɞɫɬɜɚ ɹɝɨɞɧɵɯ ɤɭɥɶɬɭɪ / Ɋɨɫɫɟɥɶɯɨɡɚɤɚɞɟɦɢɹ. ɋɢɛ. ɨɬɞɧɢɟ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2008. – 280 ɫ.
Ɇɟɞɜɟɞɟɜ ɋ.ɋ. ɗɥɟɤɬpɨɮɢɡɢɨɥɨɝɢɹ pɚɫɬɟɧɢɣ: ɭɱɟɛɧɨɟ ɩɨɫɨɛɢɟ. – ɋɉɛ.: ɂɡɞ-ɜɨ ɋ.-ɉɟɬɟɪɛɭɪɝɫɤɨɝɨ ɭɧɢɜɟɪɫɢɬɟɬɚ, 1997. – 122 ɫ.
Ⱥɥɟɣɧɢɤɨɜ Ⱥ.Ɏ., Ɉɫɟɧɧɢɣ Ⱥ.ɋ. Ɉɰɟɧɤɚ ɢɧɬɟɝɪɚɥɶɧɨɝɨ ɮɭɧɤɰɢɨɧɚɥɶɧɨɝɨ ɫɨɫɬɨɹɧɢɹ ɨɪɝɚɧɢɡɦɚ ɩɨ ɩɨɤɚɡɚɬɟɥɹɦ ɷɥɟɤɬɪɢɱɟɫɤɨɣ ɩɨɥɹɪɢɡɭɟɦɨɫɬɢ ɬɤɚɧɢ: ɦɟɬɨɞ. ɪɟɤɨɦ. / Ɋɨɫ.ɚɤɚɞ. ɫ.-ɯ. ɧɚɭɤ, ɋɢɛ. ɨɬɞ-ɧɢɟ, ɋɢɛ.
ɮɢɡ. – ɬɟɯɧ. ɢɧ-ɬ ɚɝɪɚɪ. ɩɪɨɛɥ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1993.– 40 ɫ.
Ⱥɥɟɣɧɢɤɨɜ Ⱥ.Ɏ., Ɇɢɧɟɟɜ ȼ.ȼ. ɉɪɢɦɟɧɟɧɢɟ ɦɟɬɨɞɨɜ ɷɥɟɤɬɪɨɩɪɨɜɨɞɧɨɫɬɢ ɜ ɩɪɨɰɟɫɫɟ ɜɟɝɟɬɚɰɢɢ ɩɥɨɞɨɜɨ-ɹɝɨɞɧɵɯ ɤɭɥɶɬɭɪ// ɇɚɭɱɧɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢɧɧɨɜɚɰɢɨɧɧɨɝɨ ɪɚɡɜɢɬɢɹ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ ɢ Ɋɟɫɩɭɛɥɢɤɢ
Ⱥɥɬɚɣ: ɦɚɬɟɪɢɚɥɵ ɝɨɞɢɱɧɨɝɨ ɨɛɳɟɝɨ ɫɨɛɪɚɧɢɹ ɢ ɧɚɭɱɧɨɣ ɫɟɫɫɢɢ Ƚɇɍ ɋɈ Ɋɨɫɫɟɥɶɯɨɡɚɤɚɞɟɦɢɢ (26–27
ɹɧɜɚɪɹ 2011 ɝ.).– ɇɨɜɨɫɢɛɢɪɫɤ, 2011.– ɋ. 289–296.
Ⱥɥɟɣɧɢɤɨɜ Ⱥ.Ɏ., ɉɚɥɶɱɢɤɨɜɚ ɂ.Ƚ., ɑɭɝɭɣ ɘ.ȼ. Ɉɛɨɫɧɨɜɚɧɢɟ ɷɤɫɩɪɟɫɫ-ɦɟɬɨɞɚ ɨɰɟɧɤɢ ɫɜɟɠɟɫɬɢ ɦɹɫɧɨɝɨ
ɫɵɪɶɹ// ɋɢɛ. ɜɟɫɬ. ɫ.-ɯ. ɧɚɭɤɢ.– 2012.– ʋ5.– ɋ.83–90.
Ⱥɥɟɣɧɢɤɨɜ Ⱥ.Ɏ., ɉɚɥɶɱɢɤɨɜɚ ɂ.Ƚ., Ƚɥɹɧɟɧɤɨ ȼ.ɋ., ɑɭɝɭɣ ɘ.ȼ. ɗɤɫɩɪɟɫɫ-ɦɟɬɨɞ ɨɰɟɧɤɢ ɤɚɱɟɫɬɜɚ ɦɹɫɚ//
ɋɢɛ.ɜɟɫɬ.ɫ.-ɯ. ɧɚɭɤɢ.– 2013.– ʋ 6.– ɋ.71–79.
Ɍɚɪɭɫɨɜ Ȼ.ɇ. ɢ ɞɪ. Ȼɢɨɮɢɡɢɤɚ. – Ɇ.: ȼɵɫɲɚɹ ɲɤɨɥɚ, 1986. – 468 ɫ.
Ⱥɥɟɣɧɢɤɨɜ Ⱥ.Ɏ., Ƚɨɥɵɲɟɜ Ⱦ.ɇ., Ƚɚɛɢɬɨɜ ɇ.Ɇ., Ⱦɭɞɤɢɧ Ⱥ.Ʌ., Ɇɚɬɚɫɨɜɚ ɘ.Ⱥ., ɉɨɬɚɧɢɧ ȼ.Ƚ., ɑɟɲɤɨɜɚ
Ⱥ.Ɏ./ɉɪɨɛɥɟɦɵ ɢɧɮɨɪɦɚɬɢɡɚɰɢɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɧɚɭɤɢ ɋɢɛɢɪɢ: ɉɨɞ ɨɛɳɟɣ ɪɟɞɚɤɰɢɟɣ ɩɪɨɮɟɫɫɨɪɚ Ⱥ.Ɏ. Ⱥɥɟɣɧɢɤɨɜɚ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2005.–286 ɫ.
ȽɈɋɌ 8.207–76.Ƚɋɂ. ɉɪɹɦɵɟ ɢɡɦɟɪɟɧɢɹ ɫ ɦɧɨɝɨɤɪɚɬɧɵɦɢ ɧɚɛɥɸɞɟɧɢɹɦɢ. Ɇɟɬɨɞɵ ɨɛɪɚɛɨɬɤɢ ɪɟɡɭɥɶɬɚɬɨɜ ɧɚɛɥɸɞɟɧɢɣ.– Ɇ.:ɂɉɄ ɂɡɞ-ɜɨ ɫɬɚɧɞɚɪɬɨɜ, 2001.–7 ɫ.
309
ɊȺɁɊȺȻɈɌɄȺ ɆȺɌȿɆȺɌɂɑȿɋɄɈɃ ɆɈȾȿɅɂ ɈɉɌɂɆɂɁȺɐɂɂ
ɆȺɒɂɇ ȾɅə ɉɊɂȽɈɌɈȼɅȿɇɂə ɄɈɊɆɈȼ
ɇəɆɐɗɊɗɇ. Ƚ., ȻȺɌɆɍɇɏ. Ȼ., ȽȺɇȻȺɌ. Ȼ.
Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ ɇɚɭɤɢ ɢ Ɍɟɯɧɨɥɨɝɢɣ
Ɇɨɧɝɨɥɶɫɤɢɣ Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ Ⱥɝɪɚɪɧɵɣ ɍɧɢɜɟɪɫɢɬɟɬ
ɍɥɚɚɧɛɚɚɬɚɪ, Ɇɨɧɝɨɥɢɹ, e-mail: ganbat@muls.edu.mn
ɂɡɜɟɫɬɧɵ ɪɚɛɨɬɵ ɩɨ ɨɩɬɢɦɢɡɚɰɢɢ ɨɛɨɪɭɞɨɜɚɧɢɹ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ ɧɚ ɮɟɪɦɚɯ ɄɊɋ.
ɇɚɩɪɢɦɟɪ, ɜ ɪɚɛɨɬɟ ȼ.ɋ. əɤɨɜɥɟɜɚ ɜɤɥɸɱɟɧɵ ɬɚɤɢɟ ɩɨɤɚɡɚɬɟɥɢ, ɤɚɤ ɤɨɷɮɮɢɰɢɟɧɬ ɝɨɬɨɜɧɨɫɬɢ, ɞɟɮɢɰɢɬ ɬɪɭɞɨɜɵɯ ɪɟɫɭɪɫɨɜ, ɭɳɟɪɛ ɨɬ ɩɪɨɫɬɨɟɜ ɦɚɲɢɧ ɢ ɫɨɜɨɤɭɩɧɵɟ ɡɚɬɪɚɬɵ.ȼ ɪɚɛɨɬɟ ȼ.ɂ. Ɂɟɦɫɤɨɜɚ
ɜɤɥɸɱɟɧ ɤɨɷɮɮɢɰɢɟɧɬ ɧɚɞɟɠɧɨɫɬɢ ɢ ɩɨɤɚɡɚɬɟɥɶ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɹ ɤɨɪɦɨɰɟɯɨɜ.
Ɇ. Ʌ. ɉɨɪɬɦɚɧ ɪɚɫɫɱɢɬɚɥ ɡɚɬɪɚɬɵ ɩɨ ɫɬɚɛɢɥɶɧɨɫɬɢ, Ⱥ.Ⱥ. ɍɯɚɧɟɜɵɦ ɩɪɨɜɟɞɟɧ ɪɚɫɱɟɬ ɩɨ ɨɩɬɢɦɢɡɚɰɢɢ ɩɨɤɚɡɚɬɟɥɟɣ ɤɚɱɟɫɬɜɚ ɤɨɪɦɨɜ ɢ ɬ.ɞ.
Ɉɞɧɚɤɨ ɛɨɥɶɲɢɧɫɬɜɨ ɢɡ ɧɢɯ ɛɵɥɨ ɩɨɫɜɹɳɟɧɨ ɨɛɨɫɧɨɜɚɧɢɸ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɞɥɹ ɭɡɤɨɝɨ ɤɪɭɝɚ
ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɢ ɬɟɯɧɢɱɟɫɤɢɯ ɪɟɲɟɧɢɣ.
ɇɚ ɮɟɪɦɚɯ ɫɟɣɱɚɫ ɩɪɢɦɟɧɹɸɬ ɪɚɡɥɢɱɧɵɟ ɬɟɯɧɨɥɨɝɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ, ɨɛɭɫɥɨɜɥɟɧɧɵɟ
ɬɢɩɨɦ ɤɨɪɦɥɟɧɢɹ ɠɢɜɨɬɧɵɯ, ɪɚɰɢɨɧɨɜ ɤɨɪɦɨɜ, ɬɢɩɚɦɢ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɩɨɫɬɪɨɟɤ ɢ ɯɪɚɧɢɥɢɳ,
ɪɚɡɦɟɪɦɢ ɮɟɪɦ, ɪɚɡɥɢɱɧɵɟ ɦɚɲɢɧɵ ɢ ɨɛɨɪɭɞɨɜɚɧɢɹ.
Ɍɪɟɛɭɟɬɫɹ ɜɵɛɪɚɬɶ ɬɚɤɨɣ ɤɨɦɩɥɟɤɬ ɦɚɲɢɧ, ɤɨɬɨɪɵɣ ɛɵ ɜɵɩɨɥɧɹɥ ɜɟɫɶ ɡɚɞɚɧɧɵɣ ɨɛɴɟɦ ɪɚɛɨɬ
ɩɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɥɢɧɢɹɦ ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɡɨɨɬɟɯɧɢɱɟɫɤɢɦɢ, ɛɢɨɥɨɝɢɱɟɫɤɢɦɢ, ɮɢɡɢɨɥɨɝɢɱɟɫɤɢɦɢ ɢ ɨɪɝɚɧɢɡɚɰɢɨɧɧɵɦɢ ɬɪɟɛɨɜɚɧɢɹɦɢ ɜ ɭɫɬɚɧɨɜɥɟɧɧɨɟ ɜɪɟɦɹ ɩɪɢ ɦɢɧɢɦɚɥɶɧɵɯ ɫɨɜɨɤɭɩɧɵɯ
ɡɚɬɪɚɬɚɯ ɫɪɟɞɫɬɜ ɢ ɩɪɢ ɨɩɪɟɞɟɥɟɧɧɵɯ ɨɪɝɚɧɢɱɟɧɢɹɯ ɩɨ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɨɣ ɧɚɞɟɠɧɨɫɬɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɥɢɧɢɣ.
ɉɨɤɚɡɚɬɟɥɶ ɤɪɢɬɟɪɢɹ ɢ ɜɥɢɹɸɳɢɯ ɮɚɤɬɨɪɨɜ ɞɥɹ ɨɰɟɧɤɢ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɩɨ ɩɪɢɝɨɬɨɜɥɟɧɢɸ ɤɨɪɦɨɜ ɞɨɥɠɟɧ ɭɱɢɬɵɜɚɬɶ ɰɟɥɶ ɪɚɛɨɬɵ ɫ ɭɱɟɬɨɦ ɫɩɟɰɢɮɢɱɟɫɤɢɯ
ɭɫɥɨɜɢɣ ɫɬɪɚɧɵ.
ɉɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɤɨɪɦɨɰɟɯɚ ɜ ɡɧɚɱɢɬɟɥɶɧɨɣ ɦɟɪɟ ɨɩɪɟɞɟɥɹɟɬ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɜɫɟɣ ɩɨɬɨɱɧɨɣ ɥɢɧɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ. ɉɨɷɬɨɦɭ ɱɬɨɛɵ ɜɵɛɪɚɬɶ ɨɩɬɢɦɚɥɶɧɵɟ ɤɨɦɩɥɟɤɬɵ ɦɚɲɢɧ, ɧɟɨɛɯɨɞɢɦɨ ɭɱɢɬɵɜɚɬɶ ɫɩɨɫɨɛɵ ɩɨɝɪɭɡɤɢ, ɞɨɫɬɚɜɤɢ, ɩɪɢɟɦɚ, ɩɨɞɚɱɢ, ɡɚɝɪɭɡɤɢ, ɩɟɪɟɪɚɛɨɬɤɢ ɤɨɪɦɨɜ.
Ɉɛɨɪɭɞɨɜɚɧɢɹ ɤɨɪɦɨɰɟɯɚɦ ɪɚɛɨɬɚɟɬ ɫ ɩɟɪɟɪɵɜɚɦɢ ɪɚɡɥɢɱɧɨɣ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɬɟɯɧɨɥɨɝɢɢ ɢ ɨɩɟɪɚɰɢɢ ɜɟɞɭɳɟɣ ɦɚɲɢɧɵ, ɪɚɰɢɨɧɚ ɢ ɩɨɬɪɟɛɧɨɫɬɢ ɜ ɤɨɪɦɚɯ ɢ ɬɢɩɚ ɤɨɪɦɨɩɪɢɝɨɬɨɜɢɬɟɥɶɧɵɯ ɦɚɲɢɧ. ɉɨɷɬɨɦɭ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɤɚɠɞɨɣ ɦɚɲɢɧɵ ɜ ɨɛɳɟɦ ɫɥɭɱɚɟ ɧɟ
ɫɨɜɩɚɞɚɟɬ ɫ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶɸ ɞɪɭɝɢɯ ɦɚɲɢɧ. ȼ ɷɬɨɣ ɫɜɹɡɢ ɧɟɨɛɯɨɞɢɦɨ ɬɳɚɬɟɥɶɧɨ ɭɱɢɬɵɜɚɬɶ
ɜɫɟ ɬɟ ɩɨɤɚɡɚɬɟɥɢ, ɤɨɬɨɪɵɟ ɡɧɚɱɢɬɟɥɶɧɨ ɜɥɢɹɸɬ ɧɚ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɤɨɦɩɥɟɤɬɨɜɚɧɢɹ ɦɚɲɢɧ ɢ ɨɛɨɪɭɞɨɜɚɧɢɹ.
ɉɨɷɬɨɦɭ ɚɜɬɨɪ ɜɵɞɜɢɝɚɟɬ ɞɚɧɧɭɸ ɦɟɬɨɞɢɤɭ, ɤɨɬɨɪɚɹ ɭɱɢɬɵɜɚɟɬ ɪɚɡɥɢɱɧɵɟ ɬɟɯɧɨɥɨɝɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ, ɪɚɰɢɨɧ ɢ ɩɨɬɪɟɛɧɨɫɬɶ ɤɨɪɦɨɜ, ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɢ ɨɪɝɚɧɢɡɚɰɢɨɧɧɵɟ ɮɚɤɬɨɪɵ ɜ ɭɫɥɨɜɢɹɯ
Ɇɨɧɝɨɥɢɢ. Ɉɫɧɨɜɵ ɦɟɬɨɞɢɤɢ ɪɚɡɪɚɛɨɬɚɧɵ ɜ ɥɚɛɨɪɚɬɨɪɢɢ ɦɟɯɚɧɢɡɚɰɢɢ ɩɟɪɟɪɚɛɨɬɤɢ ɢ ɪɚɡɞɚɱɢ ɤɨɪɦɨɜ ɇɉɈ“Ʉɚɡɫɟɥɶɯɨɡɦɟɯɚɧɢɡɚɰɢɹ”.
Ɋɚɫɱɟɬɵ ɩɪɨɜɨɞɢɥɢɫɶ ɩɨ ɷɥɟɦɟɧɬɚɦ ɡɚɬɪɚɬ ɫ ɞɨɫɬɚɜɤɢ ɝɪɭɛɵɯ ɤɨɪɦɨɜ ɢ ɫɢɥɨɫɚ ɫ ɜɧɭɬɪɢɮɟɪɦɫɤɢɯ ɯɪɚɧɢɥɢɳ ɧɚ ɩɟɪɟɪɚɛɨɬɤɭ ɞɨ ɜɵɞɚɱɢ ɝɨɬɨɜɨɣ ɩɨɥɧɨɪɚɰɢɨɧɧɨɣ ɤɨɪɦɨɫɦɟɫɢ.
ɉɪɢɜɟɞɟɧɧɵɟ ɡɚɬɪɚɬɵ ɡɚ ɝɨɞ ɪɚɫɫɱɢɬɵɜɚɥɢɫɶ ɩɨ ɫɥɟɞɭɸɳɟɣ ɮɨɪɦɭɥɟ
ɉ
a ɋȾɌ
(1)
Ƚɞɟ: a -ɩɨɫɬɨɹɧɧɚɹ ɫɨɫɬɚɜɥɹɸɳɚɹ ɝɨɞɨɜɵɯ ɩɪɢɜɟɞɟɧɧɵɯ ɡɚɬɪɚɬ, ɜɤɥɸɱɚɸɳɚɹ ɜ ɫɟɛɹ ɚɦɨɪɬɢɡɚɰɢɨɧɧɵɟ ɨɬɱɢɫɥɟɧɢɹ ɧɚ ɦɚɲɢɧɵ ɢ ɧɨɪɦɚɬɢɜɧɭɸ ɷɮɮɟɤɬɢɜɧɨɫɬɶ.
ɋ –ɩɟɪɟɦɟɧɧɚɹ ɫɨɫɬɚɜɥɹɸɳɚɹ ɝɨɞɨɜɵɯ ɩɪɢɜɟɞɟɧɧɵɯ ɡɚɬɪɚɬ, ɩɪɢɯɨɞɹɳɚɹɫɹ ɧɚ ɨɞɢɧ ɱɚɫ ɪɚɛɨɬɵ
ɤɨɪɦɨɰɟɯɚ ɢ ɦɚɲɢɧɨɛɫɥɭɠɢɜɚɸɳɢɯ ɤɨɪɦɨɰɟɯ /ɡɚɬɪɚɬɵ ɧɚ ɬɟɤɭɲɢɣ ɪɟɦɨɧɬ ɢ ɬɟɯɨɛɫɥɭɠɢɜɚɧɢɟ,
ɷɥɟɤɬɪɨɷɧɟɪɝɢɸ, ɬɨɩɥɢɜɨ, ɨɩɥɚɬɭ ɬɪɭɞɚ ɢ ɜɫɩɨɦɨɝɚɬɟɥɶɧɵɯ ɦɚɬɟɪɢɚɥɨɜ/.
Ⱦ- ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɪɚɛɨɬɵ ɤɨɪɦɨɰɟɯɚ, ɫɭɬɨɤ ɜ ɝɨɞɭ.
Ɍ- ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɪɚɛɨɬɵ ɤɨɪɦɨɰɟɯɚ, ɱɚɫɨɜ ɜ ɫɭɬɤɢ
ɉɨɫɬɨɹɧɧɚɹ ɫɨɫɬɚɜɥɹɸɳɚɹ ɝɨɞɨɜɵɯ ɩɪɢɜɟɞɟɧɧɵɯ ɡɚɬɪɚɬ ɨɩɪɟɞɟɥɹɟɬɫɹ ɫɥɟɞɭɸɳɢɦ ɨɛɪɚɡɨɦ.
a
¦ K i a
M
Mi
ȾT
E ¦ KTi a Ti E THi
Ƚɞɟ: K Mi , KTi -ɛɚɥɚɧɫɨɜɚɹ ɫɬɨɢɦɨɫɬɶ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɦɚɲɢɧ ɢ ɬɪɚɤɬɨɪɨɜ
310
(2)
a Mi , a Ti -ɨɬɱɢɫɥɟɧɢɹ ɧɚ ɪɟɧɨɜɚɰɢɸ, ɤɚɩɢɬɚɥɶɧɵɣ ɪɟɦɨɧɬ, ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɦɚɲɢɧ ɢ ɬɪɚɤɬɨɪɨɜ
ɜ ɞɨɥɹɯ ɟɞɢɧɢɰɵ.
E –ɧɨɪɦɚɬɢɜɧɵɣ ɤɨɷɮɮɢɰɢɟɧɬ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɤɚɩɢɬɚɥɶɧɵɯ ɜɥɨɠɟɧɢɣ E 0.15
THi - ɧɨɪɦɚɬɢɜɧɚɹ ɝɨɞɨɜɚɹ ɧɚɝɪɭɡɤɚ ɧɚ ɬɪɚɤɬɨɪ, ɱ.
ɉɟɪɟɦɟɧɧɚɹ ɫɨɫɬɚɜɥɹɸɳɚɹ
ɪɚɫɫɱɢɬɵɜɚɟɬɫɹ ɩɨ ɮɨɪɦɭɥɟ.
k
C
ɐ
¦K
j 1
RMi
h
k
1
g ɐ ¦ɅKɑ
ɷTi RTiTH i ¦
T N Mi
ȾTi
j 1
j 1
Mi
h
k
¦
j
¦
j
j 1
i 1
1
2
(3)
Ƚɞɟ: K M , KT -ɤɚɩɢɬɚɥɶɧɵɟ ɜɥɨɠɟɧɢɹ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɜ ɦɚɲɢɧɵ ɢ ɬɪɚɤɬɨɪɚ.
RM , RT -ɨɬɱɢɫɥɟɧɢɹ ɧɚ ɬɟɤɭɳɢɣ ɪɟɦɨɧɬ, ɩɥɚɧɨɜɨɟ ɬɟɯɧɢɱɟɫɤɨɟ ɨɛɫɥɭɠɢɜɚɧɢɟ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ
ɦɚɲɢɧ ɢ ɬɪɚɤɬɨɪɨɜ ɜ ɞɨɥɹɯ ɟɞɢɧɢɰɵ.
N M - ɭɫɬɚɧɨɜɥɟɧɧɚɹ ɦɨɳɧɨɫɬɶ ɩɪɢɜɨɞɨɜ ɦɚɲɢɧ.
ɐ ɷ , ɐ T - ɨɬɩɭɫɤɧɨɣ ɬɚɪɢɮ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɨɞɧɨɝɨ ɤȼɬ-ɱ ɷɥɟɤɬɪɨɷɧɟɪɝɢɢ, ɨɞɧɨɝɨ ɤɝ ɤɨɦɩɥɟɤɫɧɨɝɨ ɝɨɪɸɱɟɝɨ
gi -ɱɚɫɨɜɨɣ ɪɚɫɯɨɞ ɤɨɦɩɥɟɤɫɧɨɝɨ ɝɨɪɸɱɟɝɨ j -ɝɨ ɬɪɚɤɬɨɪɚ, ɤɝ
Ʌ1 j , Ʌ 2 j -ɤɨɥɢɱɟɫɬɜɨ ɨɛɫɥɭɠɢɜɚɸɳɟɝɨ ɩɟɪɫɨɧɚɥɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ j-ɣ ɦɚɲɢɧ ɢ j-ɝɨ ɬɪɚɤɬɨɪɚ,
ɱɟɥ.
ɑ 1 j , ɑ 2 j -ɱɚɫɨɜɚɹɬɚɪɢɮɧɚɹ ɫɬɚɜɤɚ ɨɩɥɚɬɵ ɬɪɭɞɚ ɨɛɫɥɭɠɢɜɚɸɳɟɝɨ ɩɟɪɫɨɧɚɥɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ j-ɣ
ɦɚɲɢɧ ɢ j-ɝɨ ɬɪɚɤɬɨɪɚ ɩɪɢ ɜɵɩɨɥɧɟɧɢɢ ɪɚɛɨɬɵ ɫ ɭɱɟɬɨɦ ɧɚɞɛɚɜɨɤ ɡɚ ɫɬɚɠ, ɤɜɚɥɢɮɢɤɚɰɢɸ, ɞɨɩɥɚɬ
ɡɚ ɩɪɨɞɭɤɰɢɸ, ɨɩɥɚɬɵ ɨɬɩɭɫɤɨɜ.
ɇɨɜɚɹ ɦɟɬɨɞɥɨɝɢɹ ɪɚɫɱɟɬɚ ɬɟɯɧɢɤɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ ɪɚɫɫɦɚɬɪɢɜɚɥɢɫɶ ɞɜɚ ɜɚɪɢɚɧɬɚ ɩɨ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɢ ɩɨ ɫɨɫɬɚɜɭ ɤɨɪɦɨɩɪɢɝɨɬɨɜɢɬɟɥɶɧɵɯ ɦɚɲɢɧ.
ɉɟɪɜɵɣ-ɤɨɪɦɨɰɟɯ ɩɪɟɞɧɚɡɧɚɱɟɧɞɥɹ ɦɚɥɵɯ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ.
ȼɬɨɪɨɣ-ɤɨɪɦɨɰɟɯ ɩɪɟɞɧɚɡɧɚɱɟɧ ɞɥɹ ɤɪɭɩɧɵɯ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ.
ȼ ɷɬɢɯ ɜɚɪɢɚɧɬɚɯ ɪɚɫɱɟɬɚ ɩɨ ɤɨɦɩɥɟɤɬɨɜɚɧɢɸ ɦɚɲɢɧ ɩɪɟɞɭɫɦɨɬɪɟɧɵ ɫɚɦɵɟ ɫɨɜɪɟɦɟɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ, ɤɨɬɨɪɵɟ ɩɪɢɟɦɥɟɦɵ ɜ ɭɫɥɨɜɢɹɯ Ɇɨɧɝɨɥɢɢ. Ⱦɥɹ ɜɵɛɨɪɚ ɨɩɬɢɦɚɥɶɧɵɯ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɤɪɢɬɟɪɹɦɢ ɹɜɥɹɸɬɫɹ ɩɪɢɜɟɞɟɧɧɵɟ ɡɚɬɪɚɬɵ.
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɦɚɬɟɦɚɬɢɱɟɫɤɚɹ ɦɨɞɟɥɶ ɞɥɹ ɨɩɬɢɦɚɰɢɢ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɢɦɟɟɬ ɫɥɟɞɭɸɳɢɣ
ɜɢɞ. Ɉɩɬɢɦɚɥɶɧɵɟ ɩɚɪɚɦɟɬɪɵ ɤɨɪɦɨɰɟɯɨɜ ɧɚɯɨɞɢɥɢ, ɢɫɯɨɞɹ ɢɡ ɨɛɳɟɝɨ ɤɪɢɬɟɪɢɹ ɷɮɮɟɤɬɢɜɧɨɫɬɢ
ɫɢɫɬɟɦɵ ɤɨɪɦɨɰɟɯɨɜ, ɦɨɞɟɥɢɪɨɜɚɧɢɟɦ ɜɫɟɝɨ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ ɩɨ ɷɥɟɦɟɧɬɚɦ.
Ɋɚɫɱɟɬ ɫɢɫɬɟɦɵ ɛɭɞɟɦ ɩɪɨɜɨɞɢɬɶ ɧɚ ɞɜɭɯ ɜɡɚɢɦɨɞɟɣɫɬɜɭɸɳɢɯ ɭɪɨɜɧɹɯ:
ɇɚ ɩɟɪɜɨɦ-ɪɚɫɫɱɢɬɵɜɚɥɢ ɨɫɧɨɜɵɟ ɬɟɯɧɢɤɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɟ ɩɨɤɚɡɚɬɟɥɢ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɫ
ɭɜɹɡɤɨɣ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɹɦ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɨɩɟɪɚɰɢɢ ɢ ɨɫɧɨɜɧɵɦɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦɢ ɩɚɪɚɦɟɬɪɚɦɢ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ, ɤɚɤ ɟɦɤɨɫɬɶ ɩɢɬɚɸɳɢɯ ɢ ɞɨɡɢɪɭɸɳɢɯ ɛɭɧɤɟɪɨɜ, ɪɚɫɫɬɨɹɧɢɟ ɤɨɪɦɨɰɟɯɚ ɨɬ ɩɨɦɟɳɟɧɢɹ ɞɥɹ ɠɢɜɨɬɧɵɯ ɢ ɪɚɛɨɱɚɹ ɫɤɨɪɨɫɬɶ ɦɨɛɢɥɶɧɵɯ ɦɚɲɢɧ ɢ ɬ.ɞ.
Ɋɟɡɭɥɶɬɚɬɵ ɪɚɫɱɟɬɨɜ ɩɟɪɜɨɝɨ ɭɪɨɜɧɹ ɫɥɭɠɚɬ ɢɫɯɨɞɧɵɦɢ ɞɚɧɧɵɦɢ ɞɥɹ ɪɟɲɟɧɢɹ ɡɚɞɚɱɢ ɜɬɨɪɨɝɨ
ɭɪɨɜɧɹ.
ɋɤɚɡɚɧɧɨɟ ɩɨɡɜɨɥɹɟɬ ɫɮɨɪɦɭɥɢɪɨɜɚɬɶ ɦɚɬɟɦɚɬɢɱɟɫɤɢɟ ɦɨɞɟɥɢ ɡɚɞɚɱɢ. ɇɚ ɩɟɪɜɨɦ ɭɪɨɜɧɟ ɞɥɹ
ɨɩɪɟɞɟɥɟɧɢɹ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɰɟɥɟɜɚɹ ɮɭɧɤɰɢɹ ɢɦɟɟɬ ɜɢɞ
ɉ
¦¦¦ X ɉ Q , G, T , r , L,u ,V , m, R ije
t
(4)
ɇɚ ɜɬɨɪɨɦ ɭɪɨɜɧɟ ɮɭɧɤɰɢɹ ɨɩɬɢɦɢɡɚɰɢɢ
ɉ
m
n
k
¦¦¦ X
ije
ɉije
X ije a ije Cije ȾT o min
(5)
Ɇɢɧɢɦɭɦ ɩɪɢɜɟɞɟɧɧɵɯ ɡɚɬɪɚɬ ɩɨɥɭɱɢɦ ɩɪɢ ɫɥɟɞɭɸɳɢɯ ɭɫɥɨɜɢɹɯ: ɜɜɟɞɟɦ ɨɝɪɚɧɢɱɟɧɢɹ ɩɨ ɨɛɴɟɦɭ ɪɚɛɨɬ
i 1 j 1 e 1
ɉ
m
n
k
¦ ¦ ¦ QijeTije X ije t
i 1
k
j 1 e 1
m
n
¦¦¦ X
e 1 i 1
j 1
eij
1i
k
m
¦ ¦V
ei
e 1 i 1
1, 2.......m
(6)
(7)
Ɉɪɝɚɧɢɱɟɧɢɟ ɩɨ ɫɨɝɥɚɫɨɜɚɧɧɨɫɬɢ ɜɵɩɨɥɧɟɧɢɹ oɩɟɪɚɰɢɢ ɜ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɥɢɧɢɹɯ ɩɨ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ
311
k
m
n
¦¦¦Q
eij
e 1
i
1
j
X eij d Q( i 1) ej X ( i 1) ej
1
(8)
Ƚɞɟ: m-ɤɨɥɢɱɟɫɬɜɨ ɨɩɟɪɚɰɢɢ ɜ e-ɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ.
ɤ- ɤɨɥɢɱɟɫɬɜɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ.
n -ɤɨɥɢɱɟɫɬɜɨ ɬɢɩɥɜ ɦɚɲɢɧ, ɩɪɟɞɧɚɡɧɚɱɟɧɧɵɯ ɞɥɹ ɜɵɩɨɥɧɟɧɢɹ ɜ i-ɨɣ oɩɟɪɚɰɢɢ ɜ ɟ-ɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ.
ɉeij-ɩɪɢɜɟɞɟɧɧɵɟ ɡɚɬɪɚɬɵ ɩɨ j-ɨɣ ɦɚɲɢɧɟ ɩɪɢ ɜɵɩɨɥɧɟɧɢɢ i-ɨɣ ɨɩɟɪɚɰɢɢ ɜ ɟ-ɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ.
Xeij- ɤɨɥɢɱɟɫɬɜɨ j-ɣ ɦɚɲɢɧ ɞɥɹ ɜɵɩɨɥɧɟɧɢɹ ɪɚɛɨɬ ɩɨ i-ɣ ɨɩɟɪɚɰɢɢ ɜ ɟ-ɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ.
Vei- ɨɛɴɟɦ ɪɚɛɨɬ i-ɣ ɨɩɟɪɚɰɢɢ ɜ ɟ-ɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ.
Teij – ɫɭɦɦɚɪɧɵɣ ɫɭɬɨɱɧɵɣ ɮɨɧɞ ɜɪɟɦɟɧɢ ɧɚ ɜɵɩɨɥɧɟɧɢɟ i-ɣ ɨɩɟɪɚɰɢɢ.
Qeij –ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ j-ɣ ɦɚɲɢɧɵ ɡɚ ɨɞɢɧ ɱɚɫ ɱɢɫɬɨɝɨ ɜɪɟɦɟɧɢ.
G –ɩɨɬɪɟɛɧɨɫɬɶ ɜ ɤɨɪɦɚɯ.
T – ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɶ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ.
r - ɩɥɨɬɧɨɫɬɶ ɤɨɪɦɨɜ.
T – ɬɢɩɚ ɨɫɧɨɜɵɯ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɥɢɧɢɢ.
L – ɪɚɫɫɬɨɹɧɢɟ ɤɨɪɦɨɰɟɯɚ ɨɬ ɩɨɦɟɳɟɧɢɹ ɞɥɹ ɠɢɜɨɬɧɵɯ.
u - ɪɚɛɨɱɚɹ ɫɤɨɪɨɫɬɶ ɦɨɛɢɥɶɧɵɯ ɦɚɲɢɧ.
g -ɤɨɷɮɮɢɰɢɟɧɬ ɡɚɝɪɭɡɤɢ ɩɪɢɰɟɩɚ.
V -ɟɦɤɨɫɬɶ ɛɭɧɤɟɪɨɜ.
m - ɤɨɥɢɱɟɫɬɜɨ ɠɢɜɨɬɧɵɯ.
R-ɤɪɚɬɧɨɫɬɶ ɤɨɪɦɥɟɧɢɹ.
Ɍɟɯɧɢɱɟɫɤɢɟ ɫɪɟɞɫɬɜɚ ɦɟɯɚɧɢɡɚɰɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ ɩɨɞɛɢɪɚɥɢɫɶ ɬɚɤ, ɱɬɨɛɵ ɨɧɢ, ɜɨ-ɩɟɪɜɵɯ, ɨɛɟɫɩɟɱɢɜɚɥɢ ɧɟɨɛɯɨɞɢɦɭɸ ɞɥɹ ɞɚɧɧɨɝɨ ɬɢɩɨɪɚɡɦɟɪɚ ɮɟɪɦɵ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɥɢɧɢɢ ɢ,
ɜɨ-ɜɬɨɪɵɯ, ɜ ɥɸɛɨɣ ɤɨɦɛɢɧɚɰɢɢ ɡɚɜɟɞɨɦɨ ɭɞɨɜɥɟɬɜɨɪɹɥɢ ɭɫɥɨɜɢɹɦ ɫɨɝɥɚɫɨɜɚɧɧɨɫɬɢ ɩɨ ɩɪɨɢɡɜɨɞɢɬɟɶɧɨɫɬɢ. ȼ ɤɚɱɟɫɬɜɟ ɬɟɯɧɢɤɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɛɵɥɢ ɩɪɢɧɹɬɵ ɩɪɢɜɟɞɟɧɧɵɟ ɡɚɬɪɚɬɵ,
ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɵɟ ɡɚɬɪɚɬɵ ɢ ɡɚɬɪɚɬɵ ɬɪɭɞɚ.
ȼɕȼɈȾɕ
ɇɚ ɨɫɧɨɜɚɧɢɢ ɬɟɨɪɟɬɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɦɨɠɧɨ ɫɞɟɥɚɬɶ ɫɥɟɞɭɸɳɢɟ ɜɵɜɨɞɵ:
Ⱦɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɨɩɬɢɦɚɥɶɧɨɣ ɫɢɫɬɟɦɵ ɦɚɲɢɧ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ ɢɫɩɨɥɶɡɨɜɚɧ ɫɢɫɬɟɦɧɵɣ ɚɧɚɥɢɡ, ɜ ɤɨɬɨɪɨɦ ɭɱɬɟɧɵ ɨɫɧɨɜɧɵɟ ɮɚɤɬɨɪɵ, ɜɥɢɹɸɳɢɟ ɧɚ ɩɪɨɰɟɫɫ, ɢ ɪɚɡɪɚɛɨɬɚɧɵ ɦɨɞɟɥɢ
ɩɚɪɚɦɟɬɪɢɱɟɫɤɢɟ ɫɯɟɦɵ ɩɪɨɰɟɫɫɚ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɩɨɥɧɨɪɚɰɢɨɧɧɵɯ ɤɨɪɦɨɜɵɯ ɫɦɟɫɟɣ.
ɉɪɟɞɥɨɠɟɧɚ ɦɚɬɟɦɚɬɢɱɟɫɤɚɹ ɦɨɞɟɥɶ ɢ ɨɩɬɢɦɚɰɢɢ ɫɢɫɬɟɦɵ ɦɚɲɢɧ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ:
ɩɪɢɜɟɞɟɧɧɵɦ ɡɚɬɪɚɬɚɦ ɢ ɪɹɞɨɦ ɨɪɝɚɧɢɱɟɧɢɣ.
Ɋɚɡɪɚɛɨɬɚɧɚ ɦɟɬɨɞɢɤɚ ɞɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɨɰɟɧɤɢ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɫɢɫɬɟɦɵ ɦɚɲɢɧ,
ɜɤɥɸɱɚɸɳɚɹ ɬɟɯɧɨɥɨɝɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ, ɫɬɪɭɤɬɭɪɵ ɪɚɰɢɨɧɨɜ ɢ ɭɜɹɡɤɢ ɦɚɲɢɧ ɩɨ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
312
Ⱥɯɦɟɞɨɜ. Ⱥ.ɇ. “Ɋɚɡɪɚɛɨɬɤɚ ɢ ɢɫɫɥɟɞɨɜɚɧɢɟ ɦɟɬɨɞɚ ɨɩɬɢɦɢɡɚɰɢɢ ɫɬɪɭɤɬɭɪɵ ɦɚɲɢɧ ɢ ɨɛɨɪɭɞɨɜɚɧɢɹ ɞɥɹ
ɤɨɦɩɥɟɤɫɧɨɣ ɦɟɯɚɧɢɡɚɰɢɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɢɯ ɮɟɪɦ ɜ ɭɫɥɨɜɢɹɯ Ⱥɡ.ɋɋɊ”. Ⱦɢɫɫ ɧɚ ɫɨɢɫɤ. ɍɱɟɧ.ɫɬɟɩɟɧɢ
ɤɚɧɞ. ɬɟɯɧ.ɧɚɭɤ-Ʉɢɪɨɜɨɛɚɞ. 1980 ɝ.
Ƚɨɥɢɤɨɜ.ȼ.Ⱥ. “Ɉɛɨɫɧɨɜɚɧɢɟ ɫɬɪɭɤɬɭɪ ɢ ɩɚɪɚɦɟɬɪɨɜ ɩɨɬɨɱɧɵɯ ɥɢɧɢɣ ɞɥɹ ɩɟɪɟɪɚɛɨɬɤɚ ɝɪɭɛɵɯ ɤɨɪɦɨɜ ɜ
ɩɪɨɦɵɲɥɟɧɧɨɦ ɨɜɰɟɜɨɞɫɬɜɟ” Ⱦɢɫɫ. ɧɚ ɫɨɢɫɤ. ɍɱɟɧ.ɫɬɟɩɟɧɢ ɞɨɤɬɨɪ ɬɟɯɧ.ɧɚɭɤ. Ⱥɥɦɚ-Ⱥɬɚ 1983 ɝ.
Ⱦɨɰɟɧɤɨ.ɋ.Ɇ. «ɉɨɜɵɲɟɧɢɟ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɨɬɨɱɧɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɥɢɧɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɢ ɪɚɡɞɚɱɢ
ɤɨɪɦɨɜ». Ɍɟɯɧ.ɜ.ɫ.ɯ.1985.ʋ8.ɫ.41–43
Ɂɚɜɪɚɠɧɨɜ.Ⱥ.ɂ. «Ɍɟɯɧɨɥɨɝɢɱɟɫɤɨɟ ɩɪɨɟɤɬɢɪɨɜɚɧɢɟ ɮɟɪɦ ɢ ɤɨɦɩɥɟɫɨɜ». Ⱥɥɦɚ-Ⱥɬɚ. Ʉɚɣɧɚɪ. 1980 ɝ.
ɫ 22–252
ɇɹɦɰɷɪɷɧ. Ƚ. «Ɉɛɨɫɧɨɜɚɧɢɟ ɨɩɬɢɦɚɥɶɧɵɯ ɤɨɦɩɥɟɤɬɨɜ ɦɚɲɢɧ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɤɨɪɦɨɜ ɧɚ ɦɨɥɨɱɧɵɯ
ɮɟɪɦɚɯ Ɇɨɧɝɨɥɢɢ». –Ⱦɢɫɫ. ɧɚ ɫɨɢɫɤ. ɍɱɟɧ. ɫɬɟɩɟɧɢ ɤɚɧɞ. ɬɟɯɧ.ɧɚɭɤ. Ⱥɥɦɚ-Ⱥɬɚ. 1992 ɝ.
ɍȾɄ 631.3:681.2.08
ɊȺɁȼɂɌɂȿ ɂɇɎɈɊɆȺɐɂɈɇɇɈɃ ɌȿɏɇɈɅɈȽɂɂ
ȾɂȺȽɇɈɋɌɂɊɈȼȺɇɂə ɌɊȺɄɌɈɊɇɕɏ ȾȼɂȽȺɌȿɅȿɃ
ɇȺ ɈɋɇɈȼȿ ɂɁɆȿɊɂɌȿɅɖɇɕɏ ɗɄɋɉȿɊɌɇɕɏ ɋɂɋɌȿɆ
ɋȺȼɑȿɇɄɈ Ɉ.Ɏ., ȾɈȻɊɈɅɘȻɈȼ ɂ.ɉ.,
ɎȽȻɇɍ ɋɢɛɢɪɫɤɢɣ ɮɢɡɢɤɨ-ɬɟɯɧɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ ɚɝɪɚɪɧɵɯ ɩɪɨɛɥɟɦ,
ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ. ɟ-mail: sof-oleg46@yandex.ru
ɉɪɨɢɡɜɨɞɫɬɜɨ ɤɨɧɤɭɪɟɧɬɨɫɩɨɫɨɛɧɨɣ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɛɚɡɢɪɭɟɬɫɹ ɧɚ ɷɮɮɟɤɬɢɜɧɨɦ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɬɟɯɧɢɤɢ, ɨɛɟɫɩɟɱɟɧɢɢ ɜɵɫɨɤɨɣ ɫɬɟɩɟɧɢ ɟɟ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ. Ɋɟɚɥɢɡɚɰɢɹ
ɠɟ ɩɨɬɟɧɰɢɚɥɶɧɵɯ ɜɨɡɦɨɠɧɨɫɬɟɣ ɦɚɲɢɧ ɢ ɦɟɯɚɧɢɡɦɨɜ ɫɞɟɪɠɢɜɚɟɬɫɹ ɧɟɫɨɨɬɜɟɬɫɬɜɢɟɦ ɬɪɟɛɭɟɦɨɦɭ ɭɪɨɜɧɸ ɫɢɫɬɟɦɵ ɬɟɯɧɢɱɟɫɤɨɝɨ ɨɛɫɥɭɠɢɜɚɧɢɹ ɜ ɱɚɫɬɢ ɨɛɟɫɩɟɱɟɧɢɹ ɜɚɠɧɟɣɲɢɯ ɩɨɤɚɡɚɬɟɥɟɣ
ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ. Ɂɧɚɱɟɧɢɟ ɫɪɟɞɧɟɝɨɞɨɜɨɝɨ ɤɨɷɮɮɢɰɢɟɧɬɚ ɬɟɯɧɢɱɟɫɤɨɣ ɝɨɬɨɜɧɨɫɬɢ ɦɚɲɢɧɧɨɬɪɚɤɬɨɪɧɨɝɨ ɩɚɪɤɚ ɜ ɪɟɝɢɨɧɚɯ ɋɢɛɢɪɢ ɩɨ ɦɧɨɝɨɥɟɬɧɢɦ ɞɚɧɧɵɦ ɋɢɛɂɆɗ ɫɨɫɬɚɜɥɹɟɬ ɜɫɟɝɨ ɥɢɲɶ
0,6–0,7 [1, 2].
ȼ ɫɥɨɠɢɜɲɟɣɫɹ ɫɢɬɭɚɰɢɢ ɫɭɳɟɫɬɜɟɧɧɨɟ ɡɧɚɱɟɧɢɟ ɩɪɢɨɛɪɟɬɚɟɬ ɨɛɟɫɩɟɱɟɧɢɟ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɬɟɯɧɢɤɢ ɡɚ ɫɱɟɬ ɨɛɨɫɧɨɜɚɧɢɹ, ɪɚɡɪɚɛɨɬɤɢ ɢ ɜɧɟɞɪɟɧɢɹ ɜɵɫɨɤɨɢɧɮɨɪɦɚɬɢɜɧɵɯ ɨɩɟɪɚɬɢɜɧɵɯ ɫɪɟɞɫɬɜ ɨɩɪɟɞɟɥɟɧɢɹ (ɷɤɫɩɟɪɬɢɡɵ) ɟɟ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ. Ɉɞɢɧ ɢɡ ɦɟɬɨɞɨɜ ɪɟɲɟɧɢɹ ɡɚɞɚɱɢ ɨɛɟɫɩɟɱɟɧɢɹ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ ɦɨɛɢɥɶɧɨɣ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɬɟɯɧɢɤɢ,
ɚ ɨɫɨɛɟɧɧɨ ɟɝɨ ɧɚɢɛɨɥɟɟ ɫɥɨɠɧɨɣ ɢ ɧɚɭɤɨɺɦɤɨɣ ɫɨɫɬɚɜɥɹɸɳɟɣ – ɞɜɢɝɚɬɟɥɹ ɜɧɭɬɪɟɧɧɟɝɨ ɫɝɨɪɚɧɢɹ
(Ⱦȼɋ)– ɨɫɧɨɜɵɜɚɟɬɫɹ ɧɚ ɤɨɧɬɪɨɥɟ ɟɝɨ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɫ ɩɨɦɨɳɶɸ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɫɢɫɬɟɦ (ɂɂɋ) ɪɟɝɢɫɬɪɚɰɢɢ ɢ ɨɛɪɚɛɨɬɤɢ ɩɚɪɚɦɟɬɪɨɜ ɪɚɛɨɱɢɯ ɩɪɨɰɟɫɫɨɜ.
Ɉɩɵɬ ɪɚɡɪɚɛɨɬɤɢ ɢ ɩɪɢɦɟɧɟɧɢɹ ɬɚɤɨɝɨ ɦɟɬɨɞɚ ɜ ɋɢɛɎɌɂ [3] ɩɪɢɜɟɥ ɤ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɫɨɡɞɚɧɢɹ
ɛɨɥɟɟ ɫɨɜɟɪɲɟɧɧɨɣ ɢɡɦɟɪɢɬɟɥɶɧɨɣ ɷɤɫɩɟɪɬɧɨɣ ɫɢɫɬɟɦɵ (ɂɗɋ), ɩɪɟɞɫɬɚɜɥɹɸɳɟɣ ɫɨɛɨɣ ɫɢɦɛɢɨɡ
ɬɢɩɨɜɨɣ ɷɤɫɩɟɪɬɧɨɣ ɫɢɫɬɟɦɵ (ɗɋ) ɢ ɤɥɚɫɫɢɱɟɫɤɨɣ ɂɂɋ [4]. ɗɬɨ ɨɛɭɫɥɨɜɥɟɧɨ ɫɥɟɞɭɸɳɢɦɢ ɯɚɪɚɤɬɟɪɧɵɦɢ ɜɨɡɦɨɠɧɨɫɬɹɦɢ, ɩɪɢɫɭɳɢɦɢ ɗɋ: ɨɪɢɟɧɬɚɰɢɟɣ ɧɚ ɪɟɲɟɧɢɟ ɡɚɞɚɱ ɜ ɧɟɮɨɪɦɚɥɢɡɨɜɚɧɧɵɯ ɨɛɥɚɫɬɹɯ, ɤɨɬɨɪɵɟ ɪɚɧɟɟ ɫɱɢɬɚɥɢɫɶ ɧɟɞɨɫɬɭɩɧɵɦɢ ɞɥɹ ɤɨɦɩɶɸɬɟɪɧɨɣ ɬɟɯɧɢɤɢ; ɜɨɡɦɨɠɧɨɫɬɶɸ
ɪɚɛɨɬɵ ɫ ɧɢɦɢ ɫɩɟɰɢɚɥɢɫɬɨɜ-ɩɨɥɶɡɨɜɚɬɟɥɟɣ (ɧɟ ɩɪɨɝɪɚɦɦɢɫɬɨɜ), ɱɬɨ ɪɟɡɤɨ ɪɚɫɲɢɪɹɟɬ ɫɮɟɪɭ ɢɯ
ɩɪɢɦɟɧɟɧɢɹ; ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɜɫɟɣ ɫɨɜɨɤɭɩɧɨɫɬɢ ɡɧɚɧɢɣ ɩɪɟɞɦɟɬɧɨɣ ɨɛɥɚɫɬɢ – ɤɨɥɢɱɟɫɬɜɟɧɧɨɣ
(ɢɡɦɟɪɢɬɟɥɶɧɨɣ) ɢ ɤɚɱɟɫɬɜɟɧɧɨɣ (ɡɧɚɧɢɹ ɷɤɫɩɟɪɬɨɜ) ɢɧɮɨɪɦɚɰɢɢ – ɞɥɹ ɤɨɧɬɪɨɥɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ ɢ ɩɨɞɞɟɪɠɤɢ ɩɪɢɧɹɬɢɹ ɪɟɲɟɧɢɣ ɩɨ ɨɛɟɫɩɟɱɟɧɢɸ ɟɝɨ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ, ɱɬɨ ɩɨɡɜɨɥɹɟɬ ɪɟɲɚɬɶ ɩɪɚɤɬɢɱɟɫɤɢɟ ɡɚɞɚɱɢ, ɤɨɬɨɪɵɟ ɧɟ ɩɨɞ ɫɢɥɭ ɨɞɧɨɦɭ ɱɟɥɨɜɟɤɭ-ɷɤɫɩɟɪɬɭ.
ɋɥɟɞɭɟɬ ɡɚɦɟɬɢɬɶ, ɱɬɨ ɪɚɡɜɢɬɢɟ ɗɋ ɢɞɟɬ ɫɥɨɠɧɵɦ ɩɭɬɟɦ, ɨɛɭɫɥɨɜɥɟɧɧɵɦ ɧɟɨɛɯɨɞɢɦɨɫɬɶɸ
ɱɟɬɤɨɝɨ ɨɛɨɫɧɨɜɚɧɢɹ ɛɭɞɭɳɟɣ ɜɨɫɬɪɟɛɨɜɚɧɧɨɫɬɢ ɫɨɡɞɚɜɚɟɦɨɣ ɗɋ, ɩɟɪɟɱɧɹ ɪɟɲɚɟɦɵɯ ɟɸ ɡɚɞɚɱ ɜ
ɜɵɛɪɚɧɧɨɣ ɩɪɟɞɦɟɬɧɨɣ ɨɛɥɚɫɬɢ. ɍɫɩɟɲɧɚɹ ɪɚɡɪɚɛɨɬɤɚ ɬɪɟɛɭɟɬ ɩɪɢɜɥɟɱɟɧɢɹ ɜɵɫɨɤɨɤɜɚɥɢɮɢɰɢɪɨɜɚɧɧɵɯ ɫɩɟɰɢɚɥɢɫɬɨɜ, ɤɚɤ ɜ ɩɪɟɞɦɟɬɧɨɣ ɨɛɥɚɫɬɢ, ɬɚɤ ɢ ɜ ɢɡɦɟɪɢɬɟɥɶɧɨ-ɜɵɱɢɫɥɢɬɟɥɶɧɨɣ ɬɟɯɧɢɤɟ
ɢ, ɱɬɨ ɨɱɟɧɶ ɜɚɠɧɨ, ɨɛɟɫɩɟɱɟɧɢɹ ɢɯ ɬɟɫɧɨɝɨ ɜɡɚɢɦɨɞɟɣɫɬɜɢɹ, ɧɚɰɟɥɟɧɧɨɫɬɢ ɧɚ ɪɟɡɭɥɶɬɚɬ.
ɉɪɨɜɟɞɟɧɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨɡɜɨɥɢɥɢ ɨɛɨɫɧɨɜɚɬɶ ɬɪɟɛɨɜɚɧɢɹ ɤ ɮɭɧɤɰɢɨɧɚɥɶɧɵɦ ɜɨɡɦɨɠɧɨɫɬɹɦ ɢ ɫɬɪɭɤɬɭɪɟ ɂɗɋ, ɪɚɡɪɚɛɨɬɚɬɶ ɢɯ ɢɧɮɨɪɦɚɰɢɨɧɧɨɟ, ɚɥɝɨɪɢɬɦɢɱɟɫɤɨɟ ɢ ɩɪɨɝɪɚɦɦɧɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢ ɫɨɡɞɚɬɶ ɢɧɮɨɪɦɚɰɢɨɧɧɭɸ ɬɟɯɧɨɥɨɝɢɸ ɞɢɚɝɧɨɫɬɢɪɨɜɚɧɢɹ Ⱦȼɋ [5].
Ɉɞɧɚɤɨ ɩɨɫɥɟɞɭɸɳɟɟ ɪɚɡɜɢɬɢɟ ɷɬɢɯ ɫɢɫɬɟɦ ɩɨɬɪɟɛɨɜɚɥɨ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ
ɨɛɟɫɩɟɱɟɧɢɹ, ɜ ɨɫɨɛɟɧɧɨɫɬɢ ɩɨ ɜɨɩɪɨɫɚɦ ɦɟɬɪɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ. Ʉɪɨɦɟ ɬɨɝɨ, ɜɨɡɧɢɤɥɚ
ɧɚɫɭɳɧɚɹ ɩɨɬɪɟɛɧɨɫɬɶ ɜ ɪɚɫɲɢɪɟɧɢɢ ɫɮɟɪɵ ɩɪɢɦɟɧɟɧɢɹ ɂɗɋ ɞɥɹ ɨɰɟɧɤɢ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ
ɨɬɞɟɥɶɧɵɯ ɚɝɪɟɝɚɬɨɜ ɢ ɫɢɫɬɟɦ, ɤɚɤ ɫɚɦɨɝɨ ɞɜɢɝɚɬɟɥɹ, ɬɚɤ ɢ ɬɪɚɤɬɨɪɚ ɜ ɰɟɥɨɦ. ɗɬɨ ɩɨɡɜɨɥɢɬ ɨɫɭɳɟɫɬɜɥɹɬɶ ɷɤɫɩɟɪɬɢɡɭ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɞɥɹ ɨɛɟɫɩɟɱɟɧɢɹ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ ɬɟɯɧɢɤɢ, ɜ ɬɨɦ
ɱɢɫɥɟ ɜ ɩɪɨɰɟɫɫɟ ɟɟ ɷɤɫɩɥɭɚɬɚɰɢɢ ɢ ɪɟɦɨɧɬɚ. ɉɨɦɢɦɨ ɷɬɨɝɨ ɧɟɨɛɯɨɞɢɦɨ ɩɨɫɬɨɹɧɧɨ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɬɶ ɬɟɯɧɢɱɟɫɤɨɟ ɢ ɩɪɨɝɪɚɦɦɧɨɟ ɨɛɟɫɩɟɱɟɧɢɹ ɂɗɋ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɬɟɯɧɢɱɟɫɤɚɹ ɷɤɫɩɟɪɬɢɡɚ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ, ɧɟɨɛɯɨɞɢɦɚɹ ɞɥɹ ɩɪɢɧɹɬɢɹ ɫɜɨɟɜɪɟɦɟɧɧɵɯ ɢ ɷɮɮɟɤɬɢɜɧɵɯ ɪɟɲɟɧɢɣ ɞɥɹ ɨɛɟɫɩɟɱɟɧɢɹ ɟɝɨ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ ɫɜɹɡɚɧɚ ɫ ɭɫɥɨɠɧɟɧɢɟɦ
ɢ ɫ ɤɚɱɟɫɬɜɟɧɧɵɦ ɪɨɫɬɨɦ ɫɥɨɠɧɨɫɬɢ ɂɗɋ. Ɋɟɱɶ ɬɟɩɟɪɶ ɢɞɟɬ ɧɟ ɨɛ ɨɬɞɟɥɶɧɵɯ ɫɪɟɞɫɬɜɚɯ, ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɩɪɢɛɨɪɚɯ, ɢɦɢɬɚɬɨɪɚɯ, ɚ ɨ ɫɥɨɠɧɵɯ ɭɫɬɪɨɣɫɬɜɚɯ ɫ ɰɟɥɟɧɚɩɪɚɜɥɟɧɧɵɦɢ ɮɭɧɤɰɢɹɦɢ,
ɛɨɥɶɲɢɦ ɤɨɥɢɱɟɫɬɜɨɦ ɩɚɪɚɦɟɬɪɨɜ, ɫɢɫɬɟɦɨɣ ɭɩɪɚɜɥɟɧɢɹ ɢ ɩɨɬɪɟɛɧɨɫɬɹɦɢ ɨɩɬɢɦɢɡɚɰɢɢ ɫɬɪɭɤɬɭɪɵ ɢ ɯɚɪɚɤɬɟɪɢɫɬɢɤ. ɗɬɨ ɤɚɱɟɫɬɜɟɧɧɨɟ ɢɡɦɟɧɟɧɢɟ ɂɗɋ ɨɛɭɫɥɨɜɥɟɧɨ ɫɥɟɞɭɸɳɢɦɢ ɩɪɢɧɰɢɩɚɦɢ ɢɯ
ɫɬɪɭɤɬɭɪɵ.
1. Ɍɚɤɢɟ ɫɥɨɠɧɵɟ ɨɛɴɟɤɬɵ ɷɤɫɩɟɪɬɢɡɵ (Ɉɗ) ɤɚɤ Ⱦȼɋ ɬɪɟɛɭɸɬ ɫɨɡɞɚɧɢɹ ɞɥɹ ɬɟɯɧɢɱɟɫɤɨɣ ɷɤɫɩɟɪɬɢɡɵ ɧɟ ɦɟɧɟɟ ɫɥɨɠɧɵɯ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ.
313
2. Ɇɧɨɝɨɨɛɪɚɡɢɟ ɪɟɲɚɟɦɵɯ ɡɚɞɚɱ ɬɪɟɛɭɟɬ ɪɚɡɪɚɛɨɬɤɢ ɤɪɢɬɟɪɢɟɜ ɤɚɱɟɫɬɜɚ, ɪɟɲɟɧɢɹ ɨɩɬɢɦɢɡɚɰɢɨɧɧɵɯ ɡɚɞɚɱ ɩɨ ɫɬɪɭɤɬɭɪɟ, ɫɨɫɬɚɜɭ, ɩɚɪɚɦɟɬɪɚɦ.
3. ɂɗɋ ɤɚɤ ɫɢɫɬɟɦɵ ɢɫɤɭɫɫɬɜɟɧɧɨɝɨ ɢɧɬɟɥɥɟɤɬɚ ɞɨɥɠɧɵ ɢɦɟɬɶ ɜɵɫɨɤɭɸ ɛɟɡɨɬɤɚɡɧɨɫɬɶ ɢ ɞɪɭɝɢɟ ɯɚɪɚɤɬɟɪɢɫɬɢɤɢ ɧɚɞɟɠɧɨɫɬɢ ɜɵɫɨɤɨɝɨ ɭɪɨɜɧɹ.
4. ɂɗɋ ɹɜɥɹɸɬɫɹ ɫɨɫɬɚɜɧɨɣ ɱɚɫɬɶɸ ɫɢɫɬɟɦɵ ɬɟɯɧɢɱɟɫɤɨɝɨ ɨɛɫɥɭɠɢɜɚɧɢɹ (ɌɈ) Ⱦȼɋ, ɚ ɢɯ ɫɥɨɠɧɨɫɬɶ ɢ ɜɵɫɨɤɚɹ ɫɬɨɢɦɨɫɬɶ ɩɪɟɞɨɩɪɟɞɟɥɹɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɢɯ ɪɚɰɢɨɧɚɥɶɧɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ: ɧɟɨɛɯɨɞɢɦɨ ɢɫɤɥɸɱɚɬɶ ɩɪɨɫɬɨɣ ɢɡ-ɡɚ ɧɟɞɨɝɪɭɡɨɤ, ɨɬɤɚɡɨɜ ɢ ɞɪɭɝɢɯ ɮɚɤɬɨɪɨɜ.
5. ɋɬɪɭɤɬɭɪɚ ɂɗɋ ɞɨɥɠɧɚ ɛɵɬɶ ɝɢɛɤɨɣ ɢ ɩɪɢɫɩɨɫɨɛɥɟɧɧɨɣ ɤ ɫɬɪɭɤɬɭɪɟ Ⱦȼɋ, ɤ ɭɫɥɨɜɢɹɦ ɩɪɨɜɟɞɟɧɢɹ ɷɤɫɩɟɪɬɢɡɵ (ɩɪɢ ɡɚɜɨɞɫɤɢɯ ɢɫɩɵɬɚɧɢɹɯ, ɜ ɪɟɦɨɧɬɧɵɯ ɩɪɟɞɩɪɢɹɬɢɹɯ ɢ ɦɚɫɬɟɪɫɤɢɯ, ɜ ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɯ ɩɭɧɤɬɚɯ ɩɪɟɞɩɪɢɹɬɢɣ, ɩɪɢ ɜɫɬɪɚɢɜɚɧɢɢ ɂɗɋ ɜ ɫɬɚɰɢɨɧɚɪɧɵɟ ɢ ɦɨɛɢɥɶɧɵɟ Ⱦȼɋ).
ɉɟɪɟɱɢɫɥɟɧɧɵɟ ɩɪɢɧɰɢɩɵ ɦɨɝɭɬ ɬɪɚɧɫɮɨɪɦɢɪɨɜɚɬɶɫɹ ɜ ɫɥɟɞɭɸɳɢɣ ɩɟɪɟɱɟɧɶ ɬɪɟɛɨɜɚɧɢɣ.
1. ɂɗɋ ɞɨɥɠɧɵ ɩɪɨɟɤɬɢɪɨɜɚɬɶɫɹ ɤɚɤ ɟɞɢɧɵɣ ɤɨɦɩɥɟɤɫ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɣ ɜ ɩɪɨɰɟɫɫɟ ɷɤɫɩɥɭɚɬɚɰɢɢ ɜɵɩɨɥɧɟɧɢɟ ɪɚɛɨɬ ɩɨ: ɨɩɪɟɞɟɥɟɧɢɸ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɝɨ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ, ɨɛɧɚɪɭɠɟɧɢɸ ɦɟɫɬɚ
ɨɬɤɚɡɚ ɩɨ ɪɚɰɢɨɧɚɥɶɧɵɦ ɚɥɝɨɪɢɬɦɚɦ; ɪɟɝɭɥɢɪɨɜɤɟ ɢ ɧɚɫɬɪɨɣɤɟ Ⱦȼɋ, ɤɪɚɬɤɨɫɪɨɱɧɨɦɭ ɢ ɞɨɥɝɨɫɪɨɱɧɨɦɭ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɸ ɫɨɫɬɨɹɧɢɹ; ɧɚɤɨɩɥɟɧɢɸ ɢ ɚɧɚɥɢɡɟ ɫɬɚɬɢɫɬɢɱɟɫɤɨɣ ɢɧɮɨɪɦɚɰɢɢ ɨɛ ɢɡɦɟɧɟɧɢɢ ɯɚɪɚɤɬɟɪɢɫɬɢɤ Ⱦȼɋ.
2. ɉɨ ɮɭɧɤɰɢɨɧɚɥɶɧɨɫɬɢ ɧɟɨɛɯɨɞɢɦɨ ɢɦɟɬɶ ɫɥɟɞɭɸɳɢɟ ɂɗɋ: ɞɥɹ ɨɩɟɪɚɬɢɜɧɨɝɨ ɌɈ; ɞɥɹ ɩɟɪɢɨɞɢɱɟɫɤɨɝɨ ɌɈ; ɞɥɹ ɪɟɦɨɧɬɚ.
3. ɂɗɋ ɞɥɹ ɨɩɟɪɚɬɢɜɧɨɝɨ ɌɈ ɞɨɥɠɧɵ ɛɚɡɢɪɨɜɚɬɶɫɹ ɧɚ ɤɨɧɬɪɨɥɥɟɪɚɯ, ɪɟɝɢɫɬɪɢɪɭɸɳɢɯ ɢɧɮɨɪɦɚɰɢɸ ɨɛ ɨɬɤɥɨɧɟɧɢɢ ɧɚɢɛɨɥɟɟ ɜɚɠɧɵɯ ɩɨɤɚɡɚɬɟɥɟɣ Ⱦȼɋ ɨɬ ɢɯ ɧɨɦɢɧɚɥɶɧɵɯ ɡɧɚɱɟɧɢɣ, ɚ ɬɚɤɠɟ
ɧɚ ɚɜɬɨɦɚɬɢɱɟɫɤɢɯ ɭɫɬɪɨɣɫɬɜɚɯ ɭɩɪɚɜɥɟɧɢɹ ɩɚɪɚɦɟɬɪɚɦɢ ɢ ɪɟɠɢɦɚɦɢ Ⱦȼɋ.
4. ɂɗɋ ɞɥɹ ɩɟɪɢɨɞɢɱɟɫɤɨɝɨ ɌɈ ɢ ɪɟɦɨɧɬɚ ɞɨɥɠɧɵ ɫɨɫɬɨɹɬɶ ɢɡ ɂɂɋ ɢ ɜɧɟɲɧɢɯ ɫɪɟɞɫɬɜ ɭɩɪɚɜɥɟɧɢɹ, ɩɨɡɜɨɥɹɸɳɢɯ ɩɪɨɢɡɜɨɞɢɬɶ ɷɤɫɩɟɪɬɢɡɭ ɫɬɚɰɢɨɧɚɪɧɵɯ Ⱦȼɋ ɧɚ ɫɩɟɰɢɚɥɶɧɵɯ ɫɬɟɧɞɚɯ.
5. ȼɚɠɧɵɦ ɭɫɥɨɜɢɟɦ ɩɪɢɦɟɧɟɧɢɹ ɜɫɬɪɨɟɧɧɵɯ ɂɗɋ ɹɜɥɹɟɬɫɹ ɨɛɟɫɩɟɱɟɧɢɟ ɢɯ ɪɚɛɨɬɵ ɜ ɪɟɠɢɦɟ
ɮɭɧɤɰɢɨɧɚɥɶɧɨɣ ɷɤɫɩɟɪɬɢɡɵ, ɬ.ɟ. ɂɗɋ ɧɟ ɞɨɥɠɧɚ ɧɚɪɭɲɚɬɶ ɧɨɪɦɚɥɶɧɨɣ ɪɚɛɨɬɵ ɨɛɴɟɤɬɚ.
Ɉɱɟɜɢɞɧɨ, ɱɬɨ ɜɚɠɧɨɣ ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɨɣ ɨɫɧɨɜɨɣ, ɢɧɫɬɪɭɦɟɧɬɨɦ ɫɨɡɞɚɧɢɹ ɢ ɢɫɫɥɟɞɨɜɚɧɢɹ
ɬɚɤɢɯ ɫɥɨɠɧɵɯ ɬɟɯɧɢɱɟɫɤɢɯ ɫɢɫɬɟɦ, ɤɚɤ ɂɗɋ ɹɜɥɹɟɬɫɹ ɦɨɞɟɥɢɪɨɜɚɧɢɟ. Ɉɧɨ ɢɦɟɟɬ ɜ ɧɚɫɬɨɹɳɟɟ
ɜɪɟɦɹ ɫɟɪɶɟɡɧɭɸ ɲɢɪɨɤɭɸ ɨɫɧɨɜɭ ɤɚɤ ɜ ɜɢɞɟ ɪɚɡɜɢɬɵɯ ɢɧɫɬɪɭɦɟɧɬɚɥɶɧɵɯ ɩɪɨɝɪɚɦɦɧɵɯ ɫɪɟɞɫɬɜ
ɚɧɚɥɢɡɚ ɞɚɧɧɵɯ ɢ ɡɧɚɧɢɣ, ɬɚɤ ɢ ɜ ɧɚɥɢɱɢɢ ɦɨɳɧɨɣ ɜɵɱɢɫɥɢɬɟɥɶɧɨɣ ɬɟɯɧɢɤɢ ɫ ɩɨɱɬɢ ɧɟɨɝɪɚɧɢɱɟɧɧɵɦɢ ɨɛɴɟɦɚɦɢ ɩɚɦɹɬɢ ɢ ɜɟɫɶɦɚ ɜɵɫɨɤɢɦ ɛɵɫɬɪɨɞɟɣɫɬɜɢɟɦ. ɗɬɨ ɨɛɟɫɩɟɱɢɜɚɟɬ ɪɟɝɢɫɬɪɚɰɢɸ
ɜ ɪɟɚɥɶɧɨɦ ɦɚɫɲɬɚɛɟ ɜɪɟɦɟɧɢ ɛɨɥɶɲɢɯ ɨɛɴɟɦɨɜ ɦɧɨɝɨɦɟɪɧɨɣ ɢɧɮɨɪɦɚɰɢɢ, ɯɚɪɚɤɬɟɪɢɡɭɸɳɟɣ
ɫɨɫɬɨɹɧɢɟ Ⱦȼɋ ɧɚ ɪɚɡɥɢɱɧɵɯ ɪɟɠɢɦɚɯ ɟɝɨ ɪɚɛɨɬɵ, ɫ ɩɨɫɥɟɞɭɸɳɟɣ ɨɩɟɪɚɬɢɜɧɨɣ ɨɛɪɚɛɨɬɤɨɣ ɩɨ
ɚɥɝɨɪɢɬɦɚɦ ɩɪɚɤɬɢɱɟɫɤɢ ɥɸɛɨɣ ɫɬɟɩɟɧɢ ɫɥɨɠɧɨɫɬɢ, ɱɬɨ ɩɨɡɜɨɥɹɟɬ ɨɬɨɛɪɚɡɢɬɶ ɫɬɪɭɤɬɭɪɭ ɢ ɫɜɹɡɢ
ɜ ɨɛɴɟɤɬɟ ɦɨɞɟɥɢɪɨɜɚɧɢɹ, ɩɪɨɚɧɚɥɢɡɢɪɨɜɚɬɶ ɟɝɨ ɩɨɜɟɞɟɧɢɟ ɫɩɟɰɢɚɥɶɧɵɦɢ ɫɪɟɞɫɬɜɚɦɢ, ɢɡɭɱɢɬɶ
ɫɜɨɣɫɬɜɚ ɢ ɜɵɹɜɢɬɶ ɫɭɳɟɫɬɜɟɧɧɵɟ ɡɚɤɨɧɨɦɟɪɧɨɫɬɢ.
ɂɫɯɨɞɹ ɢɡ ɜɵɲɟɢɡɥɨɠɟɧɧɨɝɨ, ɜ ɪɚɛɨɬɚɯ ɋɢɛɎɌɂ ɪɚɫɫɦɨɬɪɟɧɨ ɪɟɲɟɧɢɟ ɦɧɨɝɢɯ ɩɨɫɬɚɜɥɟɧɧɵɯ
ɜɨɩɪɨɫɨɜ ɩɨ ɦɨɞɟɥɢɪɨɜɚɧɢɸ ɩɪɨɰɟɫɫɨɜ Ⱦȼɋ, ɜɵɛɨɪɭ ɞɢɚɝɧɨɫɬɢɱɟɫɤɢɯ ɩɪɢɡɧɚɤɨɜ, ɨɛɟɫɩɟɱɟɧɢɸ
ɤɚɱɟɫɬɜɚ ɷɤɫɩɟɪɬɢɡɵ ɡɚ ɫɱɟɬ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ [6–8].
Ʉɪɨɦɟ ɬɨɝɨ ɨɫɬɚɟɬɫɹ ɪɹɞ ɩɪɨɛɥɟɦ ɢ ɜɨɩɪɨɫɨɜ, ɬɪɟɛɭɸɳɢɯ ɞɚɥɶɧɟɣɲɟɝɨ ɪɚɡɪɟɲɟɧɢɹ. Ʉ ɧɢɦ ɧɟɨɛɯɨɞɢɦɨ ɨɬɧɟɫɬɢ ɜɨɩɪɨɫɵ ɪɚɡɪɚɛɨɬɤɢ ɩɨɥɧɨɦɚɫɲɬɚɛɧɨɣ ɤɨɦɩɶɸɬɟɪɧɨɣ ɦɨɞɟɥɢ ɩɪɨɰɟɫɫɨɜ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɹ Ⱦȼɋ, ɞɪɭɝɢɯ ɫɨɫɬɚɜɧɵɯ ɱɚɫɬɟɣ ɢ ɬɪɚɤɬɨɪɚ ɜ ɰɟɥɨɦ; ɩɨɥɧɨɝɨ (ɫɤɜɨɡɧɨɝɨ) ɦɟɬɪɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɤɚɧɚɥɨɜ ɂɗɋ; ɪɚɫɲɢɪɟɧɢɹ ɛɚɡɵ ɡɧɚɧɢɣ ɡɚ ɫɱɟɬ ɩɪɢɦɟɧɟɧɢɹ
ɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɯ ɦɟɬɨɞɨɜ ɩɪɟɞɫɬɚɜɥɟɧɢɹ ɡɧɚɧɢɣ, ɦɟɬɨɞɨɜ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɢ ɤɥɚɫɫɢɮɢɤɚɰɢɢ ɫɨɫɬɨɹɧɢɹ Ɉɗ; ɪɚɡɪɚɛɨɬɤɢ ɩɨɥɧɨɫɬɶɸ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɣ ɫɢɫɬɟɦɵ ɭɩɪɚɜɥɟɧɢɹ ɢɫɩɵɬɚɧɢɹɦɢ Ɉɗ;
ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɩɪɨɰɟɫɫɨɜ ɢɡɜɥɟɱɟɧɢɹ ɢ ɩɪɟɞɫɬɚɜɥɟɧɢɹ ɡɧɚɧɢɣ, ɪɚɡɜɢɬɢɹ ɟɫɬɟɫɬɜɟɧɧɨɝɨ ɹɡɵɤɚ
ɢɧɬɟɪɮɟɣɫɚ ɩɨɥɶɡɨɜɚɬɟɥɹ ɜ ɞɚɧɧɨɣ ɩɪɟɞɦɟɬɧɨɣ ɨɛɥɚɫɬɢ; ɫɨɡɞɚɧɢɹ ȺɊɆ ɢɫɩɵɬɚɬɟɥɹ-ɷɤɫɩɟɪɬɚ.
Ⱦɚɥɶɧɟɣɲɟɟ ɪɚɡɜɢɬɢɟ ɢ ɪɚɫɲɢɪɟɧɢɟ ɫɮɟɪɵ ɩɪɢɦɟɧɟɧɢɹ ɂɗɋ ɫɜɹɡɚɧɨ ɫ ɩɪɢɦɟɧɟɧɢɟɦ, ɩɪɟɠɞɟ
ɜɫɟɝɨ, ɦɚɬɪɢɱɧɵɯ ɞɚɬɱɢɤɨɜ ɫɟɧɫɨɪɧɨɝɨ ɬɢɩɚ ɩɨ ɨɛɪɚɡɰɭ ɪɟɰɟɩɬɨɪɧɵɯ ɫɢɫɬɟɦ ɛɢɨɥɨɝɢɱɟɫɤɢɯ ɨɛɴɟɤɬɨɜ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɯ ɢɡɦɟɪɟɧɢɟ ɢ ɩɪɟɨɛɪɚɡɨɜɚɧɢɟ ɬɚɤɠɟ ɜɢɡɭɚɥɶɧɨɣ (ɜ ɬɨɦ ɱɢɫɥɟ ɰɜɟɬɨɜɨɣ),
ɡɜɭɤɨɜɨɣ ɢ ɞɪɭɝɨɣ ɢɧɮɨɪɦɚɰɢɢ, ɩɨɥɭɱɚɟɦɨɣ ɫ ɩɨɦɨɳɶɸ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ. ȼɚɠɧɵɦ ɹɜɥɹɟɬɫɹ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɟ ɭɫɬɪɨɣɫɬɜ ɫɨɩɪɹɠɟɧɢɹ ɂɗɋ ɫ Ⱦȼɋ (ɢɧɬɟɪɮɟɣɫɨɜ, ɤɨɧɬɪɨɥɥɟɪɨɜ, ɚɞɚɩɬɟɪɨɜ): ɩɨɜɵɲɟɧɢɟ ɛɵɫɬɪɨɞɟɣɫɬɜɢɹ, ɬɨɱɧɨɫɬɢ ɢ ɞɨɫɬɨɜɟɪɧɨɫɬɢ ɩɪɟɨɛɪɚɡɨɜɚɧɢɹ ɢ ɩɟɪɟɞɚɱɢ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɩɨɬɨɤɨɜ, ɪɚɡɜɢɬɢɟ ɫɩɨɫɨɛɧɨɫɬɟɣ ɚɞɚɩɬɢɪɨɜɚɬɶɫɹ ɤ ɫɜɨɣɫɬɜɚɦ Ⱦȼɋ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
314
Ɍɟɯɧɢɱɟɫɤɢɣ ɫɟɪɜɢɫ ɜ ȺɉɄ ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ: ɪɟɤɨɦɟɧɞɚɰɢɢ/ ɊȺɋɏɇ, ɋɢɛ. ɨɬɞ-ɧɢɟ, ɋɢɛɂɆɗ/
ɇɚɭɱɧ. ɪɟɞ. ɇɟɦɰɟɜ Ⱥ.ȿ.- ɇɨɜɨɫɢɛɢɪɫɤ, 2003.- 171 ɫ.
ɉɨɜɵɲɟɧɢɟ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɬɟɯɧɢɱɟɫɤɨɝɨ ɨɛɫɥɭɠɢɜɚɧɢɹ ɢ ɪɟɦɨɧɬɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɬɟɯɧɢɤɢ ɜ ɭɫɥɨɜɢɹɯ ɋɢɛɢɪɢ: ɭɱɟɛɧɨ-ɦɟɬɨɞɢɱɟɫɤɨɟ ɩɨɫɨɛɢɟ// ɊȺɋɏɇ, ɋɢɛ. ɨɬɞ-ɧɢɟ, ɋɢɛɂɆɗ / ɇɚɭɱɧ. ɪɟɞ.
ɇ.Ɇ. ɂɜɚɧɨɜ, Ⱥ.ȿ. ɇɟɦɰɟɜ – ɇɨɜɨɫɢɛɢɪɫɤ, 2012.- 108 ɫ.
3.
4.
5.
6.
7.
8.
ɋɢɫɬɟɦɚ ɞɥɹ ɪɟɝɢɫɬɪɚɰɢɢ ɢ ɨɛɪɚɛɨɬɤɢ ɢɧɞɢɤɚɬɨɪɧɵɯ ɞɢɚɝɪɚɦɦ : ɚ.ɫ. 954839 ɋɋɋɊ/ ɋɚɜɱɟɧɤɨ Ɉ.Ɏ.,
Ȼɭɯɬɢɹɪɨɜ ɂ.Ⱦ., Ⱥɥɶɬ ȼ.ȼ.[ɢ ɞɪ.]; ɡɚɹɜɥ. 26.01.81; ɨɩɭɛɥ. 30.08.82; Ȼɸɥ. ʋ 32.– 10 c.
ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., Ⱥɥɶɬ ȼ.ȼ. Ɉɫɨɛɟɧɧɨɫɬɢ ɢ ɩɪɢɧɰɢɩɵ ɩɨɫɬɪɨɟɧɢɹ ɷɤɫɩɟɪɬɧɨɣ ɫɢɫɬɟɦɵ
ɨɰɟɧɤɢ ɫɨɫɬɨɹɧɢɹ Ⱦȼɋ//ɋɨɜɪɟɦɟɧɧɵɟ ɦɟɬɨɞɵ, ɫɪɟɞɫɬɜɚ ɢɡɦɟɪɟɧɢɣ ɢ ɚɜɬɨɦɚɬɢɡɚɰɢɢ ɞɥɹ ɢɫɫɥɟɞɨɜɚɧɢɣ
ɮɢɡɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ: ɫɛ. ɧɚɭɱɧ. ɬɪ./ ɊȺɋɏɇ.– ɋɢɛ. ɨɬɞ–ɧɢɟ. – ɋɢɛɎɌɂ. – ɇɨɜɨɫɢɛɢɪɫɤ,1993.–ɋ. 59–73.
ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ɉɥɶɲɟɜɫɤɢɣ ɋ.ɇ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ. ɂɧɮɨɪɦɚɰɢɨɧɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɨɩɪɟɞɟɥɟɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɬɪɚɤɬɨɪɧɵɯ ɞɜɢɝɚɬɟɥɟɣ // Ɇɟɯɚɧɢɡɚɰɢɹ ɢ ɷɥɟɤɬɪɢɮɢɤɚɰɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ.–
2010.– ʋ 11. –ɋ. 27–30.
Ⱥɥɶɬ ȼ.ȼ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ɉɥɶɲɟɜɫɤɢɣ ɋ.ɇ. Ɍɟɯɧɢɱɟɫɤɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ ɦɚɲɢɧ ɢ ɦɟɯɚɧɢɡɦɨɜ ɜ ȺɉɄ: ɦɨɧɨɝɪɚɮɢɹ//Ɋɨɫɫɟɥɶɯɨɡɚɤɚɞɟɦɢɹ, ɋɢɛɢɪɫɤɨɟ
ɪɟɝɢɨɧɚɥɶɧɨɟ ɨɬɞɟɥɟɧɢɟ, Ƚɇɍ ɋɢɛɎɌɂ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2013. – 523 ɫ.
Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ., ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ɉɥɶɲɟɜɫɤɢɣ ɋ.ɇ. ɉɪɢɧɰɢɩɵ ɪɚɡɪɚɛɨɬɤɢ ɤɨɦɩɶɸɬɟɪɧɨɣ ɞɢɧɚɦɢɱɟɫɤɨɣ ɦɨɞɟɥɢ ɚɜɬɨɬɪɚɤɬɨɪɧɵɯ Ⱦȼɋ /ȼɟɫɬɧɢɤ ɇȽȺɍ.-2014.-ʋ 2.– ɋ. 141–146.
ɋɚɜɱɟɧɤɨ Ɉ.Ɏ., Ⱥɥɶɬ ȼ.ȼ., Ɉɥɶɲɟɜɫɤɢɣ ɋ.ɇ., Ⱦɨɛɪɨɥɸɛɨɜ ɂ.ɉ. Ɋɚɡɜɢɬɢɟ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɞɢɚɝɧɨɫɬɢɪɨɜɚɧɢɹ ɬɪɚɤɬɨɪɧɵɯ Ⱦȼɋ ɩɨ ɩɚɪɚɦɟɬɪɚɦ ɪɚɛɨɱɢɯ ɩɪɨɰɟɫɫɨɜ//Ɍɪɭɞɵ ȽɈɋɇɂɌɂ .- 2015. -ɬ. 118. –
ɋ. 106–112.
ɍȾɄ: 631.3
ɋɂɋɌȿɆɇȺə ɂɇɀȿɇȿɊɂə ȼ ɉɊɈȿɄɌɂɊɈȼȺɇɂɂ
ɆȺɒɂɇɇɕɏ ɌȿɏɇɈɅɈȽɂɃ ȼɈɁȾȿɅɕȼȺɇɂə
ɁȿɊɇɈȼɕɏ ɄɍɅɖɌɍɊ
ɍɌȿɇɄɈȼ Ƚ.Ʌ.,
Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɛɸɞɠɟɬɧɨɟ ɭɱɪɟɠɞɟɧɢɟ
ɋɢɛɢɪɫɤɨɟ Ɉɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ, ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ
ɍɌȿɇɄɈȼȺ Ɍ.ɂ.
Ɏɟɞɟɪɚɥɶɧɨɟ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɟ ɛɸɞɠɟɬɧɨɟ ɭɱɪɟɠɞɟɧɢɟ ɋɢɛɢɪɫɤɢɣ ɇɂɂ ɷɤɨɧɨɦɢɤɢ
ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ, ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ, e-mail: utenkov1951@mail.ru
ȼɜɟɞɟɧɢɟ.ȼɨɡɞɟɥɵɜɚɧɢɟɡɟɪɧɨɜɵɯɤɭɥɶɬɭɪɤɚɤɜɰɟɥɨɦɩɨɊɨɫɫɢɢ,ɬɚɤɢɜɋɢɛɢɪɫɤɨɦɎɟɞɟɪɚɥɶɧɨɦ
Ɉɤɪɭɝɟ, ɹɜɥɹɟɬɫɹ ɩɪɟɨɛɥɚɞɚɸɳɢɦ. ɉɪɢɱɟɦ, ɤɚɤ ɫɥɟɞɭɟɬ ɢɡ ɢɫɫɥɟɞɨɜɚɧɢɣ ɋɢɛɇɂɂɗɋɏ, ɫɪɟɞɧɹɹ
ɭɪɨɠɚɣɧɨɫɬɶ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ ɞɥɹ ɭɫɥɨɜɢɣ ɋɢɛɢɪɢ, ɞɨɥɠɧɚ ɧɚɯɨɞɢɬɶɫɹ ɧɚ ɭɪɨɜɧɟ 1,8 – 2,0 ɬ/ɝɚ.
ȼ ɪɚɛɨɬɚɯ [1] ɩɨɤɚɡɚɧɨ, ɱɬɨ ɡɚ ɩɨɫɥɟɞɧɟɟ ɞɟɫɹɬɢɥɟɬɢɟ ɫɪɟɞɧɹɹ ɭɪɨɠɚɣɧɨɫɬɶ ɩɨ ɇɨɜɨɫɢɛɢɪɫɤɨɣ
ɨɛɥɚɫɬɢ ɢ ɜ ɰɟɥɨɦ ɩɨ ɋɎɈ ɧɟ ɩɪɟɜɵɲɚɥɚ 1,5 ɬ/ɝɚ. ɇɟɤɨɬɨɪɵɟ ɢɡɦɟɧɟɧɢɹ ɜ ɪɨɫɬɟ ɭɪɨɠɚɣɧɨɫɬɢ
ɨɛɭɫɥɨɜɥɟɧɵ ɜ ɨɫɧɨɜɧɨɦ ɜɵɜɨɞɨɦ ɢɡ ɩɚɲɧɢ ɧɢɡɤɨɩɥɨɞɨɪɨɞɧɵɯ ɩɨɱɜ.
ȼ ɪɚɛɨɬɚɯ [2,3] ɩɨɤɚɡɚɧɨ, ɱɬɨ ɧɟ ɭɱɟɬ ɩɨɱɜɟɧɧɨ – ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɣ, ɚ ɬɚɤɠɟ ɧɟɞɨɫɬɚɬɨɤ
ɢɥɢ ɢɡɥɢɲɟɤ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɫɭɳɟɫɬɜɟɧɧɨ ɫɤɚɡɵɜɚɟɬɫɹ ɧɚ ɩɨɤɚɡɚɬɟɥɹɯ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɪɨɢɡɜɨɞɢɦɨɣ ɩɪɨɞɭɤɰɢɢ. Ⱥ ɩɪɢɦɟɧɟɧɢɟ ɡɚɪɭɛɟɠɧɨɣ ɬɟɯɧɢɤɢ ɷɮɮɟɤɬɢɜɧɨ ɬɨɥɶɤɨ ɩɪɢ ɜɵɪɚɳɢɜɚɧɢɢ
ɜɵɫɨɤɨɭɪɨɠɚɣɧɵɯ ɫɨɪɬɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɤɭɥɶɬɭɪ [4].
Ɉɞɧɚɤɨ ɞɚɧɧɵɟ ɫɨɪɬɚ ɨɬɧɨɫɹɬɫɹ ɤ ɢɧɬɟɧɫɢɜɧɵɦ ɬɢɩɚɦ, ɚ ɢɯ ɭɪɨɠɚɣɧɨɫɬɶ ɧɢɡɤɚ ɢ ɧɟɫɬɚɛɢɥɶɧɚ,
ɱɬɨ ɨɛɭɫɥɨɜɥɟɧɨ ɜɟɪɨɹɬɧɨɫɬɧɵɦɢ ɩɪɢɪɨɞɧɨ – ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɦɢ ɭɫɥɨɜɢɹɦɢ. ɉɪɢɱɟɦ ɩɪɚɤɬɢɤɚ
ɫɨɜɪɟɦɟɧɧɨɝɨ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ ɩɨɤɚ ɨɫɧɨɜɵɜɚɟɬɫɹ ɧɚ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɬɪɚɞɢɰɢɨɧɧɵɯ ɧɟɫɢɫɬɟɦɧɵɯ
ɪɟɲɟɧɢɣ [5].
Ɉɫɨɛɟɧɧɨ ɷɬɨ ɩɪɨɹɜɥɹɟɬɫɹ, ɤɨɝɞɚ ɢɦɟɟɬɫɹ ɞɨɫɬɚɬɨɱɧɨɟ ɤɨɥɢɱɟɫɬɜɨ ɡɟɦɥɢ. ɋɱɢɬɚɟɬɫɹ, ɱɬɨ ɧɟɝɚɬɢɜɧɨɟ ɜɨɡɞɟɣɫɬɜɢɟ ɚɝɪɨɬɟɯɧɨɥɨɝɢɣ ɧɚ ɩɪɢɪɨɞɧɭɸ ɫɪɟɞɭ, ɤɚɤ ɩɪɚɜɢɥɨ, ɩɪɹɦɨ ɩɪɨɩɨɪɰɢɨɧɚɥɶɧɵ
ɤɨɥɢɱɟɫɬɜɭ ɡɚɬɪɚɱɢɜɚɟɦɨɣ ɷɧɟɪɝɢɢ ɢɥɢ ɩɪɨɢɡɜɨɞɢɦɨɣ ɷɧɟɪɝɢɢ, ɩɪɢɯɨɞɹɳɟɣɫɹ ɧɚ ɟɞɢɧɢɰɭ ɩɥɨɳɚɞɢ ɡɟɦɥɢ.
ɉɨɥɚɝɚɸɬ [6], ɱɬɨ ɩɪɨɢɡɜɨɞɫɬɜɨ ɡɟɪɧɚ ɜ ɫɬɪɚɧɟ ɫɥɟɞɭɟɬ ɧɟɭɤɥɨɧɧɨ ɭɜɟɥɢɱɢɜɚɬɶ ɡɚ ɫɱɟɬ ɦɨɛɢɥɢɡɚɰɢɢ ɤɚɤ ɷɤɫɬɟɧɫɢɜɧɵɯ, ɬɚɤ ɢ ɢɧɬɟɧɫɢɜɧɵɯ ɮɚɤɬɨɪɨɜ. Ɉɞɧɚɤɨ ɩɟɪɟɯɨɞ ɧɚ ɩɪɨɝɪɟɫɫɢɜɧɵɟ ɬɟɯɧɨɥɨɝɢɢ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɟ ɪɚɰɢɨɧɚɥɶɧɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɪɟɫɭɪɫɨɜ, ɤɚɤ ɨɬɦɟɱɚɟɬɫɹ ɜ ɪɚɛɨɬɟ[5], ɩɨɤɚ ɧɟɜɨɡɦɨɠɟɧ ɢɡ-ɡɚ ɨɬɫɭɬɫɬɜɢɹ ɧɚɭɱɧɵɯ ɨɫɧɨɜ ɤɨɥɢɱɟɫɬɜɟɧɧɨɝɨ ɚɧɚɥɢɡɚ ɷɤɨ – ɢ ɚɝɪɨɫɢɫɬɟɦ ɜ ɰɟɥɨɦ.
ɍɩɪɚɜɥɹɬɶ ɚɝɪɚɪɧɵɦ ɩɪɨɢɡɜɨɞɫɬɜɨɦ ɛɟɡ ɭɱɟɬɚ ɩɪɨɰɟɫɫɨɜ ɫɚɦɨɨɪɝɚɧɢɡɚɰɢɢ ɠɢɜɨɣ ɩɪɢɪɨɞɵ ɢ
ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɚɞɚɩɬɚɰɢɢ ɫɟɝɨɞɧɹ ɧɟɞɨɫɬɚɬɨɱɧɨ. ɇɭɠɧɵ ɫɢɧɟɪɝɟɬɢɱɟɫɤɢɟ ɦɟɬɨɞɵ ɭɩɪɚɜɥɟɧɢɹ,
ɚɤɬɢɜɢɡɢɪɭɸɳɢɦɢ ɤɚɤ ɬɟɯɧɨɝɟɧɧɵɣ, ɬɚɤ ɢ ɛɢɨɥɨɝɢɡɢɪɨɜɚɧɧɵɣ ɮɚɤɬɨɪ ɭɩɪɚɜɥɟɧɢɹ[7].
Ⱥɧɚɥɢɡ ɩɨɫɥɟɞɧɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢ ɩɭɛɥɢɤɚɰɢɣ. ɋɨɜɪɟɦɟɧɧɨɟ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɟ ɩɪɨɢɡɜɨɞɫɬɜɨ ɨɬɧɨɫɢɬɫɹ ɤ ɨɬɤɪɵɬɵɦ ɫɥɨɠɧɵɦ ɞɢɧɚɦɢɱɟɫɤɢɦ ɫɢɫɬɟɦɚɦ ɫ ɜɟɪɨɹɬɧɨɫɬɧɵɦ ɢɫɯɨɞɨɦ ɩɨ315
ɤɚɡɚɬɟɥɟɣ ɟɝɨ ɷɮɮɟɤɬɢɜɧɨɫɬɢ. ɉɨɷɬɨɦɭ ɫɱɢɬɚɸɬ [7], ɱɬɨ ɦɟɬɨɞ ɫɢɫɬɟɦɧɨɝɨ ɚɧɚɥɢɡɚ ɰɟɥɟɫɨɨɛɪɚɡɧɨ
ɢɫɩɨɥɶɡɨɜɚɬɶ ɤɚɤ ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɢɣ ɢɧɫɬɪɭɦɟɧɬ ɞɥɹ ɪɚɡɪɚɛɨɬɤɢ ɢ ɩɪɨɟɤɬɢɪɨɜɚɧɢɹ ɫɥɨɠɧɵɯ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ, ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɢ ɭɩɪɚɜɥɟɧɢɹ ɤɚɱɟɫɬɜɨɦ ɩɪɨɢɡɜɨɞɫɬɜɚ ɚɝɪɨɩɪɨɞɭɤɰɢɢ.
Ɉɞɧɚɤɨ ɞɚɧɧɵɣ ɦɟɬɨɞ ɧɟ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɦɨɞɟɥɶ ɢɫɫɥɟɞɭɟɦɨɝɨ ɨɛɴɟɤɬɚ, ɧɨ ɩɨɡɜɨɥɹɟɬ ɜɫɤɪɵɬɶ
ɧɨɜɵɟ ɪɚɧɟɟ ɧɟɢɡɜɟɫɬɧɵɟ ɮɚɤɬɨɪɵ.
ɋɨɝɥɚɫɧɨ [8]: «ɩɨɞ ɫɢɫɬɟɦɧɵɦ ɩɨɞɯɨɞɨɦ ɤ ɢɫɫɥɟɞɨɜɚɧɢɸ ɨɛɴɟɤɬɨɜ ɩɨɧɢɦɚɟɬɫɹ ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɚɹ ɤɨɧɰɟɩɰɢɹ, ɨɫɧɨɜɚɧɧɚɹ ɧɚ ɫɬɪɟɦɥɟɧɢɢ ɩɨɫɬɪɨɢɬɶ ɰɟɥɨɫɬɧɭɸ ɤɚɪɬɢɧɭ ɢɫɫɥɟɞɭɟɦɨɝɨ ɨɛɴɟɤɬɚ ɤɚɤ
ɫɢɫɬɟɦɵ, ɤɚɤ ɟɞɢɧɨɝɨ ɰɟɥɶɧɨɝɨ, ɰɟɥɨɝɨ «ɨɪɝɚɧɢɡɦɚ» ɫ ɭɱɟɬɨɦ ɜɫɟɯ ɜɚɠɧɵɯ ɞɥɹ ɞɚɧɧɨɝɨ ɢɫɫɥɟɞɨɜɚɧɢɹ ɫɨɫɬɚɜɥɹɸɳɢɯ ɨɛɴɟɤɬɚ (ɟɝɨ ɜɧɭɬɪɟɧɧɢɯ ɷɥɟɦɟɧɬɨɜ ɤɚɤ ɰɟɥɨɫɬɧɨɫɬɢ), ɫɜɹɡɟɣ ɢ ɜɡɚɢɦɨɞɟɣɫɬɜɢɣ
ɦɟɠɞɭ ɧɢɦɢ ɢ ɢɯ ɜɧɟɲɧɢɯ ɫɜɹɡɟɣ ɫ ɞɪɭɝɢɦɢ ɨɛɴɟɤɬɚɦɢ ɢ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɨɣ». ɉɪɢ ɷɬɨɦ ɭɤɚɡɵɜɚɹ
ɧɚ ɧɚɥɢɱɢɟ ɲɟɫɬɢ ɨɫɨɛɟɧɧɨɫɬɟɣ ɫɢɫɬɟɦɧɨɝɨ ɩɨɞɯɨɞɚ, ɨɬɦɟɱɚɟɬɫɹ: «ɜɵɹɜɥɟɧɢɟ ɰɟɥɟɣ ɢɫɫɥɟɞɨɜɚɧɢɣ
ɢ ɨɩɪɟɞɟɥɟɧɢɟ ɩɨɞɥɟɠɚɳɢɯ ɪɟɲɟɧɢɸ ɡɚɞɚɱ, ɩɪɨɛɥɟɦ ɩɪɨɢɡɜɨɞɢɬɫɹ ɧɚ ɨɫɧɨɜɟ ɚɧɚɥɢɡɚ ɨɛɳɟɣ ɰɟɥɢ
ɢɫɯɨɞɹ ɢɡ ɨɛɳɟɣ ɢɞɟɢ ɪɟɲɟɧɢɹ ɩɪɨɛɥɟɦɵ, ɤɨɝɞɚ ɚɥɶɬɟɪɧɚɬɢɜɵ ɫɪɚɜɧɢɜɚɸɬɫɹ ɜ ɩɟɪɜɭɸ ɨɱɟɪɟɞɶ ɩɨ
ɤɪɢɬɟɪɢɸ ɡɚɬɪɚɬ (ɫɬɨɢɦɨɫɬɶ, ɷɮɮɟɤɬɢɜɧɨɫɬɶ).
ɋɢɫɬɟɦɧɵɣ ɩɨɞɯɨɞ ɨɡɧɚɱɚɟɬ, ɱɬɨ ɪɨɥɶ ɱɚɫɬɧɨɝɨ ɤɪɢɬɟɪɢɹ ɜɡɜɟɲɢɜɚɟɬɫɹ ɫ ɬɨɱɤɢ ɡɪɟɧɢɹ ɟɝɨ ɜɥɢɹɧɢɹ ɧɚ ɫɜɨɣɫɬɜɚ ɫɢɫɬɟɦɵ ɜ ɰɟɥɨɦ. Ʌɸɛɚɹ ɫɢɫɬɟɦɚ, ɨɫɨɛɟɧɧɨ ɫɥɨɠɧɚɹ, ɯɚɪɚɤɬɟɪɢɡɭɟɬɫɹ ɦɧɨɝɢɦɢ
ɫɜɨɣɫɬɜɚɦɢ, ɨɩɪɟɞɟɥɹɸɳɢɦɢ ɟɟ ɩɨɬɪɟɛɢɬɟɥɶɫɤɢɟ ɰɟɧɧɨɫɬɢ.
ɉɪɢ ɫɨɡɞɚɧɢɢ ɫɢɫɬɟɦɧɨɝɨ ɤɨɦɩɥɟɤɫɚ ɜɨɡɧɢɤɚɟɬ ɧɨɜɨɟ ɪɟɲɟɧɢɟ ɫ ɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɦ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɟɦ ɟɝɨ ɱɚɫɬɟɣ ɢ ɧɨɜɵɦ ɤɚɱɟɫɬɜɨɦ. Ɉɞɧɚɤɨ ɜ ɪɟɝɢɨɧɚɥɶɧɨɦ ɚɫɩɟɤɬɟ [9] ɨɬɫɭɬɫɬɜɭɟɬ ɟɞɢɧɚɹ
ɦɟɬɨɞɨɥɨɝɢɹ ɮɨɪɦɢɪɨɜɚɧɢɹ ɰɟɥɨɫɬɧɨɫɬɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɩɨ ɫɨɜɨɤɭɩɧɨɫɬɢ ɩɨɤɚɡɚɬɟɥɟɣ ɢ ɧɟ ɨɩɪɟɞɟɥɹɟɬɫɹ ɫɬɪɭɤɬɭɪɚ ɜɤɥɚɞɚ ɤɚɠɞɨɝɨ ɩɪɢ ɫɧɢɠɟɧɢɢ ɷɧɟɪɝɨɦɚɬɟɪɢɚɥɶɧɵɯ ɡɚɬɪɚɬ. Ɉɫɧɨɜɧɨɣ ɧɟɞɨɫɬɚɬɨɤ ɬɟɨɪɟɬɢɱɟɫɤɢɯ ɩɨɞɯɨɞɨɜ ɩɪɨɟɤɬɢɪɨɜɚɧɢɹ ɫɨɫɬɨɢɬ ɜ ɪɚɫɫɦɨɬɪɟɧɢɢ
ɦɚɲɢɧɧɨɣ ɬɟɯɧɨɥɨɝɢɢ ɧɟ ɤɚɤ ɟɞɢɧɨɝɨ ɰɟɥɨɝɨ, ɚ ɤɚɤ ɧɚɛɨɪɚ ɨɬɞɟɥɶɧɵɯ ɦɚɲɢɧ.
ȼ ɪɚɛɨɬɟ [10] ɩɨɤɚɡɚɧɨ, ɱɬɨ ɩɪɢɦɟɧɟɧɢɟ ɬɟɯɧɨɥɨɝɢɣ ɬɨɱɧɨɝɨ ɡɟɦɥɟɞɟɥɢɹ ɩɪɢ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɦɢɧɟɪɚɥɶɧɵɯ ɭɞɨɛɪɟɧɢɣ ɨɛɟɫɩɟɱɢɜɚɟɬ ɩɨɜɵɲɟɧɢɟ ɭɪɨɠɚɣɧɨɫɬɢ ɧɚ 25 –30 %.
ɋɨɝɥɚɫɧɨ [11], ɧɨɜɚɹ ɫɢɫɬɟɦɚ ɪɟɝɭɥɢɪɭɸɳɢɯ ɦɟɪɨɩɪɢɹɬɢɣ ɞɨɥɠɧɚ ɨɛɟɫɩɟɱɢɜɚɬɶ ɷɮɮɟɤɬ ɧɟ ɦɟɧɟɟ
35 %. ɋɱɢɬɚɟɬɫɹ, ɱɬɨ ɩɪɢ ɷɮɮɟɤɬɟ ɛɨɥɟɟ 35 % ɪɟɲɟɧɢɹ ɨɬɧɨɫɹɬɫɹ ɤ ɡɚɞɚɱɚɦ ɫɬɪɭɤɬɭɪɧɨɝɨ ɫɢɧɬɟɡɚ.
ɉɨɤɚ ɧɚɭɤɚ ɫɥɚɛɨ ɜɨɫɬɪɟɛɨɜɚɧɚ ɩɪɚɤɬɢɤɨɣ, ɬ.ɤ. ɩɪɟɞɥɚɝɚɟɬ ɧɟ ɫɢɫɬɟɦɭ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɡɧɚɧɢɣ, ɚ
ɨɬɞɟɥɶɧɵɟ ɟɟ ɤɨɦɩɨɧɟɧɬɵ. Ȼɟɡ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɜɵɝɨɞɵ ɧɚɭɱɧɵɟ ɪɟɤɨɦɟɧɞɚɰɢɢ ɧɟ ɛɭɞɭɬ ɜɵɩɨɥɧɹɬɶɫɹ,
ɞɚɠɟ ɟɫɥɢ ɩɪɟɞɭɫɦɨɬɪɟɧ ɪɨɫɬ ɭɪɨɠɚɣɧɨɫɬɢ ɢ ɩɥɨɞɨɪɨɞɢɟ ɩɨɱɜ. ɇɟɨɛɯɨɞɢɦɨ ɨɩɪɟɞɟɥɢɬɶ ɦɟɫɬɨ ɫɢɫɬɟɦɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜ ɚɝɪɚɪɧɨɣ ɧɚɭɤɟ [12]. ȼ ɰɟɥɨɦ, ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɨɛɳɟɣ ɬɟɨɪɢɟɣ ɫɢɫɬɟɦ: «…ɦɵ
ɬɚɤ ɢ ɧɟ ɧɚɭɱɢɥɢɫɶ ɬɨɥɤɨɦ ɫɢɧɬɟɡɢɪɨɜɚɬɶ, ɨɛɨɛɳɚɬɶ, ɫɨɛɢɪɚɬɶ ɰɟɥɨɟ ɢɡ ɱɚɫɬɟɣ».
ɋɥɨɠɢɜɲɢɟɫɹ ɩɪɨɬɢɜɨɪɟɱɢɹ ɦɟɠɞɭ ɬɪɟɛɭɟɦɵɦ ɭɪɨɜɧɟɦ ɦɚɲɢɧɧɨ – ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɩɪɨɰɟɫɫɨɜ ɜɨɡɞɟɥɵɜɚɧɢɹ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ ɫ ɨɞɧɨɣ ɫɬɨɪɨɧɵ, ɮɢɧɚɧɫɨɜɨɝɨ ɩɨɥɨɠɟɧɢɹ, ɪɟɚɥɶɧɨɝɨ
ɨɫɧɚɳɟɧɢɹ ɢ ɜɨɡɦɨɠɧɨɫɬɹɦɢ ɟɝɨ ɭɥɭɱɲɟɧɢɹ ɫ ɞɪɭɝɨɣ ɫɬɨɪɨɧɵ, ɭɤɚɡɵɜɚɸɬ ɧɚ ɧɚɥɢɱɢɟ ɩɪɨɛɥɟɦɧɨɣ
ɫɢɬɭɚɰɢɢ, ɡɚɤɥɸɱɚɸɳɟɣɫɹ ɜ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɞɨɫɬɢɠɟɧɢɹ ɪɚɰɢɨɧɚɥɶɧɨɝɨ ɫɨɨɬɧɨɲɟɧɢɹ ɦɟɠɞɭ ɠɟɥɚɟɦɵɦɢ ɩɨɤɚɡɚɬɟɥɹɦɢ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɢ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɢɯ ɰɟɥɟɫɨɨɛɪɚɡɧɨɫɬɶɸ, ɨɰɟɧɢɜɚɸɳɢɦɢ ɭɪɨɜɟɧɶ ɭɩɪɚɜɥɟɧɢɹ.
ɐɟɥɶ ɪɚɛɨɬɵ. Ɋɚɡɪɚɛɨɬɤɚ ɦɟɬɨɞɢɱɟɫɤɢɯ ɩɨɥɨɠɟɧɢɣ ɩɨ ɩɨɜɵɲɟɧɢɸ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɦɚɲɢɧɧɵɯ
ɬɟɯɧɨɥɨɝɢɣ ɜɨɡɞɟɥɵɜɚɧɢɹ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ.
ɂɡɥɨɠɟɧɢɟ ɨɫɧɨɜɧɨɝɨ ɦɚɬɟɪɢɚɥɚ ɢɫɫɥɟɞɨɜɚɧɢɣ. ɋɭɳɟɫɬɜɟɧɧɵɣ ɮɚɤɬɨɪ ɧɟɭɫɬɨɣɱɢɜɨɫɬɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ, ɹɜɥɹɸɳɢɣɫɹ ɨɫɧɨɜɧɵɦ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɵɦ ɩɪɨɞɭɤɬɨɦ – ɦɟɯɚɧɢɡɢɪɨɜɚɧɧɚɹ ɬɟɯɧɨɥɨɝɢɹ, ɛɟɡ ɢɡɦɟɧɟɧɢɹ ɢɫɩɨɥɶɡɭɟɬɫɹ ɦɧɨɝɢɟ ɝɨɞɵ.
ɋɱɢɬɚɟɬɫɹ [12], ɱɬɨ ɩɪɢɦɟɧɹɟɦɵɟ ɬɟɯɧɨɥɨɝɢɢ ɨɩɪɟɞɟɥɹɸɬ ɭɪɨɜɟɧɶ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɜ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɟ ɢ ɠɢɜɨɬɧɨɜɨɞɫɬɜɟ, ɚ ɬɟɯɧɢɤɚ ɹɜɥɹɟɬɫɹ ɝɥɚɜɧɵɦ ɮɚɤɬɨɪɨɦ ɢɯ ɤɚɱɟɫɬɜɟɧɧɵɯ ɢ ɷɤɨɧɨɦɢɱɟɫɤɢɯ
ɯɚɪɚɤɬɟɪɢɫɬɢɤ.
ȼ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɬɟɨɪɟɬɢɱɟɫɤɢɦɢ ɩɨɥɨɠɟɧɢɹɦɢ, ɫɬɪɚɬɟɝɢɱɟɫɤɢɣ ɩɭɬɶ ɪɚɡɜɢɬɢɹ ɢ ɦɨɞɟɪɧɢɡɚɰɢɢ ɜ
ɰɟɥɨɦ ɨɩɪɟɞɟɥɹɸɬ ɬɟɨɪɟɦɵ Ƚɟɞɟɥɹ, ɫɭɳɧɨɫɬɶ ɬɪɟɛɨɜɚɧɢɣ ɤɨɬɨɪɵɯ ɨɬɪɚɠɟɧɚ ɚɤɚɞɟɦɢɤɨɦ Ⱥ.ɂ. Ȼɟɪɝɨɦ:
«ɇɢɤɚɤɚɹ ɫɢɫɬɟɦɧɚɹ ɡɚɞɚɱɚ ɧɟ ɦɨɠɟɬ ɛɵɬɶ ɪɟɲɟɧɚ ɛɟɡ ɨɛɪɚɳɟɧɢɹ ɤ ɫɢɫɬɟɦɟ ɫɥɟɞɭɸɳɟɝɨ, ɛɨɥɟɟ ɜɵɫɨɤɨɝɨ ɩɨɪɹɞɤɚ». Ɉɛɳɚɹ ɛɥɨɤ – ɫɯɟɦɚ (ɜ ɜɢɞɟ ɱɟɪɧɨɝɨ ɹɳɢɤɚ) ɭɱɟɬɚ ɨɫɧɨɜɧɨɣ ɝɪɭɩɩɵ ɮɚɤɬɨɪɨɜ, ɨɩɪɟɞɟɥɹɸɳɢɯ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ, ɩɪɟɞɫɬɚɜɥɟɧɚ ɧɚ ɪɢɫ.1.
ɇɚɦɢ [13,14] ɪɚɫɤɪɵɬɵ ɬɪɢ ɭɪɨɜɧɹ ɦɨɪɚɥɶɧɨɝɨ ɢɡɧɨɫɚ ɬɟɯɧɢɤɢ, ɨɛɨɫɧɨɜɚɧ ɝɥɨɛɚɥɶɧɵɣ ɤɪɢɬɟɪɢɣ
ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɢ ɨɩɪɟɞɟɥɟɧɵ ɭɫɥɨɜɢɹ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɟ ɞɨɫɬɢɠɟɧɢɹ ɟɝɨ ɷɤɫɬɪɟɦɭɦɚ.
ȼ ɨɫɧɨɜɟ ɚɧɚɥɢɡɚ ɫɥɨɠɧɵɯ ɫɢɫɬɟɦ ɩɨɥɨɠɟɧ ɦɟɬɨɞ ɚɧɚɥɢɡɚ ɢɟɪɚɪɯɢɣ, ɨɫɭɳɟɫɬɜɥɹɸɳɢɣ ɞɟɤɨɦɩɨɡɢɰɢɸ ɰɟɥɟɣ. ȼɵɫɲɟɦɭ ɭɪɨɜɧɸ ɢɟɪɚɪɯɢɢ ɨɛɴɟɤɬɨɜ ɫɨɨɬɜɟɬɫɬɜɭɟɬ ɝɥɨɛɚɥɶɧɚɹ ɰɟɥɶ, ɤɨɬɨɪɚɹ ɜɤɥɸɱɚɟɬ
ɫɨɜɨɤɭɩɧɨɫɬɶ ɪɚɡɧɨɦɚɫɲɬɚɛɧɵɯ ɰɟɥɟɣ ɪɚɡɥɢɱɧɨɣ ɧɚɩɪɚɜɥɟɧɧɨɫɬɢ, ɬɚɤ ɧɚɡɵɜɚɟɦɨɝɨ «ɞɟɪɟɜɨ ɰɟɥɟɣ».
ɋɨɨɬɜɟɬɫɬɜɭɸɳɟɦɭ ɞɟɪɟɜɭ ɰɟɥɟɣ ɫɬɨɢɬɫɹ «ɞɟɪɟɜɨ ɪɟɲɟɧɢɣ», ɱɬɨ ɞɚɟɬ ɧɚɝɥɹɞɧɨɟ ɩɪɟɞɫɬɚɜɥɟɧɢɟ ɨ ɜɨɡɦɨɠɧɵɯ ɬɟɯɧɢɱɟɫɤɢɯ ɪɟɲɟɧɢɹɯ ɢ ɫɬɟɩɟɧɢ ɮɨɪɦɚɥɢɡɭɟɦɨɫɬɢ, ɤɨɬɨɪɵɟ ɢɡɥɨɠɟɧɵ ɧɚɦɢ ɜ
ɪɚɛɨɬɟ [15].
316
ɉɨ ɦɧɟɧɢɸ ɦɧɨɝɢɯ ɫɩɟɰɢɚɥɢɫɬɨɜ ɫɢɫɬɟɦɧɨɣ ɢɧɠɟɧɟɪɢɢ, ɤɚɤ ɭɩɪɚɜɥɟɧɢɟ ɞɟɹɬɟɥɶɧɨɫɬɶɸ ɩɨ ɫɨɡɞɚɧɢɸ ɫɢɫɬɟɦ ɥɸɛɨɝɨ ɧɚɡɧɚɱɟɧɢɹ, ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɨɞɯɨɞɚ ɩɨɥɧɨɝɨ ɠɢɡɧɟɧɧɨɝɨ ɰɢɤɥɚ ɩɨɡɜɨɥɹɟɬ
ɩɪɢ ɫɨɡɞɚɧɢɢ ɫɥɨɠɧɵɯ ɢɧɠɟɧɟɪɧɵɯ ɨɛɴɟɤɬɨɜ ɪɚɫɫɦɚɬɪɢɜɚɬɶ ɜɫɟ ɫɢɫɬɟɦɧɵɟ ɚɫɩɟɤɬɵ ɜ ɢɯ ɩɨɥɧɨɬɟ
ɢ ɜɡɚɢɦɨɫɜɹɡɢ.
ɉɨɞ ɠɢɡɧɟɧɧɵɦ ɰɢɤɥɨɦ ɫɢɫɬɟɦɵ (ɀɐɋ) ɩɨɧɢɦɚɸɬ ɪɚɡɜɢɬɢɟ ɫɢɫɬɟɦɵ, ɩɪɨɟɤɬɚ, ɩɪɨɞɭɤɰɢɢ, ɭɫɥɭɝɢ, ɫɨɡɞɚɜɚɟɦɵɯ ɱɟɥɨɜɟɤɨɦ ɞɥɹ ɭɞɨɜɥɟɬɜɨɪɟɧɢɹ ɫɜɨɢɯ ɧɭɠɞ, ɨɬ ɜɨɡɧɢɤɧɨɜɟɧɢɹ ɡɚɦɵɫɥɚ – ɢɞɟɢ ɞɨ
ɩɪɟɤɪɚɳɟɧɢɹ ɫɭɳɟɫɬɜɨɜɚɧɢɹ ɨɛɴɟɤɬɚ ɤɚɤ ɰɟɥɨɝɨ. ɂɥɢ ɠɢɡɧɟɧɧɵɣ ɰɢɤɥ ɬɟɯɧɨɥɨɝɢɢ – ɷɬɨ ɩɪɨɰɟɫɫ
ɦɚɤɫɢɦɢɡɚɰɢɢ ɩɨɥɟɡɧɨɫɬɢ ɢɫɤɭɫɫɬɜɟɧɧɨɝɨ ɨɫɭɳɟɫɬɜɥɟɧɢɹ ɬɨɝɨ ɢɥɢ ɢɧɨɝɨ ɮɢɡɢɱɟɫɤɨɝɨ ɷɮɮɟɤɬɚ.
Ɋɢɫ. 1. Ȼɥɨɤ-ɫɯɟɦɚ ɭɱɟɬɚ ɨɫɧɨɜɧɵɯ ɮɚɤɬɨɪɨɜ,
ɨɩɪɟɞɟɥɹɸɳɢɯ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ȼɁɄ
ɇɚ ɪɢɫ 2 ɩɪɟɞɫɬɚɜɥɟɧɚ ɛɥɨɤ – ɫɯɟɦɚ 3D ɩɪɨɟɤɬɢɪɨɜɚɧɢɹ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɫ ɭɱɟɬɨɦ ɠɢɡɧɟɧɧɨɝɨ ɰɢɤɥɚ ɫɢɫɬɟɦɵ. ɉɪɢ ɷɬɨɦ ɩɪɢɧɰɢɩ ɬɪɟɯɦɟɪɧɨɝɨ ɬɟɯɧɢɤɨ – ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɩɪɨɟɤɬɢɪɨɜɚɧɢɹ ɩɪɟɞɩɨɥɚɝɚɟɬ, ɱɬɨ ɩɪɢ ɨɞɧɨɣ ɰɟɥɟɜɨɣ ɭɫɬɚɧɨɜɤɟ (ɰɟɥɟɩɨɥɚɝɚɧɢɹ ɩɪɨɰɟɫɫɨɜ) ɢ ɨɞɧɨɡɧɚɱɧɨɫɬɢ ɜɵɯɨɞɧɵɯ ɯɚɪɚɤɬɟɪɢɫɬɢɤ, ɧɚɩɪɢɦɟɪ, ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ ɦɨɝɭɬ ɫɨɡɞɚɜɚɬɶ ɪɚɡɥɢɱɧɵɟ
ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɨɩɟɪɚɰɢɢ, ɤɨɬɨɪɵɦ, ɜ ɫɜɨɸ ɨɱɟɪɟɞɶ, ɞɨɥɠɧɵ ɫɨɨɬɜɟɬɫɬɜɨɜɚɬɶ ɪɚɡɥɢɱɧɵɟ ɬɢɩɵ
ɦɚɲɢɧ ɢ ɦɟɯɚɧɢɡɦɨɜ.
Ȼɥɨɤ ɬɟɯɧɢɱɟɫɤɨɝɨ ɪɟɲɟɧɢɹ ɜɤɥɸɱɚɟɬ:
- ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ ɤɨɦɩɥɟɤɫ ɦɚɲɢɧ; ɦɚɲɢɧɧɨ – ɬɪɚɤɬɨɪɧɵɣ ɚɝɪɟɝɚɬ (ɝɢɛɤɨɟ ɬɟɯɧɢɱɟɫɤɨɟ ɫɪɟɞɫɬɜɨ); ɤɨɦɛɢɧɢɪɨɜɚɧɧɨɟ ɨɪɭɞɢɟ; ɪɚɛɨɱɢɣ ɨɪɝɚɧ; ɬɟɯɧɢɱɟɫɤɢɣ ɩɪɢɧɰɢɩ; ɪɟɫɭɪɫɵ.
Ȼɥɨɤ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɜɤɥɸɱɚɟɬ:
- ɬɟɯɧɨɥɨɝɢɸ ɜɨɡɞɟɥɵɜɚɧɢɹ; ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ ɩɪɨɰɟɫɫ; ɬɟɯɧɨɥɨɝɢɱɟɫɤɭɸ ɨɩɟɪɚɰɢɸ; ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ ɩɪɢɧɰɢɩ; ɩɪɢɪɨɞɧɵɟ ɪɟɫɭɪɫɵ.
Ȼɥɨɤ «ɠɢɡɧɟɧɧɵɣ ɰɢɤɥ» ɜɤɥɸɱɚɟɬ:
- ɡɚɦɵɫɟɥ – ɢɞɟɸ; ɩɪɢɧɰɢɩɢɚɥɶɧɭɸ ɫɯɟɦɭ (ɨɛɥɢɤ ɫɢɫɬɟɦɵ); ɩɪɨɟɤɬɢɪɨɜɚɧɢɟ ɷɥɟɦɟɧɬɨɜ; ɢɡɝɨɬɨɜɥɟɧɢɟ ɷɥɟɦɟɧɬɨɜ; ɷɤɫɩɥɭɚɬɚɰɢɸ ɫɢɫɬɟɦɵ; ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨɟ ɩɪɢɦɟɧɟɧɢɟ; ɦɨɪɚɥɶɧɵɣ ɢɥɢ ɮɢɡɢɱɟɫɤɢɣ ɢɡɧɨɫ – ɫɩɢɫɚɧɢɟ ɫɢɫɬɟɦɵ.
317
Ɋɢɫɭ. 2. ɋɯɟɦɚ 3D ɩɪɨɟɤɬɢɪɨɜɚɧɢɹ ɦɚɲɢɧɧɨ-ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ
ɜɨɡɞɟɥɵɜɚɧɢɹ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ
ȼ ɫɬɚɧɞɚɪɬɚɯ ɫɢɫɬɟɦɧɨɣ ɢɧɠɟɧɟɪɢɢ ɜɵɞɟɥɹɟɬɫɹ ɱɟɬɵɪɟ ɨɫɧɨɜɧɵɯ ɩɪɢɧɰɢɩɚ, ɥɟɠɚɳɢɯ ɜ ɨɫɧɨɜɟ
ɦɨɞɟɥɢɪɨɜɚɧɢɹ ɀɐɋ:
- ɜ ɬɟɱɟɧɢɟ ɫɜɨɟɣ ɠɢɡɧɢ ɫɢɫɬɟɦɚ ɩɪɨɯɨɞɢɬ ɱɟɪɟɡ ɨɩɪɟɞɟɥɟɧɧɵɟ ɫɬɚɞɢɢ;
- ɧɚ ɤɚɠɞɨɣ ɫɬɚɞɢɢ ɀɐɋ ɞɨɥɠɧɵ ɛɵɬɶ ɞɨɫɬɭɩɧɵ ɧɟɨɛɯɨɞɢɦɵɟ ɫɢɫɬɟɦɵ ɨɛɟɫɩɟɱɟɧɢɹ, ɱɬɨ ɝɚɪɚɧɬɢɪɭɟɬ ɩɨɥɭɱɟɧɢɟ ɡɚɩɥɚɧɢɪɨɜɚɧɧɨɝɨ ɪɟɡɭɥɶɬɚɬɚ. ɉɪɢ ɷɬɨɦ ɫɬɚɞɢɢ ɞɨɥɠɧɵ ɭɱɢɬɵɜɚɬɶɫɹ ɢɧɞɢɜɢɞɭɚɥɶɧɨ;
- ɧɚ ɨɩɪɟɞɟɥɟɧɧɵɯ ɫɬɚɞɢɹɯ ɀɐɋ ɬɚɤɢɟ ɚɬɪɢɛɭɬɵ, ɤɚɤ ɬɟɯɧɨɥɨɝɢɱɧɨɫɬɶ, ɭɞɨɛɫɬɜɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ, ɩɪɢɝɨɞɧɨɫɬɶ ɤ ɨɛɫɥɭɠɢɜɚɧɢɸ ɢ ɜɨɡɦɨɠɧɨɫɬɶ ɭɞɚɥɟɧɢɹ ɨɬɯɨɞɨɜ, ɞɨɥɠɧɵ ɛɵɬɶ ɫɩɟɰɢɮɢɰɢɪɨɜɚɧɵ ɢ ɩɪɚɤɬɢɱɟɫɤɢ ɪɟɚɥɢɡɨɜɚɧɵ;
- ɩɟɪɟɯɨɞ ɤ ɫɥɟɞɭɸɳɟɣ ɫɬɚɞɢɢ ɜɨɡɦɨɠɟɧ ɬɨɥɶɤɨ ɩɪɢ ɭɫɥɨɜɢɢ ɩɨɥɧɨɝɨ ɞɨɫɬɢɠɟɧɢɹ ɪɟɡɭɥɶɬɚɬɨɜ,
ɡɚɩɥɚɧɢɪɨɜɚɧɧɵɯ ɞɥɹ ɬɟɤɭɳɟɣ ɫɬɚɞɢɢ.
ȼ ɬɟɨɪɢɢ ɪɟɲɟɧɢɹ ɢɧɠɟɧɟɪɧɵɯ ɡɚɞɚɱ ɠɢɡɧɟɧɧɵɣ ɰɢɤɥ ɬɟɯɧɢɱɟɫɤɢɯ ɫɢɫɬɟɦ (ɬɟɯɧɨɥɨɝɢɣ), ɤɚɤ
ɩɪɨɰɟɫɫ ɪɚɡɜɢɬɢɹ ɜɨ ɜɪɟɦɟɧɢ, ɢɦɟɟɬ S-ɨɛɪɚɡɧɵɣ ɜɢɞ.
ȼɵɜɨɞɵ:
1. ɉɪɟɨɛɥɚɞɚɸɳɢɣ ɯɚɪɚɤɬɟɪ ɩɪɢɦɟɧɹɟɦɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ ɧɨɫɢɬ ɷɤɫɬɟɧɫɢɜɧɵɣ ɯɚɪɚɤɬɟɪ.
2. ɉɪɢɦɟɧɟɧɢɟ ɦɟɬɨɞɚ ɫɢɫɬɟɦɧɨɣ ɢɧɠɟɧɟɪɢɢ ɜ ɩɪɨɟɤɬɢɪɨɜɚɧɢɢ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɨɡɜɨɥɹɟɬ ɜɫɤɪɵɬɶ ɪɚɧɟɟ ɧɟ ɭɱɢɬɵɜɚɟɦɵɟ ɮɚɤɬɨɪɵ ɢ ɨɛɟɫɩɟɱɢɬɶ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɜɨɡɞɟɥɵɜɚɧɢɹ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
318
ȼɥɚɫɟɧɤɨ Ⱥ.ɇ., ɒɨɛɚ ȼ.ɇ., ɒɚɪɤɨɜ ɂ.ɇ. ɉɪɨɞɭɤɬɢɜɧɨɫɬɶ ɹɪɨɜɨɣ ɩɲɟɧɢɰɵ ɩɨ ɩɚɪɭ ɩɪɢ ɪɚɡɥɢɱɧɵɯ
ɬɟɯɧɨɥɨɝɢɹɯ ɜ ɥɟɫɨɫɬɟɩɢ Ɂɚɩɚɞɧɨɣ ɋɢɛɢɪɢ//Ɂɟɦɥɟɞɟɥɢɟ.- 2014. – ʋ5.-ɋ.26 – 28.
Ʉɢɪɸɲɢɧ ȼ.ɂ. Ɍɟɯɧɨɥɨɝɢɱɟɫɤɚɹ ɦɨɞɟɪɧɢɡɚɰɢɹ ɡɟɦɥɟɞɟɥɢɹ – ɧɟɨɬɥɨɠɧɚɹ ɡɚɞɚɱɚ//ɗɤɨɧɨɦɢɤɚ ɫɟɥ. ɯɨɡɜɚ Ɋɨɫɫɢɢ. – 2009.- ʋ2.- ɋ.17- 25.
Ʉɨɥɨɞɢɧ Ʌ.ȼ., ɋɨɪɨɤɢɧ ɉ.ȼ., ɍɬɟɧɤɨɜ Ƚ.Ʌ. Ɋɚɰɢɨɧɚɥɶɧɨɟ ɤɨɦɩɥɟɤɬɨɜɚɧɢɟ ɦɚɲɢɧɧɨ–ɬɪɚɤɬɨɪɧɵɯ ɚɝɪɟɝɚɬɨɜ ɞɥɹ ɫɩɥɨɲɧɨɣ ɨɛɪɚɛɨɬɤɢ ɩɨɱɜɵ//Ⱥɝɪɚɪɧɚɹ ɧɚɭɤɚ – ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɦɭ ɩɪɨɢɡɜɨɞɫɬɜɭ ɋɢɛɢɪɢ,
Ɇɨɧɝɨɥɢɢ, Ʉɚɡɚɯɫɬɚɧɚ ɢ Ȼɨɥɝɚɪɢɢ: ɫɛ. ɧɚɭɱ. ɞɨɤɥ. XVII ɦɟɠɞɭɧɚɪ. ɧɚɭɱ – ɩɪɚɤɬ. ɤɨɧɮ. (ɝ. ɇɨɜɨɫɢɛɢɪɫɤ,
13 ɧɨɹɛɪɹ 2014 ɝ.).ɑ.2./ Ɏɟɞɟɪ. ɚɝɟɧɫɬɜɨ ɧɚɭɱ. ɨɪɝ., Ɋɨɫ. ɚɤɚɞ. ɫ.-ɯ. ɧɚɭɤ, ɋɢɛ. ɪɟɝɢɨɧ. ɨɬɞ-ɧɢɟ, Ɇɨɧ-
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
ɝɨɥ. ɚɤɚɞ. ɚɝɪɚɪ. ɧɚɭɤ, ɚɤɚɞ. ɫ.-ɯ. ɧɚɭɤ Ɋɟɫɩ. Ʉɚɡɚɯɫɬɚɧ, ɫ.-ɯ ɚɤɚɞ. Ɋɟɫɩ. Ȼɨɥɝɚɪɢɢ.- ɇɨɜɨɫɢɛɢɪɫɤ, 2014.
ɋ.155 – 157.
Ɂɚɜɨɪɚ ȼ.Ⱥ. Ʉ ɜɨɩɪɨɫɭ ɨ ɞɢɮɮɟɪɟɧɰɢɪɨɜɚɧɧɨɣ ɞɨɬɚɰɢɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ ȺɉɄ ɫ ɭɱɟɬɨɦ ɟɝɨ ɦɚɬɟɪɢɚɥɶɧɨ – ɬɟɯɧɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ //Ⱥɝɪɚɪɧɚɹ ɧɚɭɤɚ – ɫɟɥɶɫɤɨɦɭ ɯɨɡɹɣɫɬɜɭ.- Ȼɚɪɧɚɭɥ, 2010.- Ɍ.-ʋ 2.- ɋ.
464-465.
ɋɜɟɧɬɢɰɤɢɣ ɂ.ɂ. Ɉɫɨɛɟɧɧɨɫɬɢ ɚɞɚɩɬɢɜɧɨɝɨ ɪɚɡɜɢɬɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ Ɋɨɫɫɢɢ //Ⱥɝɪɚɪɧɚɹ ɧɚɭɤɚ.1995.- ʋ 5.- ɋ.32 – 34.
Ⱥɥɬɭɯɨɜ Ⱥ. Ɂɟɪɧɨɜɨɟ ɯɨɡɹɣɫɬɜɨ Ɋɨɫɫɢɢ: ɪɨɫɬ ɛɟɡ ɪɚɡɜɢɬɢɹ//ɗɤɨɧɨɦɢɫɬ.- 2009. – ʋ4. – ɋ.20–28.
Ȼɚɲɢɥɨɜ Ⱥ.Ɇ. ɗɥɟɤɬɪɨɧɧɨ – ɨɩɬɢɱɟɫɤɨɟ ɡɪɟɧɢɟ ɜ ɚɝɪɚɪɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ (ɫɢɫɬɟɦɨɬɟɯɧɢɤɚ ɩɨɫɬɪɨɟɧɢɹ
ɢ ɩɪɢɦɟɧɟɧɢɹ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɨɩɬɢɱɟɫɤɢɯ ɬɟɯɧɨɥɨɝɢɣ).- Ɇ.- 2005.- 312 ɫ.
Ƚɭɛɚɪɟɜ ȼ.ȼ. ɉɟɪɫɩɟɤɬɢɜɧɵɟ ɩɨɞɯɨɞɵ ɜ ɦɟɧɟɞɠɦɟɧɬɟ//Ɇɟɧɟɞɠɦɟɧɬ ɜ Ɋɨɫɫɢɢ ɢ ɡɚ ɪɭɛɟɠɨɦ. – 2009.ʋ3. – ɋ. 5 – 9.
ɐɭɝɥɟɧɨɤ ɇ.ȼ. Ɉɪɝɚɧɢɡɚɰɢɹ ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɷɧɟɪɝɨɫɛɟɪɟɝɚɸɳɢɯ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɪɨɞɨɜɨɥɶɫɬɜɢɹ ɜ ȺɉɄ ɋɢɛɢɪɢ //ɗɥɟɤɬɪɨɷɧɟɪɝɟɬɢɤɚ ɜ ɫɟɥ. ɯɨɡ-ɜɟ: Ɇɚɬɟɪ. ɦɟɠɞɭɧɚɪɨɞ. ɧɚɭɱ.ɩɪɚɤɬ. ɤɨɧɮ., 26-30 ɢɸɧɹ 2009 ɝ.- ɇɨɜɨɫɢɛɢɪɫɤ. – 2009. ɋ.- 39 -47.
əɤɭɲɟɜ ȼ.ȼ. ɂɧɮɨɪɦɚɰɢɨɧɧɨ – ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɨɫɧɨɜɵ ɩɪɟɰɢɡɢɨɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɪɚɫɬɟɧɢɟɜɨɞɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ// Ⱥɜɬɨɪɟɮ. ɞɢɫ. ɞ-ɪɚ ɫ.-ɯ. ɧɚɭɤ.- ɋɉɛ. – 2013. – 43 ɫ.
Ʌɢɩɤɨɜɢɱ ɗ.ɂ. Ɇɨɞɟɥɢɪɨɜɚɧɢɟ ɷɤɨɧɨɦɢɤɢ ɢ ɩɪɨɛɥɟɦɵ ɦɨɞɟɪɧɢɡɚɰɢɢ Ɋɨɫɫɢɢ//ȼɟɫɬɧɢɤ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ
Ⱦɨɧɚ.- 2011.- ʋ2. – ɋ. 4 –32.
Ʉɪɚɫɧɨɳɟɤɨɜ ɇ.ȼ. ɉɪɨɟɤɬɢɪɨɜɚɧɢɟ ɬɟɯɧɨɥɨɝɢɣ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ // Ɍɟɯɧɢɤɚ ɜ ɫɟɥ. ɯɨɡ – ɜɟ.- 2003.- ʋ1. – ɋ.3–7.
ɍɬɟɧɤɨɜ Ƚ.Ʌ. ɋɬɪɚɬɟɝɢɹ ɮɨɪɦɢɪɨɜɚɧɢɹ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜɨɡɞɟɥɵɜɚɧɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ
ɤɭɥɶɬɭɪ ɜ ɭɫɥɨɜɢɹɯ ɋɢɛɢɪɢ//ȼɟɫɬɧɢɤ ɄɪɚɫȽȺɍ. – 2010. – ʋ2. – ɋ.123–127.
ɍɬɟɧɤɨɜ Ƚ.Ʌ. ɍɩɪɚɜɥɟɧɢɟ ɩɨɤɚɡɚɬɟɥɹɦɢ ɤɚɱɟɫɬɜɚ ɜ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɹɯ ɜɨɡɞɟɥɵɜɚɧɢɹ ɡɟɪɧɨɜɵɯ
ɤɭɥɶɬɭɪ//ɉɢɳɚ. ɗɤɨɥɨɝɢɹ. Ʉɚɱɟɫɬɜɨ: ɬɪɭɞɵ ɏ ɦɟɠɞɭɧɚɪ. ɧɚɭɱ. – ɩɪɚɤɬ. ɤɨɧɮ. (Ʉɪɚɫɧɨɨɛɫɤ, 1–3 ɢɸɥɹ
2013 ɝ.)/Ɋɨɫ. ɚɤɚɞ. ɫ.-ɯ. ɧɚɭɤ, ɋɢɛ. ɪɟɝɢɨɧ. ɨɬɞ-ɧɢɟ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2013.- ɋ. 292 – 296.
ɍɬɟɧɤɨɜ Ƚ.Ʌ. Ʉɨɧɰɟɩɰɢɹ ɫɨɡɞɚɧɢɹ ɷɮɮɟɤɬɢɜɧɵɯ ɦɚɲɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜɨɡɞɟɥɵɜɚɧɢɹ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ, ɭɱɢɬɵɜɚɸɳɢɯ ɧɟɨɞɧɨɪɨɞɧɨɫɬɶ ɫɨɫɬɨɹɧɢɹ ɩɨɱɜɟɧɧɨɝɨ ɩɨɤɪɨɜɚ //ɗɤɨɥɨɝɢɹ ɢ ɩɪɢɪɨɞɨɩɨɥɶɡɨɜɚɧɢɟ.
Ɍ.3. – ɂɡɛɪɚɧɧɵɟ ɬɪɭɞɵ Ɇɟɠɞɭɧɚɪɨɞɧɨɝɨ ɫɢɦɩɨɡɢɭɦɚ ɩɨ ɮɭɧɞɚɦɟɧɬɚɥɶɧɵɦ ɢ ɩɪɢɤɥɚɞɧɵɦ ɩɪɨɛɥɟɦɚɦ
ɧɚɭɤɢ. Ɇ.: ɊȺɇ, 2012.- ɋ. 94 – 118.
319
ɉȿɊȿɊȺȻɈɌɄȺ ɂ ɏɊȺɇȿɇɂȿ
ɋȿɅɖɋɄɈɏɈɁəɃɋɌȼȿɇɇɈɃ ɉɊɈȾɍɄɐɂɂ
ɍȾɄ: 338.431.6
ɊȺɁȼɂɌɂȿ ɉȿɊȿɊȺȻɈɌɄɂ
ɋȿɅɖɋɄɈɏɈɁəɃɋɌȼȿɇɇɈɃ ɉɊɈȾɍɄɐɂɂ –
ȽɅȺȼɇɕɃ ɉɊɂɈɊɂɌȿɌ ȺɉɄ ɊȿɋɉɍȻɅɂɄɂ ɄȺɁȺɏɋɌȺɇ
ȺɄɂɆȻȿɄɈȼȺ Ƚ.ɍ., ɄȺɋɄȺȻȺȿȼ ɍ.Ɋ., ɒȿɊɂɆɈȼȺ ɇ.Ɇ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɷɤɨɧɨɦɢɤɢ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ
ɤɨɦɩɥɟɤɫɚ ɢ ɪɚɡɜɢɬɢɹ ɫɟɥɶɫɤɢɯ ɬɟɪɪɢɬɨɪɢɣ», ɝ. Ⱥɥɦɚɬɵ, ɉɚɜɥɨɞɚɪɫɤɨɝɨ
ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɭɧɢɜɟɪɫɢɬɟɬɚ ɢɦ. ɋ. Ɍɨɪɚɣɝɵɪɨɜɚ, ɝ. ɉɚɜɥɨɞɚɪ, Ɋɟɫɩɭɛɥɢɤɚ
Ʉɚɡɚɯɫɬɚɧ, akimbekova_g@mail.ru, kaskabaev_ulan@mail.ru, asanek2010@mail.ru
Ɉɞɧɢɦ ɢɡ ɩɪɢɨɪɢɬɟɬɧɵɯ ɧɚɩɪɚɜɥɟɧɢɣ ȺɉɄ Ʉɚɡɚɯɫɬɚɧɚ ɹɜɥɹɟɬɫɹ ɪɚɡɜɢɬɢɟ ɩɢɳɟɜɨɣ ɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ Ʉɚɡɚɯɫɬɚɧɚ, ɨɬ ɫɨɫɬɨɹɧɢɹ ɤɨɬɨɪɨɣ ɛɭɞɟɬ ɡɚɜɢɫɟɬɶ ɤɨɧɤɭɪɟɧɬɨɫɩɨɫɨɛɧɨɫɬɶ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ȺɉɄ [1, 2]. ȼ ɪɟɫɩɭɛɥɢɤɟ ɪɟɚɥɢɡɭɸɬɫɹ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɟ ɩɪɨɝɪɚɦɦɵ «Ⱥɝɪɨɛɢɡɧɟɫ-2020» [1], «ɋɬɪɚɬɟɝɢɹ 2050» [2], Ⱦɨɪɨɠɧɚɹ ɤɚɪɬɚ ɩɨ ɩɨɞɞɟɪɠɤɟ ɢ ɪɚɡɜɢɬɢɸ
ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɢ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɨɫɬɢ [3], ɫɨɝɥɚɫɧɨ ɤɨɬɨɪɵɦ
ɩɪɟɞɫɬɨɢɬ ɡɧɚɱɢɬɟɥɶɧɚɹ ɪɚɛɨɬɚ ɩɨ ɦɨɞɟɪɧɢɡɚɰɢɢ ɨɬɪɚɫɥɢ ɢ ɮɢɧɚɧɫɨɜɨɣ ɟɟ ɩɨɞɞɟɪɠɤɟ. Ɂɚ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɨɛɴɟɦɵ ɩɪɨɢɡɜɟɞɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɩɪɟɞɩɪɢɹɬɢɣ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ ɭɜɟɥɢɱɢɥɢɫɶ, ɜ ɬ.ɱ. ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɩɨɱɬɢ ɜ 2 ɪɚɡɚ: ɫ 630 ɦɥɪɞ ɬɟɧɝɟ ɜ 2009 ɝ. ɞɨ 970 ɜ 2013 ɝ., ɞɨɥɹ ɢɯ ɜ
ɨɛɳɟɦ ɨɛɴɟɦɟ ɩɢɳɟɜɨɣ ɩɪɨɞɭɤɰɢɢ ɫɨɫɬɚɜɢɥɚ – 78 %, ɚ ɤ ɩɪɨɦɵɲɥɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɊɄ – 5,1 %.
Ⱥɧɚɥɢɡ ɩɪɨɢɡɜɨɞɫɬɜɚ ɨɫɧɨɜɧɵɯ ɜɢɞɨɜ ɩɪɨɞɨɜɨɥɶɫɬɜɢɹ ɜ ɊɄ ɡɚ ɩɨɫɥɟɞɧɢɟ ɩɹɬɶ ɥɟɬ ɩɨɞɬɜɟɪɠɞɚɟɬ
ɫɬɚɛɢɥɶɧɵɣ ɪɨɫɬ ɩɪɨɢɡɜɨɞɫɬɜɚ ɦɹɫɨɩɪɨɞɭɤɬɨɜ, ɦɭɤɢ, ɤɪɭɩɵ, ɦɚɤɚɪɨɧ, ɧɟ ɫɬɚɛɢɥɶɧɨ ɪɚɡɜɢɜɚɟɬɫɹ
ɩɪɨɢɡɜɨɞɫɬɜɨ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɵɯ ɨɜɨɳɟɣ ɢ ɮɪɭɤɬɨɜ, ɤɨɥɛɚɫɧɵɯ ɢɡɞɟɥɢɣ, ɦɚɫɥɚ ɪɚɫɬɢɬɟɥɶɧɨɝɨ[4].
Ɉɞɧɚɤɨ, ɧɟɫɦɨɬɪɹ ɧɚ ɩɪɨɹɜɥɟɧɢɟ ɩɨɡɢɬɢɜɧɵɯ ɫɞɜɢɝɨɜ ɜ ȺɉɄ Ʉɚɡɚɯɫɬɚɧɚ ɭɪɨɜɟɧɶ ɪɚɡɜɢɬɢɹ ɫɢɫɬɟɦɵ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɫɢɥɶɧɨ ɨɬɫɬɚɟɬ ɨɬ ɫɬɪɚɧ ɋɇȽ, ɧɟ ɝɨɜɨɪɹ ɨ ɪɚɡɜɢɬɵɯ ɫɬɪɚɧɚɯ. Ɋɚɡɜɢɬɢɟ ɢ ɫɥɨɠɢɜɲɟɟɫɹ ɪɚɡɦɟɳɟɧɢɟ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɨɬɪɚɫɥɟɣ, ɩɨɞɱɢɧɟɧɧɵɯ
ɜɟɞɨɦɫɬɜɟɧɧɵɦ ɢɧɬɟɪɟɫɚɦ ɩɨ ɨɬɪɚɫɥɟɜɨɦɭ ɩɪɢɧɰɢɩɭ, ɧɟ ɨɪɢɟɧɬɢɪɨɜɚɧɵ ɧɚ ɤɨɧɟɱɧɵɟ ɧɚɪɨɞɧɨɯɨɡɹɣɫɬɜɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ. ɋɭɳɟɫɬɜɭɸɳɚɹ ɩɨ ɷɬɨɣ ɩɪɢɱɢɧɟ ɬɟɪɪɢɬɨɪɢɚɥɶɧɚɹ ɪɚɡɨɛɳɟɧɧɨɫɬɶ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢ ɜɡɚɢɦɨɫɜɹɡɚɧɧɵɯ ɨɬɪɚɫɥɟɣ ɧɟ ɩɨɡɜɨɥɹɟɬ ɷɮɮɟɤɬɢɜɧɨ ɪɟɚɥɢɡɨɜɵɜɚɬɶ ɨɝɪɨɦɧɵɟ ɜɨɡɦɨɠɧɨɫɬɢ ɫɵɪɶɟɜɨɣ ɛɚɡɵ ɪɟɫɩɭɛɥɢɤɢ, ɭɞɨɜɥɟɬɜɨɪɹɬɶ ɩɨɬɪɟɛɧɨɫɬɢ ɧɚɫɟɥɟɧɢɹ ɜ ɤɨɧɟɱɧɨɣ ɩɪɨɞɭɤɰɢɢ ɜ
ɩɨɥɧɨɦ ɨɛɴɟɦɟ ɢ ɚɫɫɨɪɬɢɦɟɧɬɟ. ɇɟ ɫɨɡɞɚɧ ɫɬɚɛɢɥɶɧɵɣ ɦɟɯɚɧɢɡɦ ɜɡɚɢɦɨɨɬɧɨɲɟɧɢɣ ɦɟɠɞɭ ɫɦɟɠɧɵɦɢ ɟɝɨ ɨɬɪɚɫɥɹɦɢ, ɨɬɫɭɬɫɬɜɭɟɬ ɤɨɦɩɥɟɤɫɧɨɫɬɶ ɢ ɫɥɚɠɟɧɧɨɫɬɶ ɜ ɩɪɨɰɟɫɫɟ ɩɪɨɞɜɢɠɟɧɢɹ ɩɪɨɞɭɤɬɚ
ɨɬ ɩɪɨɢɡɜɨɞɢɬɟɥɹ ɞɨ ɩɨɬɪɟɛɢɬɟɥɹ. ɇɟɫɦɨɬɪɹ ɧɚ ɩɪɢɧɹɬɵɟ ɦɟɪɵ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɩɨɞɞɟɪɠɤɢ ɞɨɥɹ
ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɜ ɨɛɳɟɦ ɨɛɴɟɦɟ ɩɪɨɢɡɜɨɞɫɬɜɚ ɨɫɬɚɟɬɫɹ ɧɢɡɤɨɣ.
Ɍɚɤ, ɜ 2013 ɝ. ɞɨɥɹ ɩɟɪɟɪɚɛɨɬɤɢ ɦɹɫɚ ɫɨɫɬɚɜɢɥɚ 24,9 %, ɦɨɥɨɤɚ – 22,4 %, ɡɟɪɧɚ – 31,41 %, ɩɥɨɞɨɜ ɢ
ɨɜɨɳɟɣ – 6,3 %. ɋɨɨɬɜɟɬɫɬɜɟɧɧɨ ɪɚɫɬɟɬ ɢɦɩɨɪɬ ɩɟɪɟɪɚɛɨɬɚɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɫ ɰɟɥɶɸ ɭɞɨɜɥɟɬɜɨɪɟɧɢɹ ɩɨɬɪɟɛɧɨɫɬɟɣ ɧɚɫɟɥɟɧɢɹ ɜ ɤɨɧɟɱɧɨɣ ɩɪɨɞɭɤɰɢɢ: ɞɨɥɹ ɢɦɩɨɪɬɚ ɦɨɥɨɤɚ ɢ ɫɥɢɜɨɤ (ɫɝɭɳɟɧɧɨɝɨ)
ɜɨ ɜɧɭɬɪɟɧɧɟɦ ɩɨɬɪɟɛɥɟɧɢɢ ɜ 2013 ɝ. ɫɨɫɬɚɜɢɥɚ 74,2 %, ɩɥɨɞɨɨɜɨɳɧɵɯ ɤɨɧɫɟɪɜɨɜ – 82,2, ɫɚɯɚɪɚ
(ɛɟɥɨɝɨ) – 22,7, ɤɨɧɞɢɬɟɪɫɤɢɯ ɢɡɞɟɥɢɣ – 63,9, ɤɨɥɛɚɫɧɵɯ ɢɡɞɟɥɢɣ – 46,0, ɫɵɪɚ ɢ ɬɜɨɪɨɝɚ – 53,8 %.
Ʉ ɨɫɧɨɜɧɵɦ ɮɚɤɬɨɪɚɦ, ɫɞɟɪɠɢɜɚɸɳɢɦ ɪɚɡɜɢɬɢɟ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɨɬɧɨɫɹɬɫɹ: – ɧɟɪɚɡɜɢɬɨɫɬɶ ɫɵɪɶɟɜɨɣ ɛɚɡɵ, ɱɬɨ ɯɚɪɚɤɬɟɪɢɡɭɟɬɫɹ ɧɟɞɨɫɬɚɬɨɱɧɨɫɬɶɸ ɫɵɪɶɹ, ɧɢɡɤɢɦ ɤɚɱɟɫɬɜɨɦ ɢ ɜɵɫɨɤɨɣ ɫɟɛɟɫɬɨɢɦɨɫɬɶɸ ɩɪɨɞɭɤɰɢɢ; – ɧɟɪɚɡɜɢɬɨɫɬɶ ɢɧɮɪɚɫɬɪɭɤɬɭɪɵ (ɩɪɢɟɦɧɵɯ
ɩɭɧɤɬɨɜ ɦɨɥɨɤɚ, ɭɛɨɣɧɵɯ ɰɟɯɨɜ, ɨɜɨɳɟɯɪɚɧɢɥɢɳ, ɨɩɬɨɜɨ – ɪɨɡɧɢɱɧɵɯ ɪɵɧɤɨɜ, ɨɪɝɚɧɢɡɚɰɢɢ ɩɨ
ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɟ, ɬɚɪɨɭɩɚɤɨɜɤɟ ɢ ɞɪ. ɫ ɫɨɜɪɟɦɟɧɧɵɦ ɨɛɨɪɭɞɨɜɚɧɢɟɦ); – ɪɨɫɬ ɰɟɧ ɧɚ ɦɚɬɟɪɢɚɥɶɧɨɬɟɯɧɢɱɟɫɤɢɟ ɪɟɫɭɪɫɵ, ɤɨɦɛɢɤɨɪɦɚ, ȽɋɆ, ɷɥɟɤɬɪɨɷɧɟɪɝɢɸ, ɜɨɞɭ ɢ ɞɪ.; – ɦɨɪɚɥɶɧɵɣ ɢ ɮɢɡɢɱɟɫɤɢɣ
ɢɡɧɨɫ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɨɪɭɞɨɜɚɧɢɹ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɩɪɟɞɩɪɢɹɬɢɣ, ɱɬɨ ɬɪɟɛɭɟɬ ɡɧɚɱɢɬɟɥɶɧɵɯ ɤɚɩɢɬɚɥɨɜɥɨɠɟɧɢɣ; – ɨɬɫɭɬɫɬɜɢɟ ɮɢɧɚɧɫɨɜ ɧɚ ɩɪɢɨɛɪɟɬɟɧɢɟ ɨɫɧɨɜɧɵɯ ɫɪɟɞɫɬɜ ɩɪɨɢɡɜɨɞɫɬɜɚ,
ɧɟɞɨɫɬɭɩɧɨɫɬɶ ɤɪɟɞɢɬɧɵɯ ɫɪɟɞɫɬɜ ɜ ɫɜɹɡɢ ɫ ɜɵɫɨɤɨɣ ɩɪɨɰɟɧɬɧɨɣ ɫɬɚɜɤɨɣ ɢ ɞɪ.
320
ɇɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɩɪɢɧɢɦɚɸɬɫɹ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɟ ɦɟɪɵ ɩɨ ɩɨɞɞɟɪɠɤɟ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɩɪɟɞɩɪɢɹɬɢɣ ȺɉɄ ɊɄ, ɧɚɩɪɚɜɥɟɧɧɵɟ ɧɚ ɪɚɡɜɢɬɢɟ ɫɵɪɶɟɜɨɣ ɛɚɡɵ, ɬɟɯɧɢɱɟɫɤɭɸ ɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɭɸ ɦɨɞɟɪɧɢɡɚɰɢɸ ɨɬɪɚɫɥɢ, ɜ ɱɚɫɬɧɨɫɬɢ: – ɩɨɞɞɟɪɠɤɚ ɪɚɡɜɢɬɢɹ ɩɥɟɦɟɧɧɨɝɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ ɩɭɬɟɦ ɫɭɛɫɢɞɢɪɨɜɚɧɢɹ ɩɥɟɦɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɫɬɨɢɦɨɫɬɢ ɤɨɦɛɢɤɨɪɦɨɜ,
ɦɨɞɟɪɧɢɡɚɰɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ; – ɫɨɡɞɚɧɢɟ ɨɬɤɨɪɦɨɱɧɵɯ ɤɨɦɩɥɟɤɫɨɜ,
ɦɨɥɨɱɧɨ-ɬɨɜɚɪɧɵɯ ɮɟɪɦ, ɬɟɩɥɢɱɧɵɯ ɯɨɡɹɣɫɬɜ ɢ ɞɪ. ɩɪɨɪɵɜɧɵɟ ɩɪɨɟɤɬɵ ɩɨ ɪɚɡɜɢɬɢɸ ɫɟɥɶɫɤɨɝɨ
ɯɨɡɹɣɫɬɜɚ ɪɟɫɩɭɛɥɢɤɢ; – ɫɭɛɫɢɞɢɪɨɜɚɧɢɟ ɫɬɚɜɤɢ ɜɨɡɧɚɝɪɚɠɞɟɧɢɹ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɩɪɟɞɩɪɢɹɬɢɣ
ɩɨ ɤɪɟɞɢɬɚɦ, ɩɨ ɥɢɡɢɧɝɭ ɨɛɨɪɭɞɨɜɚɧɢɹ, ɫɬɨɢɦɨɫɬɢ ɭɫɥɭɝ ɩɨ ɜɧɟɞɪɟɧɢɸ ɦɟɠɞɭɧɚɪɨɞɧɵɯ ɫɬɚɧɞɚɪɬɨɜ; – ɫɨɤɪɚɳɟɧɢɟ ɧɚɥɨɝɨɜɨɣ ɧɚɝɪɭɡɤɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɩɪɟɞɩɪɢɹɬɢɣ ɩɨ ɜɵɩɥɚɬɟ ɇȾɋ ɢ ɞɪ.
ɉɪɨɜɟɞɟɧɧɵɣ ɚɧɚɥɢɡ ɫɨɫɬɨɹɧɢɹ ɢ ɪɚɡɜɢɬɢɹ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɨɬɪɚɫɥɢ ȺɉɄ ɪɟɫɩɭɛɥɢɤɢ ɨɛɨɫɧɨɜɵɜɚɸɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɪɟɲɟɧɢɹ ɫɥɟɞɭɸɳɢɯ ɡɚɞɚɱ: – ɨɛɟɫɩɟɱɢɬɶ ɜ ɫɠɚɬɵɟ ɫɪɨɤɢ ɬɟɯɧɢɱɟɫɤɨɟ
ɩɟɪɟɜɨɨɪɭɠɟɧɢɟ, ɪɟɤɨɧɫɬɪɭɤɰɢɸ, ɪɚɫɲɢɪɟɧɢɟ ɞɟɣɫɬɜɭɸɳɢɯ ɢ ɫɬɪɨɢɬɟɥɶɫɬɜɨ ɧɨɜɵɯ ɩɪɟɞɩɪɢɹɬɢɣ
ɢ ɰɟɯɨɜ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɩɪɨɝɪɟɫɫɢɜɧɵɯ ɪɟɫɭɪɫɨɫɛɟɪɟɝɚɸɳɢɯ ɬɟɯɧɨɥɨɝɢɣ ɢ ɩɟɪɟɞɨɜɨɣ ɬɟɯɧɢɤɢ; – ɩɪɨɜɨɞɢɬɶ ɪɚɛɨɬɵ ɩɨ ɪɚɰɢɨɧɚɥɶɧɨɦɭ ɪɚɡɦɟɳɟɧɢɸ ɩɪɟɞɩɪɢɹɬɢɣ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ, ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɟ, ɯɪɚɧɟɧɢɸ ɫɵɪɶɹ ɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɫ ɦɚɤɫɢɦɚɥɶɧɵɦ ɩɪɢɛɥɢɠɟɧɢɟɦ ɷɬɢɯ
ɩɪɟɞɩɪɢɹɬɢɣ ɤ ɦɟɫɬɚɦ ɩɪɨɢɡɜɨɞɫɬɜɚ, ɪɚɫɲɢɪɢɬɶ ɨɛɴɟɦɵ ɫɬɪɨɢɬɟɥɶɫɬɜɚ ɩɪɟɞɩɪɢɹɬɢɣ, ɰɟɯɨɜ ɢ ɩɪɨɢɡɜɨɞɫɬɜ ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨ ɜ ɯɨɡɹɣɫɬɜɚɯ; – ɪɚɡɜɢɜɚɬɶ ɢɧɬɟɝɪɚɰɢɸ ɢ ɤɨɨɩɟɪɚɰɢɸ ɜɫɟɯ ɡɜɟɧɶɟɜ ɜ
ɫɢɫɬɟɦɟ ɦɟɠɨɬɪɚɫɥɟɜɵɯ ɫɜɹɡɟɣ ȺɉɄ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
ɉɪɨɝɪɚɦɦɚ ɩɨ ɪɚɡɜɢɬɢɸ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ ɜ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ ɧɚ 2013 – 2020 ɝɨɞɵ
«Ⱥɝɪɨɛɢɡɧɟɫ – 2020» [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ], http://mgov.kz/
ɉɨɫɥɚɧɢɟ ɉɪɟɡɢɞɟɧɬɚ ɧɚɪɨɞɭ Ʉɚɡɚɯɫɬɚɧɚ «ɋɬɪɚɬɟɝɢɹ «Ʉɚɡɚɯɫɬɚɧ-2050», 11 ɧɨɹɛɪɹ 2014 [ɗɥɟɤɬɪɨɧɧɵɣ
ɪɟɫɭɪɫ], http://strategy2050.kz/ru/
Ⱦɨɪɨɠɧɚɹ ɤɚɪɬɚ ɩɨ ɩɨɞɞɟɪɠɤɟ ɢ ɪɚɡɜɢɬɢɸ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɢ ɩɢɳɟɜɨɣ
ɩɪɨɦɵɲɥɟɧɨɫɬɢ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ], http://mgov.kz/
ɋɟɥɶɫɤɨɟ, ɥɟɫɧɨɟ ɢ ɪɵɛɧɨɟ ɯɨɡɹɣɫɬɜɨ ɜ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ, Ⱥɝɟɧɬɫɬɜɨ ɩɨ ɫɬɚɬɢɫɬɢɤɟ ɊɄ, Ⱥɫɬɚɧɚ,
2013 [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ], http://www.stat.gov.kz/
ɍȾɄ 636.638, 636.15
Ʉ ɈȻɈɋɇɈȼȺɇɂɘ ɉɊɈȿɄɌȺ ɉɈ ɉȿɊȿɊȺȻɈɌɄȿ ɉɒȿɇɂɐɕ
ɇȺ ɉɈɅɍɎȺȻɊɂɄȺɌɕ ɉɊɈȾɍɄɌɈȼ ɊȺɐɂɈɇȺɅɖɇɈȽɈ
ɉɂɌȺɇɂə, ȻȿɅɄɈȼɕȿ ȾɈȻȺȼɄɂ
ȾɅə ȼɕɋɈɄɈɉɊɈȾɍɄɌɂȼɇɕɏ ɀɂȼɈɌɇɕɏ
ȾɈɇɑȿɇɄɈ Ⱥ.ɋ., ȿɊɆɈɏɂɇ ȼ.Ƚ.,
ɎȽȻɍ ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ, e-mail: 3480646@mail.ru
«Ɇɵ ɬɨɥɶɤɨ ɩɨɬɨɦɭ ɜɢɞɢɦ ɞɚɥɶɲɟ,
ɱɬɨ ɫɬɨɢɦ ɧɚ ɩɥɟɱɚɯ ɝɢɝɚɧɬɨɜ»
ɂ.ɇɶɸɬɨɧ
ɗɩɢɞɟɦɢɨɥɨɝɢɱɟɫɤɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ, ɩɪɨɜɨɞɢɦɵɟ ɜ ɩɨɫɥɟɞɧɢɟ ɞɟɫɹɬɢɥɟɬɢɹ ɷɤɨɧɨɦɢɱɟɫɤɢ ɪɚɡɜɢɬɵɦɢ ɫɬɪɚɧɚɦɢ ɦɢɪɚ ɢ Ɋɨɫɫɢɟɣ ɜ ɨɛɥɚɫɬɢ ɨɰɟɧɤɢ ɫɨɫɬɨɹɧɢɹ ɩɢɬɚɧɢɹ, ɷɧɟɪɝɨɬɪɚɬ ɢ ɡɞɨɪɨɜɶɹ ɧɚɫɟɥɟɧɢɹ, ɫɜɢɞɟɬɟɥɶɫɬɜɭɸɬ ɨ ɫɭɳɟɫɬɜɟɧɧɨɦ ɢɡɦɟɧɟɧɢɢ ɫɬɪɭɤɬɭɪɵ ɩɢɬɚɧɢɹ ɫɨɜɪɟɦɟɧɧɨɝɨ ɱɟɥɨɜɟɤɚ
[1]. ɉɪɢɱɟɦ, ɟɫɥɢ ɩɨɬɪɟɛɧɵɟ ɞɥɹ ɠɢɡɧɟɞɟɹɬɟɥɶɧɨɫɬɢ ɷɧɟɪɝɨɬɪɚɬɵ ɥɸɞɟɣ ɫɧɢɡɢɥɢɫɶ ɡɧɚɱɢɬɟɥɶɧɨ,
ɬɨ ɩɨɬɪɟɛɧɨɫɬɶ ɜ ɷɫɫɟɰɢɚɥɶɧɵɯ ɩɢɳɟɜɵɯ ɜɟɳɟɫɬɜɚɯ ɨɫɬɚɟɬɫɹ ɩɪɚɤɬɢɱɟɫɤɢ ɧɚ ɩɪɟɠɧɟɦ ɭɪɨɜɧɟ. ɂɡɡɚ ɷɬɨɝɨ ɬɪɚɞɢɰɢɨɧɧɵɟ ɪɚɰɢɨɧɵ ɩɢɬɚɧɢɹ, ɩɨɫɬɪɨɟɧɧɵɟ ɜ ɩɪɟɠɧɢɟ ɜɪɟɦɟɧɚ ɢ ɩɨɥɨɠɢɬɟɥɶɧɨ ɡɚɪɟɤɨɦɟɧɞɨɜɚɜɲɢɟ ɫɟɛɹ ɜ ɩɪɨɲɥɨɦ, ɧɟ ɩɪɢɟɦɥɟɦɵ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɢ ɢɯ ɩɪɚɤɬɢɱɟɫɤɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɩɪɢɜɨɞɢɬ ɤ ɧɟɝɚɬɢɜɧɵɦ ɩɨɫɥɟɞɫɬɜɢɹɦ. ɉɨ ɦɧɟɧɢɸ ɚɤɚɞɟɦɢɤɚ ɊȺɇ Ɍɭɬɟɥɶɹɧɚ ȼ.Ⱥ. ɜ ɭɫɥɨɜɢɹɯ
ɠɢɡɧɢ ɫɨɜɪɟɦɟɧɧɨɝɨ ɱɟɥɨɜɟɤɚ ɧɟɜɨɡɦɨɠɧɨ ɚɞɟɤɜɚɬɧɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɩɨɬɪɟɛɧɨɫɬɢ ɨɪɝɚɧɢɡɦɚ ɜɫɟɦɢ
ɧɟɨɛɯɨɞɢɦɵɦɢ ɞɥɹ ɩɨɞɞɟɪɠɚɧɢɹ ɟɝɨ ɠɢɡɧɟɞɟɹɬɟɥɶɧɨɫɬɢ ɩɢɳɟɜɵɦɢ ɢ ɦɢɧɨɪɧɵɦɢ ɛɢɨɥɨɝɢɱɟɫɤɢ
ɚɤɬɢɜɧɵɦɢ ɤɨɦɩɨɧɟɧɬɚɦɢ ɡɚ ɫɱɟɬ ɬɪɚɞɢɰɢɨɧɧɨɝɨ ɩɢɬɚɧɢɹ [1].
ɉɲɟɧɢɰɚ, ɹɜɥɹɹɫɶ ɢɫɬɨɪɢɱɟɫɤɢ ɨɫɧɨɜɧɵɦ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɵɦ ɫɵɪɶɟɦ Ɋɨɫɫɢɢ, ɢɦɟɟɬ ɨɬɧɨɫɢɬɟɥɶɧɨ ɜɵɫɨɤɨɟ ɫɨɞɟɪɠɚɧɢɟ ɷɧɟɪɝɢɢ ɢ ɦɚɥɨɟ ɫɨɞɟɪɠɚɧɢɟ ɛɟɥɤɚ. ɉɨɷɬɨɦɭ, ɪɚɰɢɨɧɵ ɩɨɫɬɪɨɟɧɧɵɟ
ɧɚ ɬɪɚɞɢɰɢɨɧɧɵɯ ɯɥɟɛɧɵɯ ɩɪɨɞɭɤɬɚɯ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɡɚɤɨɧɨɦɟɪɧɨ ɩɪɢɜɨɞɹɬ ɤ ɫɢɫɬɟɦɧɵɦ ɧɚ321
ɪɭɲɟɧɢɹɦ ɩɢɬɚɧɢɹ: ɥɢɛɨ ɱɟɥɨɜɟɤ ɩɪɢ ɚɞɟɤɜɚɬɧɨɦ ɷɧɟɪɝɨɩɨɬɪɟɛɥɟɧɢɢ ɢɫɩɵɬɵɜɚɟɬ ɧɟɯɜɚɬɤɭ ɛɟɥɤɚ,
ɥɢɛɨ ɩɪɢ ɨɛɟɫɩɟɱɟɧɢɢ ɧɨɪɦɚɬɢɜɧɨɝɨ ɫɨɞɟɪɠɚɧɢɹ ɛɟɥɤɚ ɜ ɪɚɰɢɨɧɟ ɩɨɬɪɟɛɥɹɟɬ ɱɪɟɡɦɟɪɧɨɟ ɤɨɥɢɱɟɫɬɜɨ ɷɧɟɪɝɢɢ. ɉɨɫɥɟɞɧɢɣ ɜɚɪɢɚɧɬ ɛɨɥɟɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧ. ɉɨ ɞɚɧɧɵɦ ɚɤɚɞɟɦɢɤɚ ɊȺɇ Ʌɢɫɢɰɢɧɚ
Ⱥ.Ȼ. ɜ ɊɎ 30 % ɥɢɰ ɬɪɭɞɨɫɩɨɫɨɛɧɨɝɨ ɜɨɡɪɚɫɬɚ ɢɦɟɸɬ ɨɠɢɪɟɧɢɟ, 25 % – ɢɡɛɵɬɨɱɧɭɸ ɦɚɫɫɭ ɬɟɥɚ
[2]. Ɉɞɧɨɜɪɟɦɟɧɧɨ ɧɚ ɷɬɨɦ ɮɨɧɟ ɩɨɹɜɥɹɟɬɫɹ ɜɫɟ ɛɨɥɶɲɟ ɥɸɞɟɣ (ɜ ɨɫɧɨɜɧɨɦ ɯɨɪɨɲɨ ɦɚɬɟɪɢɚɥɶɧɨ
ɨɛɟɫɩɟɱɟɧɧɵɯ) ɜɫɟɪɶɟɡ ɭɞɟɥɹɸɳɢɯ ɜɧɢɦɚɧɢɟ ɡɞɨɪɨɜɨɦɭ ɩɢɬɚɧɢɸ.
ɉɪɨɢɡɜɨɞɫɬɜɨ ɩɲɟɧɢɰɵ ɜ ɊɎ, ɤɚɤ ɩɪɚɜɢɥɨ, ɩɪɟɜɵɲɚɟɬ ɫɭɳɟɫɬɜɭɸɳɢɟ ɩɨɬɪɟɛɧɨɫɬɢ ɜɧɭɬɪɟɧɧɟɝɨ ɪɵɧɤɚ. ɉɪɢ ɷɬɨɦ ɩɨɬɟɧɰɢɚɥ Ɋɨɫɫɢɢ ɜ ɫɭɳɟɫɬɜɟɧɧɨɦ (ɤɪɚɬɧɨɦ) ɭɜɟɥɢɱɟɧɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ
ɧɚɭɱɧɨ ɞɨɤɚɡɚɬɟɥɟɧ.
ɉɨɷɬɨɦɭ ɧɟɨɛɯɨɞɢɦɨ ɨɬɤɚɡɚɬɶɫɹ ɨɬ ɬɪɚɞɢɰɢɨɧɧɵɯ ɦɟɬɨɞɨɜ ɩɟɪɟɪɚɛɨɬɤɢ ɩɲɟɧɢɰɵ (ɨɫɧɨɜɚɧɧɵɯ
ɧɚ ɦɭɤɟ ɨɬ ɨɛɨɣɧɨɣ ɞɨ «ɜɵɫɲɢɣ» ɫɨɪɬɨɜ) ɢ ɩɟɪɟɣɬɢ ɧɚ ɤɚɱɟɫɬɜɟɧɧɨ ɧɨɜɵɣ ɭɪɨɜɟɧɶ ɩɟɪɟɪɚɛɨɬɤɢ
ɷɬɨɝɨ ɠɢɡɧɟɧɧɨ ɜɚɠɧɨɝɨ ɞɥɹ Ɋɨɫɫɢɢ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ.
ɉɨ ɧɚɲɟɦɭ ɦɧɟɧɢɸ ɧɨɜɵɣ ɩɨɞɯɨɞ ɤ ɩɟɪɟɪɚɛɨɬɤɟ ɩɲɟɧɢɰɵ ɞɨɥɠɟɧ ɨɫɧɨɜɵɜɚɬɶɫɹ ɧɟ ɧɚ ɟɝɨ ɬɪɚɞɢɰɢɨɧɧɨɦ ɦɟɯɚɧɢɫɬɢɱɧɨɦ ɮɪɚɤɰɢɨɧɢɪɨɜɚɧɢɢ (ɨɬɪɭɛɢ, ɡɚɪɨɞɵɲɢ, ɫɥɨɢ ɷɧɞɨɫɩɟɪɦɚ) ɤɚɤ ɫɟɣɱɚɫ,
ɚ ɧɚ ɛɢɨɯɢɦɢɱɟɫɤɨɦ ɞɢɮɮɟɪɟɧɰɢɪɨɜɚɧɢɢ ɛɟɥɤɨɜɨɣ ɫɨɫɬɚɜɥɹɸɳɟɣ ɩɲɟɧɢɰɵ ɨɬ ɟɟ ɭɝɥɟɜɨɞɢɫɬɨɣ
(ɩɪɟɞɫɬɚɜɥɟɧɧɨɣ ɜ ɨɫɧɨɜɧɨɦ ɤɪɚɯɦɚɥɨɦ) ɱɚɫɬɢ. ɉɪɢ ɷɬɨɦ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɜɚɠɧɨ ɧɟ ɞɨɩɭɫɤɚɬɶ (ɦɢɧɢɦɢɡɢɪɨɜɚɬɶ) ɜ ɩɪɨɰɟɫɫɟ ɩɟɪɟɪɚɛɨɬɤɢ ɩɲɟɧɢɰɵ ɩɨɬɟɪɢ ɜɨɞɨɪɚɫɬɜɨɪɢɦɵɯ (ɧɚɢɛɨɥɟɟ ɰɟɧɧɵɯ ɞɥɹ
ɩɢɬɚɧɢɹ) ɛɟɥɤɨɜ. ɂɧɵɦɢ ɫɥɨɜɚɦɢ ɫ ɬɨɱɤɢ ɡɪɟɧɢɹ ɫɨɯɪɚɧɟɧɢɹ ɧɚɬɢɜɧɵɯ ɛɟɥɤɨɜɵɯ ɤɚɱɟɫɬɜ ɩɲɟɧɢɰɵ
ɧɟɥɶɡɹ ɩɪɚɤɬɢɤɨɜɚɬɶ ɟɟ ɪɚɡɞɟɥɟɧɢɟ ɧɚ ɤɪɚɯɦɚɥ ɢ ɝɥɸɬɟɧ.
Ȼɟɥɤɨɜɚɹ ɱɚɫɬɶ ɧɨɜɨɝɨ ɩɪɨɞɭɤɬɚ ɩɟɪɟɪɚɛɨɬɤɢ ɩɲɟɧɢɰɵ ɩɨɡɜɨɥɢɬ (ɩɨɞɨɛɧɨ ɩɚɥɨɱɤɢ-ɜɵɪɭɱɚɥɨɱɤɢ) ɪɟɡɭɥɶɬɚɬɢɜɧɨ ɛɚɥɚɧɫɢɪɨɜɚɬɶ ɩɨ ɛɟɥɤɭ ɢ ɷɧɟɪɝɢɢ ɪɚɰɢɨɧ ɩɢɬɚɧɢɹ ɲɢɪɨɤɢɯ ɫɥɨɟɜ ɧɚɫɟɥɟɧɢɹ: ɨɬ
ɦɚɥɨɢɦɭɳɢɯ (ɫɨɰɢɚɥɶɧɨɟ ɩɢɬɚɧɢɟ) ɞɨ ɫɨɫɬɨɹɬɟɥɶɧɵɯ (ɷɥɢɬɧɵɟ ɮɢɬɧɟɫ-ɩɪɨɞɭɤɬɵ). ɉɪɢɱɟɦ, ɧɚɭɱɧɨ-ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɢɣ ɩɨɞɯɨɞ ɤ ɩɪɨɟɤɬɢɪɨɜɚɧɢɸ ɬɚɤɢɯ ɩɪɨɞɭɤɬɨɜ ɞɢɚɥɟɤɬɢɱɟɫɤɢ ɟɞɢɧ ɢ ɜɨ ɦɧɨɝɨɦ
ɭɧɢɮɢɰɢɪɨɜɚɧ.
ɗɧɟɪɝɟɬɢɱɟɫɤɚɹ (ɤɪɚɯɦɚɥɢɫɬɚɹ) ɱɚɫɬɶ ɩɟɪɟɪɚɛɨɬɤɢ ɩɲɟɧɢɰɵ ɜ ɨɛɳɟɦ ɫɥɭɱɚɟ ɞɥɹ ɩɢɳɟɜɵɯ ɰɟɥɟɣ ɜ ɭɫɥɨɜɢɹɯ ɫɨɜɪɟɦɟɧɧɨɝɨ ɷɤɨɧɨɦɢɤɨ-ɫɨɰɢɚɥɶɧɨɝɨ ɫɨɫɬɨɹɧɢɹ ɊɎ ɦɚɥɨɰɟɧɧɚ. Ɉɞɧɚɤɨ, ɩɨ ɥɢɧɢɢ
ɈɈɇ ɦɨɠɟɬ ɛɵɬɶ ɷɮɮɟɤɬɢɜɧɚ ɜ ɤɚɱɟɫɬɜɟ ɝɭɦɚɧɢɬɚɪɧɵɯ ɩɪɨɞɭɤɬɨɜ ɞɥɹ ɧɚɫɟɥɟɧɢɹ ɛɟɞɫɬɜɭɸɳɢɯ
ɪɟɝɢɨɧɨɜ ɩɥɚɧɟɬɵ. Ⱦɥɹ ɜɧɭɬɪɟɧɧɟɝɨ ɪɵɧɤɚ ɩɪɨɝɧɨɡɧɨ ɚɤɬɭɚɥɶɧɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɷɬɨɣ ɱɚɫɬɢ ɩɟɪɟɪɚɛɨɬɤɢ ɩɲɟɧɢɰɵ ɧɚ ɷɤɨɥɨɝɢɱɟɫɤɢɟ ɰɟɥɢ: ɜ ɤɚɱɟɫɬɜɟ ɭɩɚɤɨɜɨɱɧɵɯ ɦɚɬɟɪɢɚɥɨɜ ɢɡ ɛɢɨɪɚɡɥɚɝɚɟɦɵɯ
ɩɨɥɢɦɟɪɨɜ.
Ʉɨɪɦɨɜɚɹ ɫɨɫɬɚɜɥɹɸɳɚɹ ɩɪɨɟɤɬɚ.
Ƚɟɧɟɬɢɱɟɫɤɢɣ ɩɨɬɟɧɰɢɚɥ ɫɨɜɪɟɦɟɧɧɵɯ ɩɨɪɨɞ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɬɪɟɛɭɟɬ ɧɚɫɵɳɟɧɢɹ ɢɯ ɤɨɪɦɨɜɨɝɨ ɪɚɰɢɨɧɚ ɜɵɫɨɤɨɣ ɤɨɧɰɟɧɬɪɚɰɢɟɣ ɛɟɥɤɚ. Ɍɪɚɞɢɰɢɨɧɧɵɟ ɛɟɥɤɨɜɵɟ ɞɨɛɚɜɤɢ
ɠɢɜɨɬɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ (ɦɹɫɨɤɨɫɬɧɚɹ ɦɭɤɚ, ɪɵɛɧɚɹ ɦɭɤɚ) ɞɨɪɨɝɨɫɬɨɹɳɢ ɢ ɡɚɱɚɫɬɭɸ ɢɦɟɸɬ ɧɟɭɞɨɜɥɟɬɜɨɪɢɬɟɥɶɧɨɟ ɩɪɚɤɬɢɱɟɫɤɨɟ ɤɚɱɟɫɬɜɨ (ɜ ɨɫɧɨɜɧɨɦ ɩɨ ɦɢɤɪɨɛɢɨɥɨɝɢɢ).
Ʉɪɭɩɧɵɦ ɦɢɪɨɜɵɦ (ɧɨ ɤ ɫɨɠɚɥɟɧɢɸ ɧɟ ɪɨɫɫɢɣɫɤɢɦ) ɢɧɧɨɜɚɰɢɨɧɧɵɦ ɭɫɩɟɯɨɦ XX ɜɟɤɚ ɹɜɢɥɚɫɶ ɜɵɫɨɤɨɪɚɡɜɢɬɚɹ ɢɧɞɭɫɬɪɢɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɪɢɫɬɚɥɥɢɱɟɫɤɢɯ ɚɦɢɧɨɤɢɫɥɨɬ (ɥɢɡɢɧɚ, ɦɟɬɢɨɧɢɧɚ, ɬɪɟɨɧɢɧɚ). ɇɟɫɤɨɥɶɤɨ (ɩɨɪɹɞɤɚ ɫɟɦɢ) ɦɚɤɪɨɮɢɪɦ ɡɚɤɪɵɜɚɸɬ ɦɢɪɨɜɨɣ ɪɵɧɨɤ ɤɪɢɫɬɚɥɥɢɱɟɫɤɢɯ
ɚɦɢɧɨɤɢɫɥɨɬ (ɦɢɤɪɨɛɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ) ɞɥɹ ɩɢɳɟɜɵɯ ɩɪɨɢɡɜɨɞɫɬɜ ɢ ɤɨɪɦɨɜɵɯ ɞɨɛɚɜɨɤ ɞɥɹ
ɩɪɨɦɵɲɥɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫɜɢɧɢɧɵ, ɩɬɢɰɟɩɪɨɞɭɤɬɨɜ.
ɇɚ ɫɟɝɨɞɧɹ ɤɪɢɫɬɚɥɥɢɱɟɫɤɢɟ ɚɦɢɧɨɤɢɫɥɨɬɵ – ɩɪɚɤɬɢɱɟɫɤɢ ɧɟɩɪɟɦɟɧɧɵɣ ɢɧɝɪɟɞɢɟɧɬ ɤɨɪɦɨɫɦɟɫɟɣ ɜɫɟɯ ɫɜɢɧɨɤɨɦɩɥɟɤɫɨɜ ɢ ɩɬɢɰɟɮɚɛɪɢɤ ɊɎ. ɉɨ ɞɚɧɧɵɦ ɚɤɚɞɟɦɢɤɚ ɊȺɇ Ɏɢɫɢɧɢɧɚ ȼ.ɂ. ɞɨɥɹ
ɤɪɢɫɬɚɥɥɢɱɟɫɤɨɝɨ ɥɢɡɢɧɚ ɜ ɪɚɰɢɨɧɟ ɜɵɫɨɤɨɩɪɨɞɭɤɬɢɜɧɵɯ ɰɵɩɥɹɬ-ɛɪɨɣɥɟɪɨɜ ɨɬ ɨɛɳɟɝɨ ɨɛɴɟɦɚ
ɥɢɡɢɧɚ ɜ ɪɚɰɢɨɧɟ ɫɨɫɬɚɜɥɹɟɬ 19 % [3], ɚ ɩɨ ɞɚɧɧɵɦ ɚɤɚɞɟɦɢɤɚ ɊȺɇ Ɋɹɞɱɢɤɨɜɚ ȼ.Ƚ. ɪɚɰɢɨɧɚɥɶɧɵɣ
ɨɛɴɟɦ ɤɪɢɫɬɚɥɥɢɱɟɫɤɨɝɨ ɥɢɡɢɧɚ ɜ ɪɚɰɢɨɧɟ ɷɥɢɬɧɵɯ ɩɨɪɨɞ ɫɜɢɧɟɣ ɫɨɫɬɚɜɥɹɟɬ 34 % [4]. ȿɳɟ ɪɚɡ
ɩɨɞɱɟɪɤɧɟɦ, ɜɫɟ ɫɢɧɬɟɬɢɱɟɫɤɢɟ ɚɦɢɧɨɤɢɫɥɨɬɵ ɧɚ 100 % ɩɨɫɬɚɜɥɹɸɬɫɹ ɢɡ-ɡɚ ɪɭɛɟɠɚ, ɢɯ ɫɨɛɫɬɜɟɧɧɨɟ ɩɪɨɢɡɜɨɞɫɬɜɨ ɜ Ɋɨɫɫɢɢ ɩɨɥɧɨɫɬɶɸ ɨɬɫɭɬɫɬɜɭɟɬ.
ɋ ɰɟɥɶɸ ɪɟɚɥɢɡɚɰɢɢ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɡɚɞɚɱɢ ɢɦɩɨɪɬɨɡɚɦɟɳɟɧɢɹ ɩɪɢɦɟɧɢɬɟɥɶɧɨ ɤ ɤɪɢɫɬɚɥɥɢɱɟɫɤɢɦ ɚɦɢɧɨɤɢɫɥɨɬɚɦ (ɥɢɡɢɧɭ, ɦɟɬɢɨɧɢɧɭ, ɬɪɟɨɧɢɧɭ), ɤɚɤ ɤɥɸɱɟɜɵɦ ɛɟɥɤɨɜɵɦ ɢɧɝɪɟɞɢɟɧɬɚɦ
ɫɨɜɪɟɦɟɧɧɵɯ ɤɨɦɛɢɤɨɪɦɨɜ, ɨɱɟɜɢɞɧɨ ɫɜɨɟɜɪɟɦɟɧɧɚ ɢ ɰɟɥɟɫɨɨɛɪɚɡɧɚ ɩɟɪɟɪɚɛɨɬɤɚ ɨɬɟɱɟɫɬɜɟɧɧɨɣ
ɮɭɪɚɠɧɨɣ ɩɲɟɧɢɰɵ ɧɚ ɛɟɥɤɨɜɵɟ (ɚɦɢɧɨɤɢɫɥɨɬɧɵɟ) ɞɨɛɚɜɤɢ ɞɥɹ ɜɵɫɨɤɨɩɪɨɞɭɤɬɢɜɧɵɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ.
ɋɯɟɦɚ ɩɪɨɟɤɬɚ ɞɢɮɮɟɪɟɧɰɢɪɨɜɚɧɧɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɚ (ɩɲɟɧɢɰɵ) ɩɨɤɚɡɚɧɚ ɧɚ ɪɢɫɭɧɤɟ.
ɋɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɜ ɫɥɭɱɚɟ ɭɫɩɟɲɧɨɣ ɪɟɚɥɢɡɚɰɢɢ ɢɡɥɨɠɟɧɧɵɯ ɩɨɞɯɨɞɨɜ ɤ ɩɟɪɟɪɚɛɨɬɤɟ
ɩɲɟɧɢɰɵ (ɧɚ ɩɢɳɟɜɵɟ, ɤɨɪɦɨɜɵɟ, ɷɤɨɥɨɝɢɱɧɵɟ ɰɟɥɢ) ɜɨɡɪɚɫɬɚɸɬ ɩɨɬɪɟɛɧɨɫɬɢ ɜ ɭɜɟɥɢɱɟɧɢɢ ɟɟ
ɩɪɨɢɡɜɨɞɫɬɜɚ ɜ ɊɎ, ɩɨɷɬɨɦɭ ɬɨɜɚɪɨɩɪɨɢɡɜɨɞɢɬɟɥɹɦ ɡɟɪɧɚ ɝɢɩɨɬɟɬɢɱɟɫɤɢ ɨɛɟɫɩɟɱɢɜɚɟɬɫɹ ɫɬɚɛɢɥɶɧɚɹ ɩɪɢɛɵɥɶɧɨɫɬɶ ɨɬ ɟɟ ɫɛɵɬɚ.
322
ɋɯɟɦɚ ɞɢɮɮɟɪɟɧɰɢɪɨɜɚɧɧɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɚ (ɩɲɟɧɢɰɵ)
ɐɟɥɢ ɩɪɨɟɤɬɚ:
ɇɚɭɱɧɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɩɟɪɟɪɚɛɨɬɤɢ ɩɲɟɧɢɰɵ ɧɚ ɩɢɳɟɜɭɸ ɞɨɛɚɜɤɭ (ɩɨɥɭɮɚɛɪɢɤɚɬ) ɤɚɱɟɫɬɜɟɧɧɨɝɨ ɛɟɥɤɨɜɨ-ɷɧɟɪɝɢɬɢɱɟɫɤɨɝɨ ɫɨɞɟɪɠɚɧɢɹ, ɩɨɡɜɨɥɹɸɳɟɣ ɨɛɟɫɩɟɱɢɬɶ ɩɨɬɪɟɛɧɨɫɬɶ ɲɢɪɨɤɢɯ ɫɥɨɟɜ
ɧɚɫɟɥɟɧɢɹ ɜ ɚɫɫɨɪɬɢɦɟɧɬɟ ɯɥɟɛɧɵɯ ɩɪɨɞɭɤɬɨɜ, ɨɬɜɟɱɚɸɳɢɯ ɬɪɟɛɨɜɚɧɢɹɦ ɧɨɪɦ ɪɚɰɢɨɧɚɥɶɧɨɝɨ ɩɢɬɚɧɢɹ.
ɉɪɢɦɟɧɢɬɟɥɶɧɨ ɤ ɤɨɪɦɥɟɧɢɸ ɜɵɫɨɤɨɩɪɨɞɭɤɬɢɜɧɵɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ ɨɛɟɫɩɟɱɢɬɶ ɢɦɩɨɪɬɨɡɚɦɟɳɟɧɢɟ ɤɪɢɫɬɚɥɥɢɱɟɫɤɢɯ ɚɦɢɧɨɤɢɫɥɨɬ ɧɚ ɛɟɥɤɨɜɵɟ (ɚɦɢɧɨɤɢɫɥɨɬɧɵɟ) ɤɨɪɦɨɜɵɟ
ɞɨɛɚɜɤɢ ɢɡ ɩɲɟɧɢɰɵ.
ɉɪɟɞɥɨɠɢɬɶ ɫɵɪɶɟ ɢɯ ɤɪɚɯɦɚɥɢɫɬɨɣ ɱɚɫɬɢ ɩɲɟɧɢɰɵ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɷɤɨɥɨɝɢɱɧɵɯ ɭɩɚɤɨɜɨɱɧɵɯ ɦɚɬɟɪɢɚɥɨɜ.
Ɋɚɡɪɚɛɨɬɚɬɶ ɩɪɟɞɥɨɠɟɧɢɹ ɩɨ ɩɪɨɢɡɜɨɞɫɬɜɭ ɢɡ ɤɪɚɯɦɚɥɢɫɬɨɣ ɱɚɫɬɢ ɩɲɟɧɢɰɵ ɝɭɦɚɧɢɬɚɪɧɵɯ
ɩɪɨɞɭɤɬɨɜ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
ɆɊ 2.3.1.1915-04. Ɋɚɰɢɨɧɚɥɶɧɨɟ ɩɢɬɚɧɢɟ. Ɋɟɤɨɦɟɧɞɭɟɦɵɟ ɭɪɨɜɧɢ ɩɨɬɪɟɛɥɟɧɢɹ ɩɢɳɟɜɵɯ ɢ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ (Ɋɭɤ. ɪɚɡɪɚɛɨɬɤɢ ɚɤɚɞ. Ɍɭɬɟɥɶɹɧ ȼ.Ⱥ.) . – Ɇ.: ɎɐȽɢɗɊ, 2004. – 46 ɫ.
Ʌɢɫɢɰɢɧ Ⱥ.Ȼ. ɇɚɭɱɧɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɩɪɨɞɭɤɬɨɜ ɡɞɨɪɨɜɨɝɨ ɩɢɬɚɧɢɹ /Ʌɢɫɢɰɢɧ Ⱥ.Ȼ., ɑɟɪɧɭɯɚ ɂ.Ɇ., Ƚɨɪɛɭɧɨɜɚ ɇ.Ⱥ. //ɏɪɚɧɟɧɢɟ ɢ ɩɟɪɟɪɚɛɨɬɤɚ ɫɟɥɶɯɨɡɫɵɪɶɹ –
2012. – ʋ10.– ɋ.8–14.
Ɏɢɫɢɧɢɧ ȼ.ɂ., ȿɝɨɪɨɜ ɂ.Ⱥ., Ⱦɪɚɝɚɧɨɜ ɂ.Ɏ. Ʉɨɪɦɥɟɧɢɟ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɬɢɰɵ. – Ɇ.: ȽɗɈɌȺɊɆɟɞɢɚ, 2011. – 344 ɫ.
Ɋɹɞɱɢɤɨɜ ȼ.Ƚ. Ɉɫɧɨɜɵ ɩɢɬɚɧɢɹ ɢ ɤɨɪɦɥɟɧɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ: ɭɱɟɛɧɨ-ɩɪɚɤɬɢɱɟɫɤɨɟ
ɩɨɫɨɛɢɟ. – Ʉɪɚɫɧɨɞɚɪ: ɄɭɛȽȺɍ, 2012 .- 328 ɫ.
ɍȾɄ 636.32/38.3.082
ɗɎɎȿɄɌɂȼɇɕȿ ɋɉɈɋɈȻɕ ɄɈɇɋȿɊȼɂɊɈȼȺɇɂȿ
ɂ ɏɊȺɇȿɇɂȿ ɒɍȻɇɈȽɈ ɋɕɊɖə
ɁȺɊɉɍɅɅȺȿȼ ɒ.ɇ., ɀɍɆȺɇȻȿɄɈȼ Ⱥ.ɋ., ȺȻɂɅɖȾȺȻȿɄɈȼ Ɍ.Ⱥ.,
ɌɈɈ «ɘɝɨ-Ɂɚɩɚɞɧɵɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ», ɝ. ɒɵɦɤɟɧɬ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, e-mail: karakul-00@mail.ru
ɉɪɢ ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɢ ɲɭɛɧɨ-ɦɟɯɨɜɨɝɨ ɫɵɪɶɹ ɞɨ ɧɚɫɬɨɹɳɟɝɨ ɜɪɟɦɟɧɢ ɩɪɢɦɟɧɹɟɬɫɹ ɩɨɜɚɪɟɧɧɚɹ
ɫɨɥɶ. Ɉɞɧɚɤɨ, ɩɨɜɚɪɟɧɧɚɹ ɫɨɥɶ ɧɟ ɝɚɪɚɧɬɢɪɭɟɬ ɜɵɫɨɤɭɸ ɫɨɯɪɚɧɧɨɫɬɶ ɲɤɭɪ, ɩɨɷɬɨɦɭ ɞɥɹ ɭɫɢɥɟɧɢɹ
ɤɨɧɫɟɪɜɢɪɭɸɳɟɝɨ ɫɜɨɣɫɬɜɚ ɫɨɥɢ ɪɟɤɨɦɟɧɞɭɟɬɫɹ ɞɪɭɝɢɟ ɜɟɳɟɫɬɜɚ, ɨɛɥɚɞɚɸɳɢɣ ɛɚɤɬɟɪɢɨɫɬɚɬɢɱɟɫɤɢɦ ɢ ɞɟɡɢɧɮɟɤɰɢɨɧɧɵɦ ɞɟɣɫɬɜɢɟɦ, ɩɪɟɞɨɯɪɚɧɹɸɳɢɣ ɲɤɭɪ ɨɬ ɪɚɡɜɢɬɢɹ ɩɨɪɨɤɨɜ ɫɧɢɠɚɸɳɢɯ
323
ɤɚɱɟɫɬɜɚ ɲɭɛɧɨ-ɦɟɯɨɜɨɝɨ-ɤɨɠɟɜɟɧɧɨɝɨ ɫɵɪɶɹ. Ɉɞɧɚɤɨ, ɜ ɩɨɫɥɟɞɧɟɟ ɜɪɟɦɹ ɷɬɢ ɚɧɬɢɫɟɩɬɢɤɢ, ɤɚɤ
ɩɚɪɚɞɢɯɥɨɪɛɟɧɡɨɥ, ɧɚɮɬɚɥɢɧ ɢ ɤɪɟɦɧɨɮɬɨɪɢɫɬɵɣ ɧɚɬɪɢɣ ɫɬɚɥɢ ɬɪɭɞɧɨɞɨɫɬɭɩɧɵɦɢ ɢ ɞɨɪɨɝɢɦɢ.
ȼ ɷɬɨɦ ɚɫɩɟɤɬɟ ɩɟɪɫɩɟɤɬɢɜɧɵɦ ɧɚɩɪɚɜɥɟɧɢɟɦ ɹɜɥɹɟɬɫɹ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɢ ɞɪɭɝɢɯ
ɪɚɫɬɟɧɢɣ, ɩɨɫɤɨɥɶɤɭ ɥɟɤɚɪɫɬɜɟɧɧɵɟ ɪɚɫɬɟɧɢɹ ɬɚɤɢɟ ɤɚɤ ɤɚɥɟɧɞɭɥɚ ɥɟɤɚɪɫɬɜɟɧɧɚɹ, ɩɢɠɦɚ ɨɛɵɤɧɨɜɟɧɧɚɹ, ɬɵɫɹɱɟɥɢɫɬɧɢɤ ɨɛɵɤɧɨɜɟɧɧɵɣ, ɦɟɥɢɫɫɚ ɥɟɤɚɪɫɬɜɟɧɧɚɹ, ɱɢɫɬɨɬɟɥ ɛɨɥɶɲɨɣ ɜ ɜɟɬɟɪɢɧɚɪɧɨɣ
ɩɪɚɤɬɢɤɟ ɢɫɩɨɥɶɡɭɟɬ ɩɪɨɬɢɜ ɱɟɫɨɬɤɢ, ɷɤɡɟɦɵ ɠɢɜɨɬɧɵɯ. ɏɨɬɹ ɮɥɨɪɚ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ ɛɨɝɚɬɵ
ɷɬɢɦɢ ɤɭɥɶɬɭɪɚɦɢ, ɢɯ ɷɤɫɬɪɚɤɬɵ, ɧɚɫɬɨɣ ɞɨ ɫɢɯ ɩɨɪ ɧɟ ɧɚɲɥɢ ɲɢɪɨɤɨɝɨ ɩɪɢɦɟɧɟɧɢɹ ɩɪɢ ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɢ ɲɤɭɪ.
ȼ ɯɨɡɹɣɫɬɜɚɯ ɪɚɡɧɵɯ ɮɨɪɦ ɫɨɛɫɬɜɟɧɧɨɫɬɢ ɞɥɹ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɨɝɨ ɫɵɪɶɹ ɧɟɨɛɯɨɞɢɦɨ ɫɨɡɞɚɬɶ
ɨɩɬɢɦɚɥɶɧɵɟ ɭɫɥɨɜɢɹ ɯɪɚɧɟɧɢɹ. ȼ ɬɨ ɠɟ ɜɪɟɦɹ ɫɭɳɟɫɬɜɭɸɳɢɟ ɦɟɬɨɞɵ ɯɪɚɧɟɧɢɹ ɧɟ ɜ ɩɨɥɧɨɣ ɦɟɪɟ
ɨɛɟɫɩɟɱɢɜɚɸɬ ɫɨɯɪɚɧɟɧɢɟ ɤɚɱɟɫɬɜɚ, ɩɨɷɬɨɦɭ ɧɟɨɛɯɨɞɢɦɨ ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɬɶ ɫɩɨɫɨɛɵ ɢɯ ɯɪɚɧɟɧɢɹ
ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɪɚɫɬɟɧɢɣ, ɨɛɥɚɞɚɸɳɢɟ ɢɧɫɟɤɬɢɰɢɞɧɵɦɢ ɞɟɣɫɬɜɢɹɦɢ.
ɂɧɫɟɤɬɢɰɢɞɧɵɟ ɪɚɫɬɟɧɢɹ, ɤɚɤ ɝɚɪɦɚɥɚ ɨɛɵɤɧɨɜɟɧɧɚɹ ɢɫɩɵɬɚɧɚ ɩɪɨɬɢɜ ɬɥɟɣ, ɪɨɦɚɲɤɚ ɞɚɥɦɚɬɫɤɚɹ ɩɪɢɦɟɧɹɟɬɫɹ ɞɥɹ ɛɨɪɶɛɵ ɫ ɛɵɬɨɜɵɦɢ ɧɚɫɟɤɨɦɵɦɢ. ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɢɧɫɟɤɬɢɰɢɞɧɵɯ ɪɚɫɬɟɧɢɣ ɩɪɢ ɞɟɡɢɧɮɟɤɰɢɣ ɩɨɦɟɳɟɧɢɣ, ɝɞɟ ɯɪɚɧɢɬɫɹ ɲɭɛɧɨ-ɦɟɯɨɜɨɟ ɫɵɪɶɟ, ɹɜɥɹɟɬɫɹ ɩɟɪɫɩɟɤɬɢɜɧɵɦ ɦɟɪɨɩɪɢɹɬɢɟɦ ɩɪɢ ɯɪɚɧɟɧɢɢ ɲɤɭɪ ɨɜɟɰ.
ɇɚɦɢ ɨɩɪɟɞɟɥɟɧɵ ɬɨɜɚɪɧɨ-ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ ɨɜɱɢɧ ɦɨɥɨɞɧɹɤɚ ɤɚɡɚɯɫɤɢɯ ɝɪɭɛɨɲɟɪɫɬɧɵɯ ɤɭɪɞɸɱɧɵɯ ɨɜɟɰ ɩɨɫɥɟ ɢɯ ɜɟɫɟɧɧɟɝɨ ɧɚɝɭɥɚ.
Ɉɫɧɨɜɧɵɦ ɤɪɢɬɟɪɢɟɦ ɩɪɢ ɬɨɜɚɪɧɨɣ ɨɰɟɧɤɟ ɨɜɱɢɧ ɹɜɥɹɟɬɫɹ ɟɟ ɩɥɨɳɚɞɶ. ɉɥɨɳɚɞɶ ɲɤɭɪɵ ɦɨɥɨɞɧɹɤɚ ɫɨɫɬɚɜɢɥɚ 96 ɞɦ 2. Ⱥ ɨɩɪɟɞɟɥɹɸɳɢɦ ɟɟ ɩɪɨɢɡɜɨɞ-ɫɬɜɟɧɧɨɟ ɧɚɡɧɚɱɟɧɢɟ ɹɜɥɹɟɬɫɹ ɬɨɥɳɢɧɚ
ɤɨɠɟɜɨɣ ɬɤɚɧɢ, ɤɨɬɨɪɚɹ ɭ ɦɨɥɨɞɧɹɤɚ ɤɭɪɞɸɱɧɵɯ ɨɜɟɰ ɫɨɫɬɚɜɢɥɚ 2,93 ɦɦ.
ȼɨ ɜɬɨɪɨɣ ɞɟɤɚɞɟ ɦɨɥɨɞɧɹɤ, ɪɟɚɥɢɡɭɟɦɵɣ ɧɚ ɦɹɫɨ, ɩɨɫɥɟ ɜɟɫɟɧɧɟɝɨ ɧɚɝɭɥɚ ɛɵɥ ɩɪɟɞɜɚɪɢɬɟɥɶɧɨ
ɨɫɬɪɢɠɟɧ. ɉɪɢ ɭɛɨɟ ɦɨɥɨɞɧɹɤɚ ɩɨɫɥɟ ɧɚɝɭɥɚ ɞɥɢɧɚ ɲɟɪɫɬɧɨɝɨ ɩɨɤɪɨɜɚ ɫɨɫɬɚɜɢɥɚ ɜ ɫɪɟɞɧɟɦ 3,3
ɫɦ, ɩɨ ɞɥɢɧɟ ɲɟɪɫɬɧɨɝɨ ɩɨɤɪɨɜɚ ɨɜɱɢɧɵ ɫɨɨɬɜɟɬɫɬɜɨɜɚɥɢ ɬɪɟɛɨɜɚɧɢɹɦ ɥɟɝɤɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ,
ɩɪɟɞɴɹɜɥɹɟɦɵɟ ɤ ɩɨɥɭɲɟɪɫɬɧɵɦ ɨɜɱɢɧɚɦ.
ɉɪɢ ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɢ ɲɤɭɪɵ ɦɨɥɨɞɧɹɤɚ ɤɭɪɞɸɱɧɵɯ ɨɜɟɰ ɞɥɹ ɭɫɢɥɟɧɢɹ ɤɨɧɫɟɪɜɢɪɭɸɳɟɝɨ
ɫɜɨɣɫɬɜɚ ɜɦɟɫɬɟ ɫ ɩɨɜɚɪɟɧɧɨɣ ɫɨɥɶɸ ɢɫɩɨɥɶɡɨɜɚɧɵ ɥɟɤɚɪɫɬɜɟɧɧɵɟ ɪɚɫɬɟɧɢɹ (ɳɚɜɟɥɶ ɤɨɧɫɤɢɣ ɢ
ɥɨɩɭɯ ɛɨɥɶɲɨɣ). Ɉɩɵɬɧɵɟ ɩɚɪɬɢɢ ɲɤɭɪ ɦɨɥɨɞɧɹɤɚ ɩɨɫɥɟ ɨɛɪɹɞɤɢ ɢ ɨɫɬɵɜɚɧɢɹ ɪɚɫɫɬɢɥɚɥɢɫɶ ɧɚ
ɩɨɥ ɦɟɡɞɪɨɣ ɜɜɟɪɯ, ɬɳɚɬɟɥɶɧɨ ɪɚɫɩɪɚɜɥɹɥɢɫɶ ɢ ɢɡɦɟɥɶɱɟɧɧɵɟ ɥɢɫɬɶɹ ɛɚɤɬɟɪɢɰɢɞɧɵɯ ɪɚɫɬɟɧɢɣ
(ɳɚɜɟɥɶ ɤɨɧɫɤɢɣ ɢ ɥɨɩɭɯ ɛɨɥɶɲɨɣ) ɡɚɫɵɩɚɥɢ ɜ ɦɟɡɞɪɭ ɨɜɱɢɧ ɢɡ ɪɚɫɱɟɬɚ 20–25 ɝ ɧɚ 1 ɲɤɭɪɭ. ɉɚɪɬɢɢ
ɲɤɭɪ ɛɚɪɚɧɱɢɤɨɜ ɩɨɫɥɟ ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɹ ɨɫɬɚɜɥɟɧɵ ɧɚ 2–3 ɫɭɬɨɤ ɜɵɫɭɲɢɜɚɧɢɹ, ɪɚɫɯɨɞ ɩɨɜɚɪɟɧɧɨɣ ɫɨɥɢ ɫɨɫɬɚɜɢɥ 30 % ɨɬ ɦɚɫɫɵ ɲɤɭɪɵ. ɒɤɭɪɵ, ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɵɟ ɬɨɥɶɤɨ ɩɨɜɚɪɟɧɧɨɣ ɫɨɥɶɸ,
ɫɥɭɠɢɥɢ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ.
ɉɟɪɟɞ ɯɪɚɧɟɧɢɟɦ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɵɯ ɲɤɭɪ ɩɨɦɟɳɟɧɢɟ, ɩɨɫɥɟ ɬɳɚɬɟɥɶɧɨɣ ɨɱɢɫɬɤɢ, ɞɟɡɢɧɮɢɰɢɪɨɜɚɥɢ ɷɤɫɬɪɚɤɬɨɦ ɢɧɫɟɤɬɢɰɢɞɧɨɝɨ ɪɚɫɬɟɧɢɹ (ɷɤɫɬɪɚɤɬ ɚɧɚɛɚɡɢɫɚ). ɉɪɢ ɷɬɨɦ ɷɤɫɬɪɚɤɬɨɦ ɪɚɫɬɟɧɢɣ
ɩɨɛɪɵɡɝɨɜɚɥɢɫɶ ɜɧɭɬɪɟɧɧɢɟ ɫɬɟɧɤɢ ɢ ɩɨɥ.
ɒɤɭɪɵ ɲɬɚɛɟɥɹɦɢ ɯɪɚɧɢɥɢɫɶ ɧɚ ɩɨɜɟɪɯɧɨɫɬɢ ɠɟɥɟɡɧɨɣ ɫɟɬɤɢ, ɩɨɞɧɹɬɵɟ ɨɬ ɩɨɥɚ ɧɚ ɜɵɫɨɬɭ 40
ɫɦ. Ʉɨɦɧɚɬɚ, ɝɞɟ ɯɪɚɧɢɥɢɫɶ ɲɤɭɪɵ, ɛɵɥɚ ɡɚɬɟɦɧɟɧɧɨɣ, ɨɤɧɚ ɫ ɪɟɲɟɬɤɨɣ ɛɵɥɚ ɨɬɤɪɵɬɨɣ.
ȼ ɩɪɨɰɟɫɫɟ ɯɪɚɧɟɧɢɹ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɵɯ ɲɤɭɪ ɨɩɵɬɧɵɯ ɩɚɪɬɢɣ ɧɟ ɧɚɛɥɸɞɚɥɢɫɶ ɨɫɥɚɛɥɟɧɢɟ ɜɨɥɨɫɚ, ɞɪɹɛɥɨɫɬɶ, ɨɫɥɢɡɧɟɧɢɟ, ɤɪɚɫɧɨɬɚ ɢ ɝɧɢɥɨɫɬɧɵɣ ɡɚɩɚɯ, ɬɨ ɟɫɬɶ ɧɟ ɩɪɨɢɫɯɨɞɢɥɚ ɩɨɪɱɚ ɲɤɭɪɵ.
ɒɤɭɪɵ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɯɪɚɧɢɥɢɫɶ ɜ ɬɳɚɬɟɥɶɧɨ ɨɱɢɳɟɧɧɨɣ, ɧɨ ɧɟ ɞɟɡɢɧɮɢɰɢɪɨɜɚɧɧɨɣ
ɤɨɦɧɚɬɟ. ȼ ɩɪɨɰɟɫɫɟ ɯɪɚɧɟɧɢɹ ɭ ɩɚɪɬɢɢ ɨɜɱɢɧ ɢɡ ɤɨɧɬɪɨɥɶɧɨɣ ɝɪɭɩɩɵ ɧɚɛɥɸɞɚɥɢɫɶ ɡɚɬɟɦɧɟɧɧɵɟ
ɦɟɫɬɚ. ɉɪɢ ɨɫɦɨɬɪɟ ɧɚɛɥɸɞɚɥɢɫɶ ɩɨɹɜɥɟɧɢɟ ɦɨɥɟɣ, ɤɨɬɨɪɵɟ ɞɥɹ ɩɪɟɞɨɬɜɪɚɳɟɧɢɹ ɩɨɪɱɢ ɲɤɭɪ ɧɟɦɟɞɥɟɧɧɨ ɭɧɢɱɬɨɠɚɥɢ.
ɂɡɭɱɟɧɢɟ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɩɨɤɚɡɚɥɨ, ɱɬɨ ɫɬɨɢɦɨɫɬɶ 1 ɲɤɭɪɵ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ
ɭɛɨɹ ɦɨɥɨɞɧɹɤɚ ɝɪɭɛɨɲɟɪɫɬɧɵɯ ɤɭɪɞɸɱɧɵɯ ɨɜɟɰ ɩɨɫɥɟ ɢɯ ɜɟɫɟɧɧɟɝɨ ɧɚɝɭɥɚ ɢɡ ɤɨɧɬɪɨɥɶɧɨɣ ɢ
ɨɩɵɬɧɨɣ ɩɚɪɬɢɢ ɫɨɫɬɚɜɢɥ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 860 ɢ 1010 ɬɟɧɝɟ ɢ ɫ ɤɚɠɞɨɣ ɲɤɭɪɵ ɩɨɥɭɱɟɧɨ ɩɨ 290 ɢ
340 ɬɟɧɝɟ ɩɪɢɛɵɥɢ ɩɪɢ ɪɟɧɬɚɛɟɥɶɧɨɫɬɢ 32,3 ɢ 50,7 %. ɉɪɢ ɪɟɚɥɢɡɚɰɢɢ ɲɤɭɪ ɩɨɫɥɟ ɢɯ ɩɟɪɜɢɱɧɨɣ
ɩɟɪɟɪɚɛɨɬɤɢ (ɫɴɟɦɤɚ, ɨɛɪɹɞɤɚ, ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɟ) ɨɬ ɤɚɠɞɨɣ ɲɤɭɪɤɢ, ɩɨɥɭɱɟɧɧɨɝɨ ɨɬ ɭɛɨɹ ɦɨɥɨɞɧɹɤɚ ɩɨɫɥɟ ɢɯ ɜɟɫɟɧɧɟɝɨ ɧɚɝɭɥɚ, ɢɡ ɨɩɵɬɧɨɣ ɩɚɪɬɢɢ ɩɨɥɭɱɟɧɨ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 340 ɬɟɧɝɟ ɩɪɢɛɵɥɢ,
ɱɬɨ ɧɚ 130 ɬɟɧɝɟ ɛɨɥɶɲɟ, ɱɟɦ ɢɡ ɲɤɭɪ ɤɨɧɬɪɨɥɶɧɨɣ ɩɚɪɬɢɢ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɟ ɲɤɭɪ ɦɨɥɨɞɧɹɤɚ ɤɚɡɚɯɫɤɢɯ ɤɭɪɞɸɱɧɵɯ ɝɪɭɛɨɲɟɪɫɬɧɵɯ ɨɜɟɰ
ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɩɨɜɚɪɟɧɧɨɣ ɫɨɥɢ (30 % ɨɬ ɦɚɫɫɵ ɲɤɭɪ) ɢ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɪɚɫɬɟɧɢɣ (ɳɚɜɟɥɶ ɤɨɧɫɤɢɣ, ɥɨɩɭɯ 20–25 ɝ ɧɚ 1 ɲɭɛɧɭɸ ɨɜɱɢɧɭ) ɢ ɩɨɫɥɟɞɭɸɳɟɟ ɢɯ ɯɪɚɧɟɧɢɟ ɧɚ ɞɟɡɢɧɮɢɰɢɪɨɜɚɧɧɵɯ
ɷɤɫɬɪɚɤɬɨɦ ɚɧɚɛɚɡɢɫɚ ɩɨɦɟɳɟɧɢɹɯ ɨɤɚɡɚɥɨɫɶ ɷɮɮɟɤɬɢɜɧɵɦ ɦɟɬɨɞɨɦ ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɹ ɢ ɯɪɚɧɟɧɢɹ
ɲɭɛɧɨɝɨ ɫɵɪɶɹ, ɩɨɡɜɨɥɹɸɳɢɟ ɩɨɥɭɱɢɬɶ ɫ ɨɞɧɨɣ ɲɤɭɪɵ ɞɨɩɨɥɧɢɬɟɥɶɧɨ 130 ɬɟɧɝɟ ɩɪɢɛɵɥɢ.
324
ɍȾɄ 637.1
ɇɈȼɕɃ ɉɊɈȻɂɈɌɂɑȿɋɄɂɃ ɄɂɋɅɈɆɈɅɈɑɇɕɃ ɇȺɉɂɌɈɄ
«ɉɅȺȻɂɎɂɇ»
ɂɊɄɂɌɈȼȺ Ⱥ.ɇ., ɎɍɇɄ ɂ.Ⱥ., ɐȿɉȿɇɇɂɄɈȼȺ ɇ.ȼ.,
ɎȽȻɇɍ ɋɢɛɇɂɂɋ, Ȼɚɪɧɚɭɥ, Ɋɨɫɫɢɹ, e-mail: sibniis.altai@mail.ru
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ, ɜɫɟ ɛɨɥɶɲɟɟ ɱɢɫɥɨ ɩɨɬɪɟɛɢɬɟɥɟɣ ɪɚɫɫɦɚɬɪɢɜɚɟɬ ɭɩɨɬɪɟɛɥɟɧɢɟ ɨɛɨɝɚɳɟɧɧɵɯ ɩɨɥɟɡɧɨɣ ɦɢɤɪɨɮɥɨɪɨɣ ɩɪɨɞɭɤɬɨɜ ɜ ɤɚɱɟɫɬɜɟ ɞɨɥɝɨɫɪɨɱɧɵɯ ɜɥɨɠɟɧɢɣ ɜ ɫɨɛɫɬɜɟɧɧɨɟ ɡɞɨɪɨɜɶɟ.
ɉɨɷɬɨɦɭ ɩɪɨɛɢɨɬɢɱɟɫɤɢɟ ɤɢɫɥɨɦɨɥɨɱɧɵɟ ɩɪɨɞɭɤɬɵ, ɜ ɬɨɦ ɱɢɫɥɟ ɧɚɩɢɬɤɢ, ɧɚɛɢɪɚɸɬ ɜɫɟ ɛɨɥɶɲɭɸ
ɩɨɩɭɥɹɪɧɨɫɬɶ. ɉɪɨɛɢɨɬɢɱɟɫɤɢɟ ɤɢɫɥɨɦɨɥɨɱɧɵɟ ɧɚɩɢɬɤɢ ɨɛɥɚɞɚɸɬ ɧɟ ɬɨɥɶɤɨ ɩɪɢɜɥɟɤɚɬɟɥɶɧɵɦɢ
ɞɥɹ ɛɨɥɶɲɨɝɨ ɤɪɭɝɚ ɩɨɬɪɟɛɢɬɟɥɟɣ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɦɢ ɩɨɤɚɡɚɬɟɥɹɦɢ, ɧɨ ɢ ɹɜɥɹɸɬɫɹ ɩɨɥɟɡɧɵɦɢ
ɞɥɹ ɡɞɨɪɨɜɶɹ. Ƚɥɚɜɧɚɹ ɮɭɧɤɰɢɹ ɩɪɨɛɢɨɬɢɤɨɜ – ɩɪɨɮɢɥɚɤɬɢɤɚ ɪɚɡɜɢɬɢɹ ɤɢɲɟɱɧɨɝɨ ɞɢɡɛɚɤɬɟɪɢɨɡɚ ɜ
ɪɟɡɭɥɶɬɚɬɟ ɚɧɬɢɛɢɨɬɢɤɨɬɟɪɚɩɢɢɢ, ɯɢɪɭɪɝɢɱɟɫɤɢɯ ɜɦɟɲɚɬɟɥɶɫɬɜ, ɨɫɬɪɵɯ ɢ ɯɪɨɧɢɱɟɫɤɢɯ ɡɚɛɨɥɟɜɚɧɢɣ ɤɢɲɟɱɧɢɤɚ, ɫɬɪɟɫɫɚ ɢ ɞɪɭɝɢɯ ɩɪɢɱɢɧ. ɂɯ ɪɟɤɨɦɟɧɞɭɸɬ ɬɚɤɠɟ ɩɪɢɦɟɧɹɬɶ ɜ ɤɚɱɟɫɬɜɟ ɨɞɧɨɝɨ ɢɡ
ɷɮɮɟɤɬɢɜɧɵɯ ɫɪɟɞɫɬɜ ɜ ɤɨɦɩɥɟɤɫɧɨɣ ɬɟɪɚɩɢɢ ɭɠɟ ɪɚɡɜɢɜɲɟɝɨɫɹ ɞɢɫɛɚɤɬɟɪɢɨɡɚ [1].
ȼ ɋɢɛɢɪɫɤɨɦ ɢɧɫɬɢɬɭɬɟ ɫɵɪɨɞɟɥɢɹ ɪɚɡɪɚɛɨɬɚɧ ɨɪɢɝɢɧɚɥɶɧɵɣ ɤɢɫɥɨɦɨɥɨɱɧɵɣ ɩɪɨɛɢɨɬɢɱɟɫɤɢɣ
ɧɚɩɢɬɨɤ, ɩɨɥɭɱɢɜɲɢɣ ɧɚɡɜɚɧɢɟ «ɉɥɚɛɢɮɢɧ» (Ɍɍ 9222-073-00419710–14).
ɇɚɩɢɬɨɤ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɧɨɪɦɚɥɢɡɨɜɚɧɧɨɟ ɩɨ ɦɚɫɫɨɜɨɣ ɞɨɥɟ ɠɢɪɚ ɫɬɟɪɢɥɢɡɨɜɚɧɧɨɟ ɢɥɢ
ɩɚɫɬɟɪɢɡɨɜɚɧɧɨɟ ɦɨɥɨɤɨ, ɫɤɜɚɲɟɧɧɨɟ ɫɨɜɦɟɫɬɧɵɦ ɞɟɣɫɬɜɢɟɦ ɡɚɤɜɚɫɨɤ ɢɡ ɞɜɭɯ ɝɪɭɩɩ ɩɨɥɟɡɧɵɯ
ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ: Bifidobacterium longum (ɪɢɫ. 1) ɢ Lactobacillus plantarum (ɪɢɫ.2). ɉɪɢ ɪɚɡɪɚɛɨɬɤɟ ɬɟɯɧɨɥɨɝɢɢ ɢɫɩɨɥɶɡɨɜɚɥɢ ɲɬɚɦɦɵ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ ɢɡ ɤɨɥɥɟɤɰɢɢ ɥɚɛɨɪɚɬɨɪɢɢ ɦɢɤɪɨɛɢɨɥɨɝɢɢ
ɋɢɛɇɂɂɋ.
B. longum – ɜɢɞ ɝɪɚɦɩɨɥɨɠɢɬɟɥɶɧɵɯ ɚɧɚɷɪɨɛɧɵɯ ɧɟɩɨɞɜɢɠɧɵɯ ɧɟɫɩɨɪɨɨɛɪɚɡɭɸɳɢɯ ɛɚɤɬɟɪɢɣ.
Ʉɥɟɬɤɢ ɩɨ ɮɨɪɦɟ ɩɪɟɞɫɬɚɜɥɹɸɬ ɫɨɛɨɣ ɩɚɥɨɱɤɢ ɩɪɹɦɵɟ, ɪɚɡɜɟɬɜɥɺɧɧɵɟ, ɢɡɨɝɧɭɬɵɟ, ɪɚɡɞɜɨɟɧɧɵɟ.
Y– ɢɥɢ V– ɮɨɪɦɵ, ɛɭɥɚɜɨɜɢɞɧɵɟ, ɥɨɩɚɬɨɜɢɞɧɵɟ. Ʉɥɟɬɤɢ ɪɚɫɩɨɥɚɝɚɸɬɫɹ ɨɞɢɧɨɱɧɨ, ɩɚɪɚɦɢ ɢɧɨɝɞɚ
ɰɟɩɨɱɤɚɦɢ, ɪɨɡɟɬɤɚɦɢ. Ɋɚɡɦɟɪ ɤɥɟɬɨɤ 0,5–1,3 ɯ 1,5–8 ɦɤɦ. B. longum ɚɤɬɢɜɧɨ ɫɛɪɚɠɢɜɚɟɬ ɥɚɤɬɨɡɭ,
ɫɚɯɚɪɨɡɭ, ɦɚɥɶɬɨɡɭ, ɝɚɥɚɤɬɨɡɭ, ɮɪɭɤɬɨɡɭ. Ⱦɥɹ ɪɚɡɦɧɨɠɟɧɢɹ ɧɟɨɛɯɨɞɢɦɨ ɛɨɥɶɲɨɟ ɤɨɥɢɱɟɫɬɜɨ ɮɚɤɬɨɪɨɜ ɪɨɫɬɚ. ɇɭɠɧɵ ɪɢɛɨɮɥɚɜɢɧ, ɩɚɧɬɚɬɟɧɨɜɚɹ ɤɢɫɥɨɬɚ, ɰɢɫɬɟɢɧ, ɛɢɨɬɢɧ, ɩɭɪɢɧɨɜɵɟ ɢ ɩɢɪɢɦɢɞɢɧɨɜɵɟ ɨɫɧɨɜɚɧɢɹ, ɩɟɩɬɢɞɵ. Ɉɩɬɢɦɚɥɶɧɨɣ ɹɜɥɹɟɬɫɹ ɬɟɦɩɟɪɚɬɭɪɚ 37–41 °ɋ [2].
Ɋɢɫ 1. Ɇɢɤɪɨɫɤɨɩɢɱɟɫɤɢɣ ɩɪɟɩɚɪɚɬ B. longum (ɯ 1350).
L. plantarum – ɪɚɫɬɢɬɟɥɶɧɚɹ ɩɚɥɨɱɤɚ, ɝɪɚɦɩɨɥɨɠɢɬɟɥɶɧɵɟ ɚɧɚɷɪɨɛɧɵɟ ɧɟɫɩɨɪɨɨɛɪɚɡɭɸɳɢɟ ɦɨɥɨɱɧɨɤɢɫɥɵɟ ɛɚɤɬɟɪɢɢ, ɩɪɢɧɚɞɥɟɠɚɳɢɟ ɤ ɝɨɦɨɮɟɪɦɟɧɬɚɬɢɜɧɵɦ ɜɢɞɚɦ ɢɡ ɩɨɞɝɪɭɩɩɵ ɫɬɪɟɩɬɨɛɚɤɬɟɪɢɣ. Ʉɥɟɬɤɢ ɢɦɟɸɬ ɜɢɞ ɬɨɥɫɬɵɯ ɩɚɥɨɱɟɤ ɫɪɟɞɧɢɯ ɪɚɡɦɟɪɨɜ, ɨɞɧɚɤɨ ɞɥɢɧɚ ɢɯ ɦɨɠɟɬ ɢɡɦɟɧɹɬɶɫɹ
ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɭɫɥɨɜɢɣ ɫɪɟɞɵ. ɉɪɢ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɯ ɭɫɥɨɜɢɹɯ ɧɚɛɥɸɞɚɸɬɫɹ ɛɨɥɟɟ ɜɵɬɹɧɭɬɵɟ
325
ɮɨɪɦɵ. Ʉɥɟɬɤɢ ɪɚɫɩɨɥɨɠɟɧɵ ɨɞɢɧɨɱɧɨ ɢɥɢ ɤɨɪɨɬɤɢɦɢ ɰɟɩɨɱɤɚɦɢ. Ɂɟɪɟɧ ɜɨɥɸɬɢɧɚ ɜ ɨɫɧɨɜɧɨɦ ɧɟ
ɨɛɪɚɡɭɸɬ. Ʉɨɥɨɧɢɢ ɫɪɟɞɧɟɣ ɜɟɥɢɱɢɧɵ, ɤɭɩɨɥɨɨɛɪɚɡɧɵɟ, ɛɟɥɨɜɚɬɵɟ. ȼɢɞ L. plantarum ɫɛɪɚɠɢɜɚɟɬ
ɦɧɨɝɢɟ ɫɚɯɚɪɚ, ɜ ɬɨɦ ɱɢɫɥɟ ɦɚɥɶɬɨɡɭ ɢ ɫɚɯɚɪɨɡɭ. Ɉɧ ɬɪɟɛɭɟɬ ɞɥɹ ɫɜɨɟɝɨ ɪɚɡɜɢɬɢɹ ɛɨɝɚɬɵɟ ɫɪɟɞɵ, ɫɨɞɟɪɠɚɳɢɟ ɪɚɡɧɨɨɛɪɚɡɧɵɟ ɭɝɥɟɜɨɞɵ, ɜɢɬɚɦɢɧɵ, ɚɦɢɧɨɤɢɫɥɨɬɵ. Ɉɩɬɢɦɚɥɶɧɚɹ ɬɟɦɩɟɪɚɬɭɪɚ
ɞɥɹ ɟɝɨ ɪɚɡɜɢɬɢɹ 30°ɋ, ɨɞɧɚɤɨ ɦɨɠɟɬ ɪɚɫɬɢ ɜ ɞɨɜɨɥɶɧɨ ɲɢɪɨɤɢɯ ɩɪɟɞɟɥɚɯ ɬɟɦɩɟɪɚɬɭɪɵ (15-38°ɋ).
Ɉɬɥɢɱɚɟɬɫɹ ɫɩɢɪɬɨɭɫɬɨɣɱɢɜɨɫɬɶɸ, ɜɵɞɟɪɠɢɜɚɹ ɤɨɧɰɟɧɬɪɚɰɢɸ ɫɩɢɪɬɚ ɞɨ 20 % [3].
Ɋɢɫ 2. Ɇɢɤɪɨɫɤɨɩɢɱɟɫɤɢɣ ɩɪɟɩɚɪɚɬ L. plantarum (ɯ 1350).
ȼ ɤɪɭɩɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ ɢɫɬɨɱɧɢɤɨɦ ɩɪɨɛɢɨɬɢɱɟɫɤɢɯ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ B. longum ɢ L. plantarum
ɜ ɫɨɫɬɚɜɟ ɡɚɤɜɚɫɨɱɧɨɣ ɦɢɤɪɨɮɥɨɪɵ ɧɚɩɢɬɤɚ «ɉɥɚɛɢɮɢɧ» ɫɥɭɠɚɬ ɨɬɟɱɟɫɬɜɟɧɧɵɟ ɮɚɪɦɚɰɟɜɬɢɱɟɫɤɢɟ ɩɪɟɩɚɪɚɬɵ (ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ «Ʌɚɤɬɨɛɚɤɬɟɪɢɧ» ɢ «Ȼɢɮɢɞɭɦɛɚɤɬɟɪɢɧ»), ɩɪɟɞɧɚɡɧɚɱɟɧɧɵɟ ɫɩɟɰɢɚɥɶɧɨ ɞɥɹ ɧɨɪɦɚɥɢɡɚɰɢɢ ɤɢɲɟɱɧɨɝɨ ɦɢɤɪɨɛɢɨɰɟɧɨɡɚ.
ɏɚɪɚɤɬɟɪɢɫɬɢɤɚ ɧɚɩɢɬɤɚ ɩɪɟɞɫɬɚɜɥɟɧɚ ɜ ɬɚɛɥɢɰɟ 1.
Ɍɚɛɥɢɰɚ 1
ɏɚɪɚɤɬɟɪɢɫɬɢɤɚ ɩɪɨɛɢɨɬɢɱɟɫɤɨɝɨ ɧɚɩɢɬɤɚ «ɉɥɚɛɢɮɢɧ»
ɇɚɢɦɟɧɨɜɚɧɢɟ
ɩɨɤɚɡɚɬɟɥɹ
ȼɤɭɫ ɢ ɡɚɩɚɯ
ȼɧɟɲɧɢɣ ɜɢɞ ɢ ɤɨɧɫɢɫɬɟɧɰɢɹ
ɐɜɟɬ
Ʉɢɫɥɨɬɧɨɫɬɶ, ɨɌ
Ⱥɤɬɢɜɧɚɹ ɤɢɫɥɨɬɧɨɫɬɶ, ɟɞ. ɪɇ
Ʉɨɥɢɱɟɫɬɜɨ B. longum ɧɚ ɤɨɧɟɰ ɫɪɨɤɚ
ɝɨɞɧɨɫɬɢ, ɄɈȿ/ɫɦ3 (ɝ) ɧɟ ɦɟɧɟɟ
Ʉɨɥɢɱɟɫɬɜɨ L. plantarum ɧɚ ɤɨɧɟɰ
ɫɪɨɤɚ ɝɨɞɧɨɫɬɢ, ɄɈȿ/ɫɦ3 (ɝ) ɧɟ
ɦɟɧɟɟ
ɋɪɨɤ ɝɨɞɧɨɫɬɢ, ɫɭɬ.
ɏɚɪɚɤɬɟɪɢɫɬɢɤɚ ɩɨɤɚɡɚɬɟɥɹ
ɑɢɫɬɵɣ, ɤɢɫɥɨɦɨɥɨɱɧɵɣ ɢɥɢ ɤɢɫɥɨɫɥɚɞɤɢɣ (ɞɥɹ ɫɥɚɞɤɨɝɨ), ɯɚɪɚɤɬɟɪɧɵɣ ɞɥɹ
ɛɢɮɢɞɨɫɨɞɟɪɠɚɳɢɯ ɩɪɨɞɭɤɬɨɜ, ɛɟɡ ɩɨɫɬɨɪɨɧɧɢɯ ɩɪɢɜɤɭɫɨɜ ɢ ɡɚɩɚɯɨɜ. Ⱦɨɩɭɫɤɚɟɬɫɹ ɩɪɢɜɤɭɫ ɩɚɫɬɟɪɢɡɚɰɢɢ, ɫ ɜɵɪɚɠɟɧɧɵɦ ɜɤɭɫɨɦ ɢ ɚɪɨɦɚɬɨɦ, ɫɜɨɣɫɬɜɟɧɧɵɦ ɩɚɫɬɟɪɢɡɨɜɚɧɧɨɦɭ ɩɪɨɞɭɤɬɭ
Ɉɞɧɨɪɨɞɧɚɹ, ɫ ɧɚɪɭɲɟɧɧɵɦ ɫɝɭɫɬɤɨɦ. ɇɚ ɩɨɜɟɪɯɧɨɫɬɢ ɩɪɨɞɭɤɬɚ ɞɨɩɭɫɤɚɟɬɫɹ
ɧɟɡɧɚɱɢɬɟɥɶɧɨɟ ɨɬɞɟɥɟɧɢɟ ɫɵɜɨɪɨɬɤɢ
Ȼɟɥɵɣ ɫ ɤɪɟɦɨɜɵɦ ɨɬɬɟɧɤɨɦ, ɪɚɜɧɨɦɟɪɧɵɣ ɩɨ ɜɫɟɣ ɦɚɫɫɟ.
65–85
4,6–5,3
106
106
5
ɉɪɟɞɭɫɦɨɬɪɟɧ ɜɵɩɭɫɤ ɧɚɩɢɬɤɚ ɫ ɦɚɫɫɨɜɨɣ ɞɨɥɟɣ ɠɢɪɚ 3,2 %, 2,5 % ɢ ɨɛɟɡɠɢɪɟɧɧɨɝɨ ɧɚɩɢɬɤɚ. Ɉɛɟɡɠɢɪɟɧɧɵɣ ɜɚɪɢɚɧɬ «ɉɥɚɛɢɮɢɧɚ» ɨɬɧɨɫɢɬɫɹ ɤ ɧɢɡɤɨɤɚɥɨɪɢɣɧɵɦ ɩɪɨɞɭɤɬɚɦ, ɱɬɨ ɞɨɥɠɧɨ
ɩɪɟɞɫɬɚɜɥɹɬɶ ɨɫɨɛɵɣ ɢɧɬɟɪɟɫ ɞɥɹ ɥɢɰ ɫ ɢɡɛɵɬɨɱɧɵɦ ɜɟɫɨɦ.
326
ɋɪɨɤ ɝɨɞɧɨɫɬɢ ɧɚɩɢɬɤɚ ɨɝɪɚɧɢɱɟɧ 5 ɫɭɬɤɚɦɢ, ɱɬɨ (ɩɪɢ ɫɨɛɥɸɞɟɧɢɢ ɭɫɥɨɜɢɣ ɯɪɚɧɟɧɢɹ) ɝɚɪɚɧɬɢɪɭɟɬ ɜɵɫɨɤɭɸ ɱɢɫɥɟɧɧɨɫɬɶ ɠɢɜɵɯ ɮɢɡɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɤɥɟɬɨɤ ɩɪɨɛɢɨɬɢɱɟɫɤɢɯ ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ.
ɇɨɜɵɣ ɩɪɨɛɢɨɬɢɱɟɫɤɢɣ ɧɚɩɢɬɨɤ ɪɚɫɫɱɢɬɚɧ ɧɚ ɜɫɟ ɜɨɡɪɚɫɬɧɵɟ ɝɪɭɩɩɵ ɧɚɫɟɥɟɧɢɹ. ɗɬɨ «ɠɢɜɨɣ»,
ɷɤɨɥɨɝɢɱɟɫɤɢ ɱɢɫɬɵɣ ɩɪɨɞɭɤɬ, ɨɧ ɧɟ ɫɨɞɟɪɠɢɬ ɤɚɤɢɯ-ɥɢɛɨ ɤɨɧɫɟɪɜɚɧɬɨɜ, ɯɢɦɢɱɟɫɤɢɯ ɜɤɭɫɨɜɵɯ ɢ
ɚɪɨɦɚɬɢɱɟɫɤɢɯ ɢɧɝɪɟɞɢɟɧɬɨɜ, ɤɪɚɫɢɬɟɥɟɣ. ɉɪɨɢɡɜɨɞɫɬɜɨ ɞɚɧɧɨɝɨ ɩɪɨɞɭɤɬɚ ɩɨɡɜɨɥɢɬ ɪɚɫɲɢɪɢɬɶ
ɚɫɫɨɪɬɢɦɟɧɬ ɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɬɨɜ ɫɩɟɰɢɚɥɶɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
Ʉɚɝɚɧ ə.Ɋ., ɋɟɪɝɟɟɜɚ ɂ.ə. ɇɨɜɵɣ ɩɪɨɛɢɨɬɢɱɟɫɤɢɣ ɤɢɫɥɨɦɨɥɨɱɧɵɣ ɧɚɩɢɬɨɤ «Ⱥɥɬɚɣɫɤɚɹ ɡɚɤɜɚɫɤɚ» //
ɉɟɪɟɪɚɛɨɬɤɚ ɦɨɥɨɤɚ. – 2009. – ʋ5. – ɋ. 30–31.
ɘɪɢɤ ɋ.Ⱥ., ɋɟɦɟɧɢɯɢɧ ȼ.ɂ., ɂɪɤɢɬɨɜɚ Ⱥ.ɇ., ɇɨɫɨɜɚ Ɇ.ȼ. Ⱦɢɮɮɟɪɟɧɰɢɚɰɢɹ ɤɭɥɶɬɭɪ Bifidobacterium ɫ
ɩɨɦɨɳɶɸ ɫɢɧɬɟɬɢɱɟɫɤɢɯ ɨɥɢɝɨɧɭɤɥɟɨɬɢɞɧɵɯ ɩɪɚɣɦɟɪɨɜ // ȼɟɫɬɧɢɤ Ɋɨɫɫɢɣɫɤɨɣ ɚɤɚɞɟɦɢɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɧɚɭɤ. – 2014. – ʋ5. – ɋ. 24–25.
Ʉɜɚɫɧɢɤɨɜ ȿ.ɂ, ɇɟɫɬɟɪɟɧɤɨ Ɉ.Ⱥ. Ɇɨɥɨɱɧɨɤɢɫɥɵɟ ɛɚɤɬɟɪɢɢ ɢ ɩɭɬɢ ɢɯ ɢɫɩɨɥɶɡɨɜɚɧɢɹ. – Ɇ.: ɇɚɭɤɚ. –
1975. – 384 ɫ.
ɍȾɄ 663.18
ɋȿɆȿɃɇɕɃ ɐȿɏ ɉɈ ɉȿɊȿɊȺȻɈɌɄȿ ɈȼɈɓȿɃ
ɄɍɒɇȺɊȿȼ Ⱥ.ɋ.,
ɍɤɪɇȾɂɉȼɌ ɢɦ. Ʌ.ȼ. ɉɨɝɨɪɟɥɨɝɨ, Ʉɢɟɜ
ɍɌȿɇɄɈȼ Ƚ.Ʌ. ,
ɎȽȻɍ ɋɈ Ⱥɇ, ɇɨɜɨɫɢɛɢɪɫɤ
Ɉɜɨɳɢ ɫɨɫɬɚɜɥɹɸɬ ɨɬɞɟɥɶɧɭɸ ɩɨɡɢɰɢɸ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɧɚɫɟɥɟɧɢɹ ɪɟɫɩɭɛɥɢɤɢ. Ɋɚɛɨɬɚ ɩɨ ɩɨɜɵɲɟɧɢɸ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɫɟɝɦɟɧɬɚ ɩɪɨɢɡɜɨɞɫɬɜɚ ɨɜɨɳɟɣ ɹɜɥɹɟɬɫɹ ɢ ɡɚɞɚɱɟɣ
ɨɛɟɫɩɟɱɟɧɢɹ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɪɟɫɩɭɛɥɢɤɢ. ɉɟɪɟɪɚɛɨɬɤɚ ɨɜɨɳɟɣ ɨɛɟɫɩɟɱɢɜɚɟɬ
ɯɪɚɧɟɧɢɟ ɢ ɤɪɭɝɥɨɝɨɞɢɱɧɨɟ ɢɯ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɧɚɫɟɥɟɧɢɟɦ. ɉɨɬɪɟɛɧɨɫɬɢ ɫɟɜɟɪɚ ɜ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɝɨɪɚɡɞɨ ɜɵɲɟ.
ɉɨ ɧɨɪɦɚɬɢɜɚɦ Ɋɨɫɫɢɢ ɧɚ ɤɚɠɞɨɝɨ ɠɢɬɟɥɹ ɫɬɪɚɧɵ ɞɨɥɠɧɨ ɩɪɨɢɡɜɨɞɢɬɶɫɹ 100 ɛɚɧɨɤ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɢɡ ɤɨɬɨɪɨɣ ɩɨɥɨɜɢɧɚ ɞɨɥɠɧɚ ɛɵɬɶ ɨɜɨɳɧɨɣ. Ɉɞɧɚɤɨ ɜ ɪɟɚɥɶɧɨɣ ɠɢɡɧɢ ɧɚ
ɤɚɠɞɨɝɨ ɠɢɬɟɥɹ Ɋɨɫɫɢɢ ɬɨɪɝɨɜɥɹ ɪɟɚɥɢɡɭɟɬ 10–15 ɛɚɧɨɤ ɤɨɧɫɟɪɜɢɪɨɜɚɧɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɩɪɢɱɺɦ
ɩɨɱɬɢ ɩɨɥɨɜɢɧɚ ɢɡ ɧɢɯ ɢɦɩɨɪɬɢɪɭɟɬɫɹ ɢɡ-ɡɚ ɪɭɛɟɠɚ. ɉɪɚɜɞɚ ɦɧɨɝɢɟ ɠɢɬɟɥɢ Ɋɨɫɫɢɢ ɧɚ ɫɜɨɢɯ ɩɪɢɭɫɚɞɟɛɧɵɯ ɞɚɱɧɵɯ ɢ ɨɝɨɪɨɞɧɵɯ ɭɱɚɫɬɤɚɯ ɡɚɤɚɬɵɜɚɸɬ ɛɨɥɶɲɨɟ ɤɨɥɢɱɟɫɬɜɨ ɨɜɨɳɟɣ ɢ ɮɪɭɤɬɨɜ ɞɥɹ
ɥɢɱɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ. Ɉɫɨɛɟɧɧɨɫɬɢ:
- ɜɨ – ɩɟɪɜɵɯ ɦɚɥɚɹ ɩɥɨɳɚɞɶ ɩɨɞ ɨɜɨɳɚɦɢ ɜ Ʌɉɏ ɢ ɧɢɡɤɚɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɚɹ ɨɪɝɚɧɢɡɚɰɢɹ ɢɯ
ɩɪɨɢɡɜɨɞɫɬɜɚ (ɫɨɪɬɚ, ɫɪɟɞɫɬɜɚ ɡɚɳɢɬɵ, ɭɞɨɛɪɟɧɢɹ, ɭɯɨɞ, ɢ ɬ.ɞ.) ɫɨɩɪɨɜɨɠɞɚɸɬɫɹ ɧɢɡɤɢɦɢ ɭɪɨɠɚɣɧɨɫɬɶɸ ɢ ɜɚɥɨɜɨɦɭ ɫɛɨɪɭ;
- ɜɨ – ɜɬɨɪɵɯ ɪɟɚɥɢɡɚɰɢɹ ɨɜɨɳɟɣ ɩɪɨɢɡɜɨɞɢɬɫɹ, ɤɚɤ ɩɪɚɜɢɥɨ, ɜ ɩɟɪɢɨɞ ɦɚɫɫɨɜɨɝɨ ɫɛɨɪɚ. ɗɬɨ
ɩɪɢɜɨɞɢɬ ɤɚɤ ɤ ɧɢɡɤɢɦ ɰɟɧɚɦ, ɬɚɤ ɢ ɨɬɪɵɜɭ ɩɪɨɢɡɜɨɞɢɬɟɥɹ ɨɬ ɯɨɡɹɣɫɬɜɟɧɧɵɯ ɞɟɥ ɜ ɨɝɨɪɨɞɟ – ɜɫɟ
ɟɝɨ ɭɫɢɥɢɹ ɧɚɩɪɚɜɥɟɧɵ ɧɚ ɨɛɟɫɩɟɱɟɧɢɟ ɭɞɚɱɧɨɝɨ ɫɛɵɬɚ ɩɪɨɞɭɤɰɢɢ.
Ɉɪɝɚɧɢɡɚɰɢɹ ɡɚɜɨɞɨɜ, ɜ ɬɨɦ ɱɢɫɥɟ ɢ ɦɢɧɢ ɡɚɜɨɞɨɜ, ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ ɨɜɨɳɟɣ ɢɦɟɟɬ ɫɜɨɢ ɨɫɨɛɟɧɧɨɫɬɢ. Ʉɨɧɫɟɪɜɧɵɟ ɡɚɜɨɞɵ ɨɛɵɱɧɨ ɨɩɢɪɚɸɬɫɹ ɧɚ ɫɵɪɶɟɜɭɸ ɛɚɡɭ ɩɪɨɢɡɜɨɞɫɬɜɚ ɨɜɨɳɟɣ ɜ ɬɵɫɹɱɢ ɢ ɞɟɫɹɬɤɢ ɬɵɫɹɱ ɝɟɤɬɚɪ, ɩɪɢɥɟɝɚɸɳɢɯ ɤ ɧɟɦɭ ɧɚ ɪɚɫɫɬɨɹɧɢɢ ɧɟ ɛɨɥɟɟ 50–70 ɤɦ. ɇɚɩɪɢɦɟɪ, ɜ
ɏɟɪɫɨɧɫɤɨɣ ɨɛɥɚɫɬɢ, ɩɥɨɳɚɞɶ ɤɨɬɨɪɨɣ ɜɫɟɝɨ 26,4 ɬɵɫ. ɤɜ. ɤɦ. ɜ 2012 ɝɨɞɭ ɛɵɥɨ ɫɨɛɪɚɧɨ ɛɨɥɟɟ 2
ɦɥɧ ɬɨɧɧ ɨɜɨɳɟɣ, ɢɡ ɤɨɬɨɪɵɯ ɛɨɥɟɟ 25 ɬɵɫ. ɬɨɧɧ ɛɵɥɨ ɡɚɤɨɧɫɟɪɜɢɪɨɜɚɧɨ ɧɚ ɡɚɜɨɞɚɯ ɨɛɥɚɫɬɢ.
ɇɚ ɧɚɲ ɜɡɝɥɹɞ, ɫɚɦɵɣ ɩɟɪɫɩɟɤɬɢɜɧɵɣ ɩɭɬɶ – ɨɪɝɚɧɢɡɚɰɢɹ ɫɟɦɟɣɧɵɯ ɰɟɯɨɜ Ʌɉɏ ɢ ɮɟɪɦɟɪɫɤɢɯ
ɯɨɡɹɣɫɬɜɚɯ, ɢɦɟɸɳɢɯ ɩɥɨɳɚɞɶ ɩɨɞ ɩɪɨɢɡɜɨɞɫɬɜɨ ɨɜɨɳɟɣ ɨɬ 0,5 ɞɨ 2,0 ɝɚ. ȼ ɬɚɤɢɯ ɯɨɡɹɣɫɬɜɚɯ ɦɨɠɧɨ ɞɨ 30 ɬɨɧɧ ɩɪɨɢɡɜɟɞɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɩɟɪɟɪɚɛɨɬɚɬɶ ɭ ɫɟɛɹ ɢ ɪɟɚɥɢɡɨɜɚɬɶ ɟɺ ɜ ɨɫɟɧɧɟɟ – ɡɢɦɧɢɣ
– ɜɟɫɟɧɧɢɣ ɩɟɪɢɨɞ. ɉɨɫɭɬɢ ɷɬɨ ɫɨɫɪɟɞɨɬɨɱɟɧɢɟ ɬɪɺɯ ɫɨɫɬɚɜɥɹɸɳɢɯ ɫɢɫɬɟɦɵ: «ɩɪɨɢɡɜɨɞɫɬɜɨ – ɩɟɪɟɪɚɛɨɬɤɚ – ɯɪɚɧɟɧɢɟ» ɜ ɪɭɤɚɯ ɩɪɨɢɡɜɨɞɢɬɟɥɹ.
ɇɚ ɧɚɲ ɜɡɝɥɹɞ ɷɬɨ ɜɚɠɧɨ ɢ ɩɪɢ ɪɟɚɥɢɡɚɰɢɢ ɩɥɚɧɨɜ ɩɪɟɡɢɞɟɧɬɚ ȼ. ɉɭɬɢɧɚ – ɨɛɟɫɩɟɱɢɬɶ ɛɟɫɩɥɚɬɧɨ ɠɟɥɚɸɳɢɯ ɨɞɧɢɦ ɝɟɤɬɚɪɨɦ ɡɟɦɥɢ ɜ ɋɢɛɢɪɢ ɢ Ⱦɚɥɶɧɟɦ ɜɨɫɬɨɤɟ.
ɋɟɦɟɣɧɵɣ ɰɟɯ ɪɚɛɨɬɚɟɬ ɜ ɬɟɱɟɧɢɢ 90 – 110 ɞɧɟɣ ɜ ɝɨɞɭ ɢ ɜ ɷɬɨ ɜɪɟɦɹ ɩɟɪɟɪɚɛɚɬɵɜɚɟɬɫɹ ɞɨ
200–300 ɤɝ ɨɜɨɳɟɣ ɜ ɞɟɧɶ. ȼ ɩɪɟɞɥɚɝɚɟɦɨɦ ɧɚɦɢ ɷɫɤɢɡɧɨɦ ɩɪɨɟɤɬɟ ɨɬɦɟɬɢɦ ɫɥɟɞɭɸɳɢɟ ɩɨɥɨɠɢɬɟɥɶɧɵɟ ɨɫɨɛɟɧɧɨɫɬɢ ɬɚɤɢɯ ɫɭɩɟɪɦɚɥɵɯ ɰɟɯɨɜ:
327
– ɨɛɟɫɩɟɱɢɜɚɟɬɫɹ ɭɜɟɥɢɱɟɧɢɟ ɬɨɜɚɪɧɨɣ ɩɪɨɞɭɤɰɢɢ ɡɚ ɫɱɺɬ ɫɧɢɠɟɧɢɹ ɩɨɬɟɪɶ, ɫɜɹɡɚɧɧɵɯ ɩɟɪɟɜɨɡɤɨɣ, ɩɟɪɟɜɚɥɤɨɣ ɢ ɜɪɟɦɟɧɧɵɦ ɯɪɚɧɟɧɢɟɦ. Ɉɜɨɳɢ ɭɠɟ ɱɟɪɟɡ ɧɟɫɤɨɥɶɤɨ ɱɚɫɨɜ ɩɨɫɥɟ ɭɛɨɪɤɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɬɫɹ ɜ ɤɨɧɟɱɧɵɣ ɩɪɨɞɭɤɬ;
– ɨɛɟɫɩɟɱɢɜɚɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ ɩɪɨɢɡɜɨɞɫɬɜɚ ɲɢɪɨɤɨɣ ɧɨɦɟɧɤɥɚɬɭɪɵ ɩɪɨɞɭɤɰɢɢ (ɪɚɡɥɢɱɧɵɟ
ɨɜɨɳɢ, ɢɯ ɫɦɟɫɢ ɢ ɪɟɰɟɩɬɭɪɚ).
– ɨɛɟɫɩɟɱɢɜɚɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɨɜɨɳɧɨɝɨ ɤɨɧɜɟɣɟɪɚ ɞɥɹ ɪɚɜɧɨɦɟɪɧɨɣ ɡɚɝɪɭɡɤɢ
ɰɟɯɚ;
– ɨɛɟɫɩɟɱɢɜɚɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ ɨɪɝɚɧɢɡɚɰɢɹ ɫɬɪɭɤɬɭɪɵ ɩɨɫɟɜɧɵɯ ɩɥɨɳɚɞɟɣ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ
ɤɨɦɩɨɧɟɧɬɨɜ ɝɨɬɨɜɨɣ ɩɪɨɞɭɤɰɢɢ;
– ɨɬɫɭɬɫɬɜɭɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɫɨɞɟɪɠɚɧɢɹ ɭɩɪɚɜɥɟɧɱɟɫɤɨɝɨ ɢ ɜɫɩɨɦɨɝɚɬɟɥɶɧɨɝɨ ɩɟɪɫɨɧɚɥɚ. ɗɬɢ
ɮɭɧɤɰɢɢ ɜɵɩɨɥɧɹɸɬ ɱɥɟɧɵ ɫɟɦɶɢ ɢ ɢɫɩɨɥɶɡɭɸɬɫɹ ɨɩɬɢɦɚɥɶɧɨ ɪɟɫɭɪɫɵ ɫɟɦɶɢ;
– ɦɚɥɚɹ ɩɥɨɳɚɞɶ ɩɨɞ ɰɟɯ – ɞɨ 12–15 ɤɜ. ɦ.;
– ɨɛɟɫɩɟɱɢɜɚɸɬɫɹ ɦɢɧɢɦɚɥɶɧɵɟ ɬɪɚɧɫɩɨɪɬɧɵɟ, ɩɟɪɟɜɚɥɨɱɧɵɟ ɢ ɩɟɪɟɝɪɭɡɨɱɧɵɟ ɪɚɛɨɬɵ;
– ɝɨɬɨɜɚɹ ɩɪɨɞɭɤɰɢɹ – ɢɦɟɟɬ ɚɜɬɨɪɚ – ɩɪɨɢɡɜɨɞɢɬɟɥɹ ɨɜɨɳɟɣ, ɱɬɨ ɧɟɜɨɡɦɨɠɧɨ ɜ ɫɥɭɱɚɟ ɚɜɬɨɧɨɦɧɵɯ ɰɟɯɨɜ. ɉɪɢ ɜɵɯɨɞɟ ɧɚ ɪɵɧɨɤ ɩɪɨɢɡɜɨɞɢɬɟɥɶ ɫɬɚɧɨɜɢɬɫɹ ɭɡɧɚɜɚɟɦɵɦ;
– ɧɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɫɬɪɨɢɬɟɥɶɫɬɜɚ ɤɨɦɦɭɧɢɤɚɰɢɣ. Ⱦɨɫɬɚɬɨɱɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɤɨɦɦɭɧɢɤɚɰɢɨɧɧɵɟ ɜɨɡɦɨɠɧɨɫɬɢ ɤɪɟɫɬɶɹɧɫɤɨɝɨ ɩɨɞɜɨɪɶɹ: ɝɚɡ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɩɢɳɢ, ɷɥɟɤɬɪɨɫɟɬɶ 220 ɜɨɥɶɬ
ɩɨɬɪɟɛɥɹɟɦɚɹ ɦɨɳɧɨɫɬɶ ɞɨ 2,5-3,0 ɤȼɬ, ɜɨɞɚ 400–800 ɥɢɬɪɨɜ ɜ ɫɭɬɤɢ;
– ɨɬɯɨɞɵ ɧɟ ɡɚɝɪɹɡɧɹɸɬ ɨɤɪɭɠɚɸɳɭɸ ɫɪɟɞɭ ɢ ɢɫɩɨɥɶɡɭɸɬɫɹ ɜ ɞɜɭɯ ɧɚɩɪɚɜɥɟɧɢɹɯ – ɤɨɪɦ ɞɥɹ
ɫɤɨɬɚ ɢ ɩɬɢɰɵ, ɩɨɥɢɜ ɢ ɭɞɨɛɪɟɧɢɟ ɞɥɹ ɫɜɨɟɝɨ ɨɝɨɪɨɞɚ.
ɉɨ ɧɚɲɟɦɭ ɷɫɤɢɡɧɨɦɭ ɩɪɨɟɤɬɭ ɬɢɩɨɜɨɣ ɫɟɦɟɣɧɵɣ ɰɟɯ ɨɛɟɫɩɟɱɢɜɚɟɬ ɫɥɟɞɭɸɳɢɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɨɩɟɪɚɰɢɢ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ ɨɜɨɳɟɣ:
– ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɟ ɦɚɪɢɧɨɜɚɧɧɵɯ ɨɜɨɳɟɣ (ɨɝɭɪɰɵ, ɬɨɦɚɬɵ, ɤɚɛɚɱɤɢ, ɫɚɥɚɬɵ ɨɜɨɳɧɵɟ ɢ ɬ.ɞ.);
– ɫɨɥɟɧɢɟ ɢ ɤɜɚɲɟɧɢɟ (ɨɝɭɪɰɵ, ɤɚɩɭɫɬɚ ɢ ɬ.ɞ.);
– ɫɭɲɟɧɢɟ ɨɜɨɳɟɣ ɢ ɩɪɨɢɡɜɨɞɫɬɜɨ ɝɨɬɨɜɵɯ ɩɨɥɭɮɚɛɪɢɤɚɬɨɜ, ɤɚɤ ɫɭɯɨɣ ɛɨɪɳ, ɫɭɯɨɣ ɫɜɟɤɨɥɶɧɢɤ
ɢ ɬ.ɞ., ɜ ɜɚɤɭɭɦɧɨɣ ɭɩɚɤɨɜɤɟ;
– ɩɪɢɝɨɬɨɜɥɟɧɢɟ ɫɚɥɚɬɨɜ ɜ ɩɥɚɫɬɢɤɨɜɨɣ ɭɩɚɤɨɜɤɟ ɫɨ ɫɪɨɤɨɦ ɯɪɚɧɟɧɢɹ ɞɨ 10 ɞɧɟɣ.
ȼɫɹ ɩɪɨɞɭɤɰɢɹ ɝɚɪɦɨɧɢɡɭɟɬɫɹ ɫ ȽɈɋɌɚɦɢ ɢ Ɍɍ (ɬɟɯɧɢɱɟɫɤɢɦɢ ɭɫɥɨɜɢɹɦɢ), ɞɟɣɫɬɜɭɸɳɢɦɢ ɧɚ
ɬɟɪɪɢɬɨɪɢɢ Ɋɨɫɫɢɢ.
Ɉɛɨɪɭɞɨɜɚɧɢɟ ɫɟɦɟɣɧɨɝɨ ɰɟɯɚ ɜɤɥɸɱɚɟɬ:
– ɦɨɟɱɧɨɟ;
– ɲɢɧɤɨɜɚɥɶɧɨɟ;
– ɫɭɲɢɥɶɧɨɟ;
– ɚɜɬɨɤɥɚɜɵ (ɞɥɹ ɩɚɫɬɟɪɢɡɚɰɢɢ ɤɨɧɫɟɪɜɨɜ);
– ɡɚɤɚɬɨɱɧɨɟ (ɞɥɹ ɡɚɤɚɬɤɢ ɜ ɫɬɟɤɥɹɧɧɨɣ ɛɚɧɤɢ);
– ɜɚɤɭɭɦ – ɭɩɚɤɨɜɨɱɧɨɟ;
– ɩɥɢɬɚ ɝɚɡɨɜɚɹ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɦɚɪɢɧɚɞɚ.
ɐɟɧɚ ɧɚɛɨɪɚ ɨɛɨɪɭɞɨɜɚɧɢɹ ɫɟɝɨɞɧɹ ɫɨɫɬɚɜɥɹɟɬ ɞɨ 50 ɬɵɫ. ɪɭɛɥɟɣ. Ʉɪɨɦɟ ɨɛɨɪɭɞɨɜɚɧɢɹ ɧɟɨɛɯɨɞɢɦɵ ɨɛɨɪɨɬɧɵɟ ɫɪɟɞɫɬɜɚ ɧɚ ɬɚɪɭ, ɤɪɵɲɤɢ, ɺɦɤɨɫɬɢ ɞɥɹ ɫɨɥɺɧɨɣ ɢ ɤɜɚɲɟɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɩɥɚɫɬɢɤɨɜɵɟ ɺɦɤɨɫɬɢ ɞɥɹ ɫɚɥɚɬɨɜ ɢ ɷɬɢɤɟɬɤɢ. ɇɟɨɛɯɨɞɢɦɨ ɨɪɝɚɧɢɡɨɜɚɬɶ ɡɚɝɨɬɨɜɤɭ ɜɬɨɪɢɱɧɨɣ ɬɚɪɵ ɜ ɡɨɧɟ
ɨɛɫɥɭɠɢɜɚɧɢɹ. Ʉɪɨɦɟ ɬɨɝɨ ɧɟɨɛɯɨɞɢɦɨ ɨɛɨɪɭɞɨɜɚɬɶ ɜ ɩɨɞɜɨɪɶɟ ɫɤɥɚɞ ɝɨɬɨɜɨɣ ɩɪɨɞɭɤɰɢɢ ɧɚ 10–15
ɬɨɧɧ ɺɦɤɨɫɬɶɸ 20–25 ɤɭɛ. ɦ.
Ⱦɪɭɝɨɣ ɫɨɫɬɚɜɥɹɸɳɟɣ ɢɧɬɟɧɫɢɮɢɤɚɰɢɢ ɨɜɨɳɟɣ ɢ ɨɜɨɳɧɨɣ ɩɪɨɞɭɤɰɢɢ ɹɜɥɹɟɬɫɹ ɜɧɟɞɪɟɧɢɟ
ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ. ɇɚɲ ɨɩɵɬ ɜɧɟɞɪɟɧɢɹ ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ ɜ ɯɨɡɹɣɫɬɜɚɯ ɏɟɪɫɨɧɫɤɨɣ ɢ
Ɂɚɩɨɪɨɠɫɤɨɣ ɨɛɥɚɫɬɹɯ ɍɤɪɚɢɧɵ ɩɨɤɚɡɚɥ, ɱɬɨ ɧɚ ɪɹɞɭ ɫ ɩɨɜɵɲɟɧɢɟ ɭɪɨɠɚɣɧɨɫɬɢ ɜ 2–5 ɪɚɡ ɫɭɳɟɫɬɜɟɧɧɨ ɭɥɭɱɲɚɟɬɫɹ ɢ ɤɚɱɟɫɬɜɨ ɩɪɨɞɭɤɰɢɢ; ɨɛɟɫɩɟɱɢɜɚɸɬɫɹ ɜɵɫɨɤɢɟ ɭɪɨɠɚɢ ɧɚ ɛɨɥɶɲɢɯ ɩɥɨɳɚɞɹɯ.
Ɍɨɥɶɤɨ ɜ Ʉɚɯɨɜɫɤɨɦ ɪɚɣɨɧɟ ɏɟɪɫɨɧɫɤɨɣ ɨɛɥɚɫɬɢ ɧɚ ɤɚɩɟɥɶɧɨɦ ɨɪɨɲɟɧɢɢ ɜɵɪɚɳɢɜɚɸɬɫɹ ɨɜɨɳɢ ɧɚ
ɩɥɨɳɚɞɢ ɛɨɥɟɟ 10 ɬɵɫ. ɝɚ ɢ ɨɛɟɫɩɟɱɢɜɚɸɬɫɹ ɭɪɨɠɚɣ ɦɨɪɤɨɜɢ – 82,9 ɬ. ɝɚ, ɫɜɟɤɥɵ ɫɬɨɥɨɜɨɣ 90 ɬ. ɝɚ,
ɤɚɛɚɱɤɨɜ 80 ɬ. ɝɚ, ɬɨɦɚɬɨɜ 85 ɬ. ɝɚ, ɨɝɭɪɰɨɜ 40 ɬ. ɝɚ.
ɋɨɜɦɟɫɬɧɨɟ ɨɫɜɨɟɧɢɟ ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ ɢ ɫɟɦɟɣɧɨɝɨ ɰɟɯɚ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ ɨɜɨɳɟɣ ɩɨɡɜɨɥɢɬ
ɫɟɦɶɟ ɜ ɝɨɞ ɩɪɨɢɡɜɨɞɢɬɶ ɬɨɜɚɪɧɨɣ ɩɪɨɞɭɤɰɢɢ ɧɚ ɫɭɦɦɭ ɛɨɥɟɟ 500 ɬɵɫ. ɪɭɛɥɟɣ ɜ ɝɨɞ.
Ⱦɥɹ ɪɟɚɥɢɡɚɰɢɢ ɷɬɨɝɨ ɩɪɨɟɤɬɚ ɧɟɨɛɯɨɞɢɦɨ ɜɟɫɬɢ ɫɢɫɬɟɦɧɭɸ ɪɚɛɨɬɭ ɜ ɧɟɫɤɨɥɶɤɢɯ ɧɚɩɪɚɜɥɟɧɢɹɯ:
1 – ɨɪɝɚɧɢɡɚɰɢɹ ɩɪɨɩɚɝɚɧɞɵ ɢ ɨɛɭɱɟɧɢɟ;
2 – ɨɪɝɚɧɢɡɚɰɢɹ ɤɨɧɫɭɥɶɬɚɰɢɨɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ;
3 – ɨɪɝɚɧɢɡɚɰɢɹ ɩɪɟɞɩɪɢɹɬɢɹ, ɨɛɟɫɩɟɱɢɜɚɸɳɟɝɨ:
3.1 – ɩɪɢɜɹɡɤɭ ɬɢɩɨɜɨɝɨ ɩɪɨɟɤɬɚ ɤ ɪɟɚɥɶɧɵɦ ɭɫɥɨɜɢɹɦ ɩɪɨɢɡɜɨɞɢɬɟɥɹ;
3.2 – ɡɚɜɨɡ ɜ ɪɟɫɩɭɛɥɢɤɭ ɤɨɦɩɥɟɤɬɭɸɳɢɯ ɤɚɤ ɞɥɹ ɨɪɝɚɧɢɡɚɰɢɢ ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ, ɬɚɤ ɢ ɫɟɦɟɣɧɨɝɨ ɰɟɯɚ;
328
3.3 – ɤɨɦɩɥɟɤɬɚɰɢɹ ɨɛɨɪɭɞɨɜɚɧɢɹ ɞɥɹ ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ ɢ ɫɟɦɟɣɧɨɝɨ ɰɟɯɚ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ
ɨɜɨɳɟɣ ɢ ɢɯ ɪɟɚɥɢɡɚɰɢɹ ɩɨ ɪɚɣɨɧɚɦ ɪɟɫɩɭɛɥɢɤɢ.
Ɇɨɠɧɨ ɜɟɫɬɢ ɪɚɛɨɬɵ ɩɨ ɪɚɡɪɚɛɨɬɤɟ ɮɟɪɦɟɪɫɤɢɯ ɰɟɯɨɜ, ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ ɨɜɨɳɧɨɣ ɩɪɨɞɭɤɰɢɢ
ɦɨɳɧɨɫɬɶɸ ɞɨ 500 ɤɝ ɜ ɫɭɬɤɢ. ɗɬɨ ɨɬɞɟɥɶɧɵɣ ɜɨɩɪɨɫ ɢ ɩɪɢ ɧɚɥɢɱɢɢ ɡɚɢɧɬɟɪɟɫɨɜɚɧɧɨɫɬɢ ɦɵ ɝɨɬɨɜɵ ɟɝɨ ɪɚɫɫɦɚɬɪɢɜɚɬɶ.
ɉɪɢɝɥɚɲɚɟɦ ɡɚɢɧɬɟɪɟɫɨɜɚɧɧɵɯ ɥɢɰ ɩɪɢɧɹɬɶ ɚɤɬɢɜɧɨɟ ɭɱɚɫɬɢɟ ɜ ɨɛɫɭɠɞɟɧɢɢ ɩɨɞɧɹɬɨɣ ɧɚɦɢ
ɩɪɨɛɥɟɦɵ.
ɍȾɄ 663. 252.6
ȺɄɌɍȺɅɖɇɈɋɌɖ ɉɊɂɆȿɇȿɇɂə
ɉɂɓȿȼɕɏ ɄɈɇɐȿɇɌɊȺɌɈȼ ɉɈɅɂɎȿɇɈɅɈȼ
ɆȺȽȺɀȺɇɈȼ ɀ.Ɇ., ɊȺɎɄȺɌɈȼȺ Ʌ.Ɋ., ȻȿɄɌɍɊɋɍɇɈȼȺ Ɇ.ɀ.,
Ʉɚɡɚɯɫɤɢɣ ɇɂɂ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɢ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ
ɝ. Ⱥɥɦɚɬɵ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ. E-mail: kazniippp@mail.ru.
ɇɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɨɫɧɨɜɧɨɣ ɩɪɨɛɥɟɦɨɣ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ ɹɜɥɹɟɬɫɹ ɨɛɟɫɩɟɱɟɧɢɟ
ɧɚɫɟɥɟɧɢɹ ɩɨɥɧɨɰɟɧɧɵɦɢ, ɞɨɫɬɭɩɧɵɦɢ ɢ ɛɟɡɨɩɚɫɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ ɩɢɬɚɧɢɹ. Ɍɚɤ ɤɚɤ ɨɛɪɚɡ ɠɢɡɧɢ ɫɨɜɪɟɦɟɧɧɨɝɨ ɱɟɥɨɜɟɤɚ ɯɚɪɚɤɬɟɪɢɡɭɟɬɫɹ ɢɡɦɟɧɟɧɢɹɦɢ ɜ ɫɬɨɪɨɧɭ ɫɧɢɠɟɧɢɹ ɮɢɡɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ, ɧɟɛɥɚɝɨɩɪɢɹɬɧɨɣ ɷɤɨɥɨɝɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɨɣ, ɧɚɥɢɱɢɟɦ ɜɪɟɞɧɵɯ ɩɪɢɜɵɱɟɤ, ɧɟɞɨɫɬɚɬɤɨɦ
ɤɚɱɟɫɬɜɟɧɧɨɣ ɢ ɩɨɥɟɡɧɨɣ ɩɢɳɢ, ɫɨɞɟɪɠɚɳɟɣ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɵɣ ɫɨɫɬɚɜ ɩɪɢɪɨɞɧɵɯ ɚɧɬɢɨɤɫɢɞɚɧɬɨɜ – ɩɨɥɢɮɟɧɨɥɨɜ, ɤɚɪɨɬɢɧɨɢɞɨɜ, ɜɢɬɚɦɢɧɨɜ, ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɜ ɪɚɰɢɨɧɟ ɩɢɬɚɧɢɹ, ɤɨɬɨɪɵɟ ɜ ɢɬɨɝɟ
ɨɬɪɢɰɚɬɟɥɶɧɨ ɫɤɚɡɵɜɚɸɬɫɹ ɧɚ ɧɨɪɦɚɥɶɧɨɦ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɢ ɱɟɥɨɜɟɱɟɫɤɨɝɨ ɨɪɝɚɧɢɡɦɚ ɢ ɩɪɨɞɨɥɠɢɬɟɥɶɧɨɫɬɢ ɠɢɡɧɢ.
ɉɨɜɵɲɟɧɧɨɟ ɜɧɢɦɚɧɢɟ ɭɱɟɧɵɯ – ɩɢɳɟɜɢɤɨɜ ɜɫɟɝɨ ɦɢɪɚ ɧɚɛɥɸɞɚɟɬɫɹ ɤ ɫɵɪɶɸ ɪɚɫɬɢɬɟɥɶɧɨɝɨ
ɩɪɨɢɫɯɨɠɞɟɧɢɹ. ɉɪɢɪɨɞɧɵɟ ɭɧɢɤɚɥɶɧɵɟ ɤɨɦɩɥɟɤɫɵ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɫɵɪɶɹ ɩɪɟɞɨɩɪɟɞɟɥɹɸɬ ɤɚɤ ɢɯ
ɥɟɱɟɛɧɨ – ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɨɟ ɞɟɣɫɬɜɢɟ ɬɚɤ ɢ ɜɨɡɦɨɠɧɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ɜ ɤɚɱɟɫɬɜɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ
ɩɢɳɟɜɵɯ ɞɨɛɚɜɨɤ, ɩɨɫɤɨɥɶɤɭ ɢɦ ɩɪɢɫɭɳɢ ɪɚɡɥɢɱɧɵɟ ɜɤɭɫɨɚɪɨɦɚɬɢɱɟɫɤɢɟ, ɞɭɛɢɥɶɧɵɟ, ɚɧɬɢɨɤɢɫɥɢɬɟɥɶɧɵɟ, ɚɧɬɢɦɢɤɪɨɛɧɵɟ ɢ ɩɪɨɱɢɟ ɫɜɨɣɫɬɜɚ. Ɉɞɧɢɦ ɢɡ ɩɪɢɨɪɢɬɟɬɧɵɯ ɧɚɩɪɚɜɥɟɧɢɣ ɤɨɪɪɟɤɰɢɢ
ɩɢɬɚɧɢɹ ɢ ɡɞɨɪɨɜɶɹ ɫɨɜɪɟɦɟɧɧɨɝɨ ɱɟɥɨɜɟɤɚ ɹɜɥɹɸɬɫɹ ɩɪɨɞɭɤɬɵ ɮɭɧɤɰɢɨɧɚɥɶɧɨɣ ɧɚɩɪɚɜɥɟɧɧɨɫɬɢ,
ɜ ɬɨɦ ɱɢɫɥɟ ɩɢɳɟɜɵɟ ɞɨɛɚɜɤɢ ɤ ɩɢɳɟ, ɤɚɤ ɢɫɬɨɱɧɢɤ ɧɟɡɚɦɟɧɢɦɵɯ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ [1]. ɉɨɷɬɨɦɭ
ɝɥɭɛɨɤɚɹ ɩɟɪɟɪɚɛɨɬɤɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ, ɜ ɬɨɦ ɱɢɫɥɟ ɢ ɜɢɧɨɝɪɚɞɧɨɣ, ɫ ɩɨɥɭɱɟɧɢɟɦ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ (ȻȺȼ) ɹɜɥɹɟɬɫɹ ɨɞɧɨɣ ɢɡ ɜɚɠɧɟɣɲɢɯ ɡɚɞɚɱ ɩɨ ɨɛɟɫɩɟɱɟɧɢɸ ɧɚɫɟɥɟɧɢɹ ɮɭɧɤɰɢɨɧɚɥɶɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ ɩɢɬɚɧɢɹ [2].
ɂɫɫɥɟɞɨɜɚɧɢɹ ɡɚɪɭɛɟɠɧɵɯ ɭɱɟɧɵɯ (Ɏɪɚɧɰɢɹ, ɂɬɚɥɢɹ, ɂɫɩɚɧɢɹ, ɋɒȺ ɢ ɞɪ.) ɩɨɤɚɡɚɥɢ ɲɢɪɨɱɚɣɲɢɣ ɫɩɟɤɬɪ ɞɟɣɫɬɜɢɹ ɢ ɜɵɫɨɤɭɸ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ɩɪɨɞɭɤɬɨɜ ɩɟɪɟɪɚɛɨɬɤɢ ɤɪɚɫɧɨɝɨ
ɜɢɧɨɝɪɚɞɚ. ȼɢɧɨɝɪɚɞ ɱɪɟɡɜɵɱɚɣɧɨ ɛɨɝɚɬ ɮɟɧɨɥɶɧɵɦɢ ɜɟɳɟɫɬɜɚɦɢ, ɤɨɬɨɪɵɟ ɹɜɥɹɸɬɫɹ ɭɧɢɤɚɥɶɧɵɦɢ ɩɪɢɪɨɞɧɵɦɢ ɫɨɟɞɢɧɟɧɢɹɦɢ, ɨɬɤɪɵɜɚɸɳɢɟ ɧɨɜɵɟ ɜɨɡɦɨɠɧɨɫɬɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɫɵɪɶɹ ɜ ɤɚɱɟɫɬɜɟ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɞɨɛɚɜɨɤ ɤ ɩɢɳɟ ɤɚɤ ɩɚɧɚɰɟɢ ɨɬ ɦɧɨɝɢɯ ɛɨɥɟɡɧɟɣ
ɛɥɚɝɨɞɚɪɹ ɫɜɨɢɦ ɦɨɳɧɵɦ ɚɧɬɢɤɚɧɰɟɪɨɝɟɧɧɵɦ ɝɟɩɚɬɨɩɪɨɬɟɤɬɨɪɧɵɦ, ɩɪɨɬɢɜɨɜɨɫɩɚɥɢɬɟɥɶɧɵɦ ɢ
ɚɧɬɢɦɢɤɪɨɛɧɵɦ ɫɜɨɣɫɬɜɚɦ. ɉɨɥɢɮɟɧɨɥɵ ɜ ɜɢɧɨɝɪɚɞɟ ɫɨɫɪɟɞɨɬɨɱɟɧɵ ɝɥɚɜɧɵɦ ɨɛɪɚɡɨɦ: 10 %
ɜ ɦɹɤɨɬɢ, 60–70 % – ɜ ɫɟɦɟɧɚɯ, 28–35 % ɜ ɤɨɠɢɰɟ. ɋɨɞɟɪɠɚɧɢɟ ɮɟɧɨɥɶɧɵɯ ɜɟɳɟɫɬɜ ɜ ɫɟɦɟɧɚɯ
ɜɚɪɶɢɪɭɟɬ ɨɬ 5 ɞɨ 8 % ɩɨ ɦɚɫɫɟ. ɉɨɥɢɮɟɧɨɥɵ ɜɢɧɨɝɪɚɞɚ, ɨɛɥɚɞɚɸɳɢɟ ɚɧɬɢɨɤɫɢɞɚɧɬɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɷɮɮɟɤɬɢɜɧɨ ɫɜɹɡɵɜɚɸɬ ɫɜɨɛɨɞɧɵɟ ɪɚɞɢɤɚɥɵ (ɜ ɬɨɦ ɱɢɫɥɟ ɬɟ, ɤɨɬɨɪɵɟ ɨɛɪɚɡɭɸɬɫɹ ɩɨɞ ɜɨɡɞɟɣɫɬɜɢɟɦ ɢɨɧɢɡɢɪɭɸɳɟɝɨ ɢɡɥɭɱɟɧɢɹ), ɚɤɬɢɜɢɡɢɪɭɸɬ ɩɪɨɰɟɫɫɵ ɜɡɚɢɦɨɞɟɣɫɬɜɢɹ ɛɟɥɤɨɜ ɩɢɳɢ ɫ
ɩɢɳɟɜɚɪɢɬɟɥɶɧɵɦɢ ɮɟɪɦɟɧɬɚɦɢ, ɭɥɭɱɲɚɸɬ ɜɫɚɫɵɜɚɧɢɟ ɩɟɩɬɢɞɨɜ ɢ ɚɦɢɧɨɤɢɫɥɨɬ, ɚɤɬɢɜɢɡɢɪɭɸɬ
ɩɪɨɰɟɫɫɵ ɷɬɟɪɢɮɢɤɚɰɢɢ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɢ ɯɨɥɟɫɬɟɪɢɧɚ, ɩɪɟɞɨɬɜɪɚɳɚɹ ɬɟɦ ɫɚɦɵɦ ɪɚɡɜɢɬɢɟ ɚɬɟɪɨɫɤɥɟɪɨɡɚ ɢ ɢɲɟɦɢɱɟɫɤɨɣ ɛɨɥɟɡɧɢ ɫɟɪɞɰɚ. ɉɪɨɰɢɚɧɢɞɢɧɵ ɤɪɚɫɧɨɝɨ ɜɢɧɨɝɪɚɞɚ ɮɢɤɫɢɪɭɸɬɫɹ
ɩɪɨɥɢɧɨɦ ɤɨɥɥɚɝɟɧɚ ɢ ɷɥɚɫɬɢɧɚ ɜ ɫɬɟɧɤɚɯ ɚɪɬɟɪɢɣ, ɭɜɟɥɢɱɢɜɚɹ ɢɯ ɩɪɨɬɢɜɨɞɟɣɫɬɜɢɟ ɞɚɜɥɟɧɢɸ
ɤɪɨɜɢ. ȼɫɟ ɷɬɢ ɮɚɤɬɨɪɵ ɜɥɢɹɸɬ ɧɚ ɫɨɞɟɪɠɚɧɢɟ ɯɨɥɟɫɬɟɪɢɧɚ ɜ ɤɪɨɜɢ ɢ ɢɧɝɢɛɢɪɭɸɬ ɮɟɪɦɟɧɬ ɝɢɫɬɢɞɢɧɞɟɤɚɪɛɨɤɫɢɥɚɡɭ, ɛɥɚɝɨɞɚɪɹ ɱɟɦɭ ɜ ɤɪɨɜɢ ɫɧɢɠɚɟɬɫɹ ɫɨɞɟɪɠɚɧɢɟ ɝɢɫɬɚɦɢɧɚ, ɨɬɜɟɱɚɸɳɟɝɨ
ɡɚ ɩɪɨɧɢɰɚɬɟɥɶɧɨɫɬɶ ɫɬɟɧɨɤ ɤɪɨɜɟɧɨɫɧɵɯ ɫɨɫɭɞɨɜ. ɉɢɳɟɜɵɟ ɞɨɛɚɜɤɢ ɧɚ ɨɫɧɨɜɟ ɩɪɨɚɧɬɨɰɢɚɧɢɞɢɧɨɜ ɜɢɧɨɝɪɚɞɧɵɯ ɤɨɫɬɨɱɟɤ, ɤɨɬɨɪɵɦ ɩɪɢɫɭɳɚ ɚɧɬɢɨɤɫɢɞɚɧɬɧɚɹ ɚɤɬɢɜɧɨɫɬɶ, ɜ ɧɟɫɤɨɥɶɤɨ ɪɚɡ
ɩɪɟɜɵɲɚɸɬ ɚɤɬɢɜɧɨɫɬɶ ɜɢɬɚɦɢɧɚ ȿ [3].
Ɉɛɨɝɚɳɟɧɢɟ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɩɨɥɢɮɟɧɨɥɚɦɢ ɩɨɡɜɨɥɢɬ ɩɨɜɵɫɢɬɶ ɢɯ ɛɢɨɥɨɝɢɱɟɫɤɭɸ ɰɟɧɧɨɫɬɶ, ɢ ɩɪɨɞɥɢɬɶ ɫɪɨɤ ɯɪɚɧɟɧɢɹ ɛɟɡ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɫɢɧɬɟɬɢɱɟɫɤɢɯ ɚɧɬɢɨɤɢɫɥɢɬɟɥɟɣ[4].
329
Ȼɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɟ ɜɟɳɟɫɬɜɚ, ɩɨɥɭɱɟɧɧɵɟ ɜ ɪɟɡɭɥɶɬɚɬɟ ɝɥɭɛɨɤɨɣ ɢ ɤɨɦɩɥɟɤɫɧɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɜɢɧɨɝɪɚɞɚ ɭɫɩɟɲɧɨ ɩɪɢɦɟɧɹɸɬɫɹ ɜ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ, ɜ ɦɟɞɢɰɢɧɟ, ɤɨɫɦɟɬɨɥɨɝɢɢ
ɞɪ. ɇɚɩɪɢɦɟɪ, Ɇɚɪɦɟɥɚɞ ɠɟɥɟɣɧɵɣ «Ȼɢɨɥɚɞ», ɫɨɞɟɪɠɚɳɢɣ ɤɨɦɩɥɟɤɫ ɪɚɫɬɢɬɟɥɶɧɵɯ ɩɨɥɢɮɟɧɨɥɨɜ.
ɂɡ ɜɢɧɨɝɪɚɞɚ ɢɡɝɨɬɚɜɥɢɜɚɟɬɫɹ ɥɟɤɚɪɫɬɜɟɧɧɵɣ ɩɪɟɩɚɪɚɬ «ɇɚɬɭɪɨɡɚ», ɤɨɬɨɪɵɣ ɜɜɨɞɢɬɫɹ ɜɧɭɬɪɢɜɟɧɧɨ ɩɪɢ ɨɫɬɪɵɯ ɩɨɬɟɪɹɯ ɤɪɨɜɢ, ɤɨɥɥɚɩɫɟ, ɲɨɤɟ. «ɇɚɬɭɪɨɡɚ» ɩɨɜɵɲɚɟɬ ɞɚɜɥɟɧɢɟ ɤɪɨɜɢ ɢ ɭɦɟɧɶɲɚɟɬ ɩɪɨɧɢɰɚɟɦɨɫɬɶ ɫɨɫɭɞɢɫɬɵɯ ɦɟɦɛɪɚɧ, ɫɩɨɫɨɛɫɬɜɭɟɬ ɭɫɜɨɟɧɢɸ ɋɚɯɚɪɨɜ ɫɟɪɞɟɱɧɨɣ ɦɵɲɰɟɣ.
ɉɢɳɟɜɚɹ ɞɨɛɚɜɤɚ «ɗɧɨɚɬ», ɩɪɟɞɫɬɚɜɥɹɸɳɚɹ ɫɨɛɨɣ ɤɨɧɰɟɧɬɪɚɬ ɩɨɥɢɮɟɧɨɥɨɜ ɜɢɧɨɝɪɚɞɚ, ɞɚɟɬ
ɯɨɪɨɲɢɟ ɪɟɡɭɥɶɬɚɬɵ ɩɪɢ ɬɟɪɚɩɢɢ ɫɟɪɞɟɱɧɨ-ɫɨɫɭɞɢɫɬɨɣ ɫɢɫɬɟɦɵ, ɜ ɱɚɫɬɧɨɫɬɢ ɩɪɢ ɪɟɚɛɢɥɢɬɚɰɢɢ
ɛɨɥɶɧɵɯ ɩɨɫɥɟ ɢɧɮɚɪɤɬɚ. Ȼɟɡɚɥɤɨɝɨɥɶɧɵɣ ɷɤɫɬɪɚɤɬ ɰɟɥɶɧɨɝɨ ɤɪɚɫɧɨɝɨ ɜɢɧɨɝɪɚɞɚ ɂɦɦɨɪɬɟɥɶ ɬɚɤ
ɠɟ ɩɪɢɦɟɧɹɬɫɹ ɜ ɤɚɱɟɫɬɜɟ ȻȺȾ. Ɍɚɤ ɠɟ ɩɨɥɢɮɟɧɨɥɚɦɢ ɨɛɨɝɚɳɚɸɬ ɦɨɥɨɱɧɵɟ ɩɪɨɞɭɤɬɵ ɞɥɹ ɩɪɟɞɨɬɜɪɚɳɟɧɢɹ ɨɤɢɫɥɟɧɢɹ ɠɢɪɨɜ, ɧɚɩɢɬɤɨɜ, ɜ ɬɨɦ ɱɢɫɥɟ ɢ ɚɥɤɨɝɨɥɶɧɵɯ ɞɥɹ ɭɦɟɧɶɲɟɧɢɹ ɚɥɤɨɝɨɥɶɧɨɣ ɡɚɜɢɫɢɦɨɫɬɢ. ȼ ɯɥɟɛɨɛɭɥɨɱɧɵɯ ɞɥɹ ɛɨɪɶɛɵ ɫ ɤɚɪɬɨɮɟɥɶɧɨɣ ɛɨɥɟɡɧɶɸ ɢ ɨɛɨɝɚɳɟɧɢɹ ɫɨɫɬɜɚ
ɯɥɟɛɨɛɭɥɨɱɧɵɯ ɢɡɞɟɥɢɣ: ɏɥɟɛɰɵ Ʌɚɣɬ ɜɚɮɟɥɶɧɵɟ ɫ ɷɤɫɬɪɚɤɬɨɦ ɜɢɧɨɝɪɚɞɚ, «Ⱦɢɚ-ȼɟɫɬɚ» ɝɪɭɩɩɚ
ɤɨɦɩɚɧɢɣ, ɫɩɟɰɢɚɥɢɡɢɪɭɸɳɢɯɫɹ ɧɚ ɜɵɩɭɫɤɟ ɩɪɨɞɭɤɬɨɜ ɡɞɨɪɨɜɨɝɨ ɩɢɬɚɧɢɹ. Ɍɚɤ ɠɟ ɩɨɥɢɮɟɧɨɥɵ
ɩɪɢɦɟɧɹɸɬɫɹ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɨɪɦɚ ɞɥɹ ɠɢɜɨɬɧɵɯ, ɧɚɩɪɢɦɟɪ, ɤɨɧɫɟɪɜɵ Royal Canin ɞɥɹ ɤɨɲɟɤ
ɨɛɨɝɚɳɚɸɬ ɩɨɥɢɮɟɧɨɥɚɦɢ ɞɥɹ ɡɚɦɟɞɥɟɧɢɹ ɨɤɢɫɥɢɬɟɥɶɧɵɯ ɩɪɨɰɟɫɫɨɜ ɢ ɭɥɭɱɲɟɧɢɹ ɩɨɱɟɱɧɨɝɨ ɤɪɨɜɨɫɧɚɛɠɟɧɢɹ [5].
ȼ ɧɚɲɟɣ ɫɬɪɚɧɟ ɩɪɨɦɵɲɥɟɧɧɚɹ ɩɟɪɟɪɚɛɨɬɤɚ ɜɢɧɨɝɪɚɞɚ ɧɚ ɜɢɧɨɦɚɬɟɪɢɚɥɵ ɢ ɫɨɤɢ ɩɪɢɜɨɞɢɬ ɤ
ɨɛɪɚɡɨɜɚɧɢɸ ɨɬɯɨɞɨɜ, ɜ ɬɨɦ ɱɢɫɥɟ ɡɧɚɱɢɬɟɥɶɧɨɝɨ ɤɨɥɢɱɟɫɬɜɚ ɜɵɠɢɦɨɤ, ɤɨɬɨɪɵɟ ɹɜɥɹɸɬɫɹ ɜɵɫɨɤɨɰɟɧɧɵɦ ɛɢɨɥɨɝɢɱɟɫɤɢɦ ɫɵɪɶɺɦ. Ɍɚɤ, ɜ 1 ɬɨɧɧɟ ɜɢɧɨɝɪɚɞɧɨɣ ɜɵɠɢɦɤɢ, ɩɨ ɨɰɟɧɤɟ ɡɚɪɭɛɟɠɧɵɯ
ɭɱɟɧɵɯ, ɫɨɞɟɪɠɢɬɫɹ ɞɨ 50 ɤɝ ɩɨɥɢɮɟɧɨɥɨɜ. ȼ ɫɜɹɡɢ ɜɵɫɨɤɨɣ ɚɧɬɢɨɤɫɢɞɚɧɬɧɨɣ ɚɤɬɢɜɧɨɫɬɶɸ ɫɩɪɨɫ
ɧɚ ɩɨɥɢɮɟɧɨɥɵ ɩɨɫɬɨɹɧɧɨ ɪɚɫɬɺɬ. Ɍɚɤ 1ɝ ɩɨɥɢɮɟɧɨɥɚ ɜɢɧɨɝɪɚɞɚ ɜ ɩɪɟɩɚɪɚɬɟ «Ɇɟɝɚɉɪɨ(ɋɒȺ)»
ɪɟɚɥɢɡɭɟɬɫɹ ɩɨ ɰɟɧɟ 20 ɞɨɥɥɚɪɨɜ [6]. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɪɨɢɡɜɨɞɫɬɜɨ ɜɢɧɨɝɪɚɞɚ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɩɪɢ
ɩɥɨɳɚɞɢ ɧɚɫɚɠɞɟɧɢɣ 14 ɬɵɫ. ɝɚ ɫɨɫɬɚɜɥɹɟɬ ɨɤɨɥɨ 85 ɬɵɫ ɬɨɧɧ, ɢɡ ɤɨɬɨɪɵɯ ɬɟɯɧɢɱɟɫɤɨɝɨ ɧɚɩɪɚɜɥɟɧɢɹ (80 %) – 68 ɬɵɫ. ɬɨɧɧ ɢ ɢɡ-ɡɚ ɨɬɫɭɬɫɬɜɢɹ ɧɚɞɥɟɠɚɳɟɣ ɬɟɯɧɨɥɨɝɢɢ ɩɨɥɭɱɟɧɢɹ ɩɨɥɢɮɟɧɨɥɨɜ
ɢɡ ɨɬɯɨɞɨɜ ɫɨɤɨɩɪɨɢɡɜɨɞɫɬɜɚ ɢ ɜɢɧɨɞɟɥɢɹ ɤɚɠɞɵɣ ɝɨɞ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɬɟɪɹɟɬɫɹ ɛɨɥɟɟ 150–200 ɦɥɧ
ɬɟɧɝɟ.
ȼ ɤɚɱɟɫɬɜɟ ɫɵɪɶɹ ɞɥɹ ɩɨɥɭɱɟɧɢɹ ɩɨɥɢɮɟɧɨɥɨɜ ɢɫɩɨɥɶɡɭɸɬɫɹ – ɨɬɯɨɞɵ ɩɟɪɟɪɚɛɨɬɤɢ ɜɢɧɨɞɟɥɢɹ
(ɜɵɠɢɦɤɢ), ɱɬɨ ɪɟɲɚɟɬ ɩɪɨɛɥɟɦɭ ɭɬɢɥɢɡɚɰɢɢ ɨɬɯɨɞɨɜ ɢ ɹɜɥɹɟɬɫɹ ɞɨɩɨɥɧɢɬɟɥɶɧɵɦ ɢɫɬɨɱɧɢɤɨɦ
ɞɨɯɨɞɚ, ɪɚɫɲɢɪɹɟɬ ɚɫɫɨɪɬɢɦɟɧɬ ɜɵɩɭɫɤɚɟɦɨɣ ɩɪɨɞɭɤɰɢɢ.
ɍɱɢɬɵɜɚɹ ɨɩɵɬ ɪɨɫɫɢɣɫɤɢɯ, ɭɤɪɚɢɧɫɤɢɯ ɢ ɞɪɭɝɢɯ ɡɚɪɭɛɟɠɧɵɯ ɭɱɟɧɵɯ ɩɪɢɦɟɧɟɧɢɹ ɩɨɥɢɮɟɧɨɥɨɜ ɜ ɤɚɱɟɫɬɜɟ ɢɫɬɨɱɧɢɤɚ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ, ɤɨɧɰɟɧɬɪɚɬɵ ɩɨɥɢɮɟɧɨɥɨɜ ɪɟɤɨɦɟɧɞɭɸɬɫɹ ɢɫɩɨɥɶɡɨɜɚɬɶ ɞɥɹ ɨɛɨɝɚɳɟɧɢɹ ɢɦɢ: ɦɨɥɨɱɧɵɯ, ɦɹɫɧɵɯ, ɯɥɟɛɨɛɭɥɨɱɧɵɯ, ɤɨɧɞɢɬɟɪɫɤɢɯ ɢɡɞɟɥɢɣ, ɫɨɤɨ ɢ ɜɢɧɨ – ɜɨɞɨɱɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɧɚɩɢɬɤɨɜ (ɜ ɬ.ɱ. ɷɧɟɪɝɟɬɢɱɟɫɤɢɯ ɢ ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ),
ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ ɩɪɨɞɭɤɬɨɜ ɢ ɞɟɬɫɤɨɝɨ ɩɢɬɚɧɢɹ; ɜ ɤɚɱɟɫɬɜɟ ɠɢɞɤɨɝɨ ɩɢɬɶɟɜɨɝɨ ɤɨɧɰɟɧɬɪɚɬɚ, ɤɚɤ
ɞɨɩɨɥɧɢɬɟɥɶɧɨɝɨ ɢɫɬɨɱɧɢɤɚ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ ɢ ɜɢɬɚɦɢɧɨɜ; ɜ ɤɚɱɟɫɬɜɟ ɚɧɬɢɨɤɫɢɞɚɧɬɚ – ɚɧɬɢɨɤɢɫɥɢɬɟɥɹ ɞɥɹ ɭɜɟɥɢɱɟɧɢɹ ɫɪɨɤɚ ɯɪɚɧɟɧɢɹ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɣ ɤɨɧɰɟɧɬɪɚɬɨɜ ɩɨɥɢɮɟɧɨɥɨɜ ɫɨɜɦɟɫɬɧɨ ɫ ɥɚɛɨɪɚɬɨɪɢɟɣ «ɗɤɫɩɟɪɬ Ɍɟɫɬ»
(Ʉɚɡɚɯɫɤɚɹ ɚɤɚɞɟɦɢɹ ɩɢɬɚɧɢɹ) ɩɪɢɜɟɞɟɧɵ ɜ ɬɚɛɥɢɰɟ 1.
Ɍɚɛɥɢɰɚ 1
ɉɢɳɟɜɚɹ ɢ ɷɧɟɪɝɟɬɢɱɟɫɤɚɹ ɰɟɧɧɨɫɬɶ ɠɢɞɤɢɯ ɤɨɧɰɟɧɬɪɚɬɨɜ ɩɨɥɢɮɟɧɨɥɨɜ
ɇɚɢɦɟɧɨɜɚɧɢɟ ɩɨɤɚɡɚɬɟɥɟɣ, ɟɞɢɧɢɰɵ
ɢɡɦɟɪɟɧɢɣ
Ɏɚɤɬɢɱɟɫɤɨɟ ɫɨɞɟɪɠɚɧɢɟ.
ɋɨɪɬ ɋɚɩɟɪɚɜɢ
ɉɢɳɟɜɚɹ ɰɟɧɧɨɫɬɶ, ɝ/100 ɝ:
Ɏɚɤɬɢɱɟɫɤɨɟ ɫɨɞɟɪɠɚɧɢɟ.
ɋɨɪɬ Ʉɚɛ.ɋɨɜɢɧɶɨɧ
Ȼɟɥɤɢ
ɀɢɪɵ
ɍɝɥɟɜɨɞɵ
ɗɧɟɪɝɟɬɢɱɟɫɤɚɹ ɰɟɧɧɨɫɬɶ, ɤɤɚɥ/ɤȾɠ/100ɝ
0,4
0,1
15,3
63,7/267
ȼ1, ɦɝ
ȼ2,ɦɝ
ȼ6, ɦɝ
Ɏɨɥɢɟɜɚɹ ɤɢɫɥɨɬɚ, ɦɝ
0,163±0,0016
0,101±0,01
0,168±0,017
0,012±0,001
Ʉɚɥɶɰɢɣ, ɦɝ
ɀɟɥɟɡɨ, ɦɝ
330
0,6
0,2
19,4
81,8/342
ɋɨɞɟɪɠɚɧɢɟ ɜɢɬɚɦɢɧɨɜ, ɜ 100ɦɥ:
0,204±0,02
0,126±0,013
0,210±0,021
0,015±0,002
Ɇɢɧɟɪɚɥɶɧɵɟ ɜɟɳɟɫɬɜɚ, ɜ 100 ɦɥ:
120±24
2±0,4
100±20
1,9±0,38
ɀɢɞɤɢɟ ɤɨɧɰɟɧɬɪɚɬɨɜ ɩɨɥɢɮɟɧɨɥɨɜ, ɯɚɪɚɤɬɟɪɢɡɭɸɬɫɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɶɸ ɢɡ–ɡɚ
ɫɨɞɟɪɠɚɳɢɯɫɹ ɜ ɧɢɯ ɜɢɬɚɦɢɧɨɜ, ɦɢɧɟɪɚɥɶɧɵɯ ɢ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ – ɩɨɥɢɮɟɧɨɥɨɜ
ɢ ɩɨ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɦ ɩɨɤɚɡɚɬɟɥɹɦ – ɬɨɜɚɪɧɵɣ ɜɢɞ, ɡɚɩɚɯ, ɜɤɭɫ, ɰɜɟɬ ɢ ɤɨɧɫɢɫɬɟɧɰɢɹ- ɨɰɟɧɢɜɚɸɬɫɹ ɩɨɥɨɠɢɬɟɥɶɧɨ. ɇɚɥɢɱɢɟ ɜ ɧɢɯ ɤɨɦɩɥɟɤɫɚ ɫɭɦɦɚɪɧɵɯ ɩɨɥɢɮɟɧɨɥɨɜ, ɨɛɥɚɞɚɸɳɢɯ ɲɢɪɨɤɢɦ
ɫɩɟɤɬɪɨɦ ɩɨɥɨɠɢɬɟɥɶɧɨɝɨ ɞɟɣɫɬɜɢɹ ɧɚ ɨɪɝɚɧɢɡɦ ɱɟɥɨɜɟɤɚ ɩɨɡɜɨɥɹɟɬ ɡɚɤɥɸɱɢɬɶ, ɱɬɨ ɧɟɨɛɯɨɞɢɦɨ
ɛɟɡ ɩɪɨɦɟɞɥɟɧɢɹ ɧɚɥɚɞɢɬɶ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɨɩɵɬɧɨ – ɩɪɨɦɵɲɥɟɧɧɨɟ ɩɪɨɢɡɜɨɞɫɬɜɨ ɠɢɞɤɢɯ ɤɨɧɰɟɧɬɪɚɬɨɜ ɩɨɥɢɮɟɧɨɥɨɜ ɢɡ ɤɪɚɫɧɵɯ ɫɨɪɬɨɜ ɜɢɧɨɝɪɚɞɚ ɢ ɢɫɩɨɥɶɡɨɜɚɬɶ ɢɯ ɜ ɤɚɱɟɫɬɜɟ ɩɢɳɟɜɨɣ ɞɨɛɚɜɤɢ
ɞɥɹ ɨɛɨɝɚɳɟɧɢɹ ɯɥɟɛɨɛɭɥɨɱɧɵɯ, ɦɨɥɨɱɧɵɯ, ɦɹɫɧɵɯ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ, ɜɢɧɨ – ɜɨɞɨɱɧɵɯ ɢɡɞɟɥɢɣ,
ɫɨɤɨɜ ɢ ɧɚɩɢɬɤɨɜ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
ɇ.ȼ. Ɋɨɠɢɧɚ. Ɋɚɡɜɢɬɢɟ ɩɪɨɢɡɜɨɞɫɬɜɚ ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ], –
http://www.milkbranch.ru/publ/view/270.html
ɋɚɛɭɪɨɜ ɇ.ȼ. ɢ Ⱥɧɬɨɧɨɜ Ɇ.ȼ. ɏɪɚɧɟɧɢɟ ɢ ɩɟɪɟɪɚɛɨɬɤɚ ɩɥɨɞɨɜ ɢ ɨɜɨɳɟɣ. –Ɇ: ɋɟɥɶɯɨɡɢɡɞɚɬ, 2008.ɋ.23–28.
Elaine W-T Chong Dietary antioxidants and primary prevention of age related macular degeneration: systematic
review and meta-analysis BMJ. 2007 October 13; 335(7623): 75
ȼɫɟ ɨ ɜɢɬɚɦɢɧɚɯ/ɩɟɪɟɜɨɞ ɫ ɚɧɝɥɢɣɫɤɨɝɨ ɋ.ɂ.ɇɟɡɥɨɛɢɧɨɣ. Ɇɨɫɤɜɚ. ɄɊɈɇ–ɉɊȿɋɋ 1995 ɋ. 188–192,
196–199
Ʌɟɱɟɧɢɟ ɜɢɧɨɝɪɚɞɨɦ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ],- http://nmedik.org/
Ɉɝɚɣ ɘ.Ⱥ., ȼɚɣɥɭɤɨ Ƚ.Ƚ., Ɂɚɝɨɪɭɣɤɨ ȼ.Ⱥ., Ʉɨɫɝɚɝɨɪɵɡ Ⱥ.Ɇ. ɉɢɳɟɜɨɣ ɤɨɧɰɟɧɬɪɚɬ ɩɨɥɢɮɟɧɨɥɨɜ ɜɢɧɨɝɪɚɞɚ «ɗɧɨɚɧɬ», ɞɨɫɬɢɠɟɧɢɹ ɢ ɩɟɪɫɩɟɤɬɢɜɵ ɩɪɨɢɡɜɨɞɫɬɜɚ ɢ ɩɪɢɦɟɧɟɧɢɹ ɜ ɩɢɬɚɧɢɢ. Ɇɚɬɟɪɢɚɥɵ ɦɟɠɞɭɧɚɪɨɞɧɨɣ ɧɚɭɱɧɨ-ɩɪɚɤɬɢɱɟɫɤɨɣ ɤɨɧɮɟɪɟɧɰɢɢ Ȼɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɟ ɩɪɢɪɨɞɧɵɟ ɫɨɟɞɢɧɟɧɢɹ ɜɢɧɨɝɪɚɞɚ:
ɩɟɪɫɩɟɤɬɢɜɵ ɩɪɨɢɡɜɨɞɫɬɜɚ ɢ ɩɪɢɦɟɧɟɧɢɟ ɜ ɦɟɞɢɰɢɧɟ / – ɋɢɦɮɟɪɨɩɨɥɶ 2001ɝ – ɋ.60–62.
ɍȾɄ 637.1
ɉȿɊɋɉȿɄɌɂȼɇɕȿ ɇȺɉɊȺȼɅȿɇɂə ɊȺɁɊȺȻɈɌɈɄ
ȼ ɌȿɏɇɈɅɈȽɂɂ ɌȼɈɊɈȽȺ ɂ ɆəȽɄɂɏ ɋɕɊɈȼ
ɆȺɃɈɊɈȼ Ⱥ.Ⱥ., ɆɍɋɂɇȺ Ɉ.ɇ.,
ɎȽȻɇɍ «ɋɢɛɢɪɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɫɵɪɨɞɟɥɢɹ»,
Ȼɚɪɧɚɭɥ, Ɋɨɫɫɢɣɫɤɚɹ Ɏɟɞɟɪɚɰɢɹ, musinaolga@gmail.com
ɉɪɨɜɟɞɟɧɧɵɣ ɦɨɫɤɨɜɫɤɢɦɢ ɭɱɟɧɵɦɢ ɤɨɦɩɥɟɤɫ ɢɫɫɥɟɞɨɜɚɧɢɣ [6] ɜɵɹɜɢɥ ɩɟɪɫɩɟɤɬɢɜɧɵɟ ɧɚɩɪɚɜɥɟɧɢɹ ɪɚɡɪɚɛɨɬɨɤ ɜ ɬɟɯɧɨɥɨɝɢɢ ɦɨɥɨɱɧɨ-ɛɟɥɤɨɜɵɯ ɩɪɨɞɭɤɬɨɜ:
ɩɨɜɵɲɟɧɢɟ ɜɥɚɝɨɫɜɹɡɵɜɚɸɳɟɣ ɫɩɨɫɨɛɧɨɫɬɢ;
ɭɥɭɱɲɟɧɢɟ ɫɬɪɭɤɬɭɪɧɨ-ɦɟɯɚɧɢɱɟɫɤɢɯ ɫɜɨɣɫɬɜ;
ɫɧɢɠɟɧɢɟ ɫɟɛɟɫɬɨɢɦɨɫɬɢ;
ɩɪɢɞɚɧɢɟ ɩɪɨɞɭɤɬɭ ɥɟɱɟɛɧɨ-ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ ɫɜɨɣɫɬɜ ɩɭɬɟɦ ɜɧɟɫɟɧɢɹ ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ ɤɨɦɩɨɧɟɧɬɨɜ;
ɩɨɥɭɱɟɧɢɟ ɩɪɨɞɭɤɬɚ, ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɝɨ ɩɨ ɫɨɞɟɪɠɚɧɢɸ ɛɟɥɤɨɜ, ɠɢɪɨɜ ɢ ɭɝɥɟɜɨɞɨɜ ɢ ɨɬɜɟɱɚɸɳɟɝɨ ɷɧɟɪɝɟɬɢɱɟɫɤɢɦ ɩɨɬɪɟɛɧɨɫɬɹɦ;
ɭɜɟɥɢɱɟɧɢɟ ɤɨɥɢɱɟɫɬɜɚ ɜɤɭɫɨɜɵɯ ɧɚɩɨɥɧɢɬɟɥɟɣ ɩɪɢ ɦɢɧɢɦɚɥɶɧɨɦ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɢɫɤɭɫɫɬɜɟɧɧɵɯ ɩɢɳɟɜɵɯ ɞɨɛɚɜɨɤ;
ɩɨɜɵɲɟɧɢɟ ɫɪɨɤɚ ɝɨɞɧɨɫɬɢ ɩɪɨɞɭɤɬɚ ɛɟɡ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɤɨɧɫɟɪɜɢɪɭɸɳɢɯ ɜɟɳɟɫɬɜ.
Ⱥɧɚɥɢɡ ɪɟɡɭɥɶɬɚɬɨɜ ɷɬɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɨɡɜɨɥɢɥ ɚɜɬɨɪɚɦ ɩɪɟɞɥɨɠɢɬɶ ɤɨɧɤɪɟɬɧɵɟ ɩɟɪɫɩɟɤɬɢɜɧɵɟ ɧɚɩɪɚɜɥɟɧɢɹ ɪɚɡɪɚɛɨɬɨɤ ɜ ɬɟɯɧɨɥɨɝɢɢ ɬɜɨɪɨɝɚ ɢ ɦɹɝɤɢɯ ɫɵɪɨɜ.
Ɉɞɧɢɦ ɢɡ ɩɟɪɫɩɟɤɬɢɜɧɵɯ ɧɚɩɪɚɜɥɟɧɢɣ ɚɜɬɨɪɵ ɫɱɢɬɚɸɬ ɚɤɬɢɜɧɨɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɜ ɪɟɰɟɩɬɭɪɚɯ
ɬɜɨɪɨɝɚ ɢ ɦɹɝɤɢɯ ɫɵɪɨɜ ɪɚɫɬɢɬɟɥɶɧɵɯ ɤɨɦɩɨɧɟɧɬɨɜ. ȼ Ɋɨɫɫɢɢ ɬɚɤɢɦɢ ɤɨɦɩɨɧɟɧɬɚɦɢ ɦɨɝɭɬ ɛɵɬɶ
ɡɟɪɧɨɜɵɟ ɢ ɡɟɪɧɨɛɨɛɨɜɵɟ ɤɭɥɶɬɭɪɵ, ɨɬɥɢɱɚɸɳɢɟɫɹ ɛɨɥɶɲɨɣ ɪɟɫɭɪɫɧɨɫɬɶɸ, ɞɨɫɬɭɩɧɨɫɬɶɸ ɢ ɫɪɚɜɧɢɬɟɥɶɧɨ ɧɢɡɤɨɣ ɫɟɛɟɫɬɨɢɦɨɫɬɶɸ.
Ɂɟɪɧɨɜɵɟ ɢ ɡɟɪɧɨɛɨɛɨɜɵɟ ɤɨɦɩɨɧɟɧɬɵ ɫɨɞɟɪɠɚɬ ɤɪɚɯɦɚɥ, ɫɥɢɡɢ, ɝɭɦɦɢ, ɰɟɥɥɸɥɨɡɭ ɢ ɪɹɞ ɞɪɭɝɢɯ ɜɟɳɟɫɬɜ, ɨɛɥɚɞɚɸɳɢɦɢ ɡɧɚɱɢɬɟɥɶɧɨɣ ɜɥɚɝɨɩɨɝɥɨɬɢɬɟɥɶɧɨɣ ɢ ɜɥɚɝɨɭɞɟɪɠɢɜɚɸɳɟɣ ɫɩɨɫɨɛɧɨɫɬɹɦɢ. ɇɚɲɢ ɫɨɛɫɬɜɟɧɧɵɟ ɷɤɫɩɟɪɢɦɟɧɬɵ ɬɚɤɠɟ ɩɨɞɬɜɟɪɠɞɚɸɬ ɷɬɨɬ ɮɚɤɬ [4]. ɑɬɨ ɤɚɫɚɟɬɫɹ ɩɨɥɨɠɢɬɟɥɶɧɨɝɨ ɜɥɢɹɧɢɹ ɡɟɪɧɨɜɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɧɚɩɨɥɧɢɬɟɥɟɣ ɧɚ ɫɬɪɭɤɬɭɪɧɨ-ɦɟɯɚɧɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ
ɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɬɨɜ, ɬɭɬ ɬɚɤɠɟ ɢɦɟɟɬɫɹ ɪɹɞ ɩɨɞɬɜɟɪɠɞɚɸɳɢɯ ɫɨɨɛɳɟɧɢɣ. ɇɚɩɪɢɦɟɪ, ɩɨɤɚɡɚɧɚ
ɜɨɡɦɨɠɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɜ ɤɚɱɟɫɬɜɟ ɫɬɚɛɢɥɢɡɚɬɨɪɨɜ: ɩɢɳɟɜɵɯ ɜɨɥɨɤɨɧ – ɞɥɹ ɦɹɝɤɨɝɨ ɞɢɟɬɢɱɟɫ331
ɤɨɝɨ ɬɜɨɪɨɝɚ, ɬɜɨɪɨɠɧɵɯ ɞɟɫɟɪɬɨɜ; ɪɠɚɧɨɣ ɦɭɤɢ – ɞɥɹ ɤɢɫɥɨɦɨɥɨɱɧɨɝɨ ɩɪɨɞɭɤɬɚ; ɝɨɪɨɯɚ ɢ ɮɚɫɨɥɢ – ɞɥɹ ɤɪɟɦɨɜ ɬɜɨɪɨɠɧɨ-ɛɨɛɨɜɵɯ ɢ ɬ.ɞ. [4,5]. ɋɧɢɠɟɧɢɟ ɫɟɛɟɫɬɨɢɦɨɫɬɢ ɬɜɨɪɨɝɚ ɢ ɦɹɝɤɢɯ ɫɵɪɨɜ
ɞɨɫɬɢɝɚɟɬɫɹ ɡɚ ɫɱɟɬ ɤɨɦɛɢɧɢɪɨɜɚɧɢɹ ɫ ɧɟɞɨɪɨɝɢɦ ɦɟɫɬɧɵɦ ɫɵɪɶɟɦ, ɜɵɛɪɚɧɧɵɦ ɢɡ ɲɢɪɨɤɨɝɨ ɚɫɫɨɪɬɢɦɟɧɬɚ ɡɟɪɧɨɜɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ.
ȼɜɟɞɟɧɢɟ ɡɟɪɧɨɜɵɯ ɞɨɛɚɜɨɤ ɜ ɦɨɥɨɱɧɭɸ ɨɫɧɨɜɭ ɩɨɡɜɨɥɹɟɬ ɩɨɜɵɫɢɬɶ ɛɢɨɥɨɝɢɱɟɫɤɭɸ ɢ ɜɢɬɚɦɢɧɧɭɸ ɰɟɧɧɨɫɬɶ ɤɨɧɟɱɧɨɝɨ ɩɪɨɞɭɤɬɚ, ɭɥɭɱɲɢɬɶ ɟɝɨ ɦɢɧɟɪɚɥɶɧɵɣ ɫɨɫɬɚɜ, ɨɛɨɝɚɬɢɬɶ ɩɢɳɟɜɵɦɢ ɜɨɥɨɤɧɚɦɢ ɢ ɞɪɭɝɢɦɢ ɰɟɧɧɵɦɢ ɤɨɦɩɨɧɟɧɬɚɦɢ. Ⱥɧɚɥɢɡ ɧɨɜɵɯ ɪɚɡɪɚɛɨɬɨɤ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ,
ɱɬɨ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɜ ɦɢɪɟ ɩɨɩɭɥɹɪɧɵ ɩɪɨɞɭɤɬɵ, ɛɚɡɢɪɭɸɳɢɟɫɹ ɧɚ ɫɨɱɟɬɚɧɢɢ ɦɨɥɨɱɧɨ-ɛɟɥɤɨɜɨɣ ɨɫɧɨɜɵ ɢ ɤɚɤɢɯ-ɥɢɛɨ ɡɟɪɧɨɜɵɯ ɤɨɦɩɨɧɟɧɬɨɜ. ɂɯ ɮɭɧɤɰɢɨɧɚɥɶɧɨɟ ɞɟɣɫɬɜɢɟ ɨɛɭɫɥɨɜɥɟɧɨ
ɩɪɢɫɭɬɫɬɜɢɟɦ ɰɟɥɨɝɨ ɤɨɦɩɥɟɤɫɚ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ (ɩɢɳɟɜɵɟ ɜɨɥɨɤɧɚ, ɜɢɬɚɦɢɧɵ,
ɦɢɧɟɪɚɥɶɧɵɟ ɜɟɳɟɫɬɜɚ, ɥɢɩɢɞɵ, ɚɧɬɢɨɤɫɢɞɚɧɬɵ, ɩɪɟɛɢɨɬɢɱɟɫɤɢɟ ɭɝɥɟɜɨɞɵ ɢ ɞɪ.). ɇɚɩɪɚɜɥɟɧɢɟ
ɩɨ ɰɟɥɟɜɨɦɭ ɤɨɦɛɢɧɢɪɨɜɚɧɢɸ ɦɨɥɨɱɧɨɝɨ ɢ ɡɟɪɧɨɜɨɝɨ ɫɵɪɶɹ ɜɟɫɶɦɚ ɷɮɮɟɤɬɢɜɧɨ, ɬɚɤ ɤɚɤ ɩɨɡɜɨɥɹɟɬ ɢɫɩɨɥɶɡɨɜɚɬɶ ɲɢɪɨɤɢɣ ɤɪɭɝ ɫɵɪɶɟɜɵɯ ɪɟɫɭɪɫɨɜ, ɩɪɨɢɡɜɨɞɢɬɶ ɩɪɨɞɭɤɬɵ ɫ ɡɚɞɚɧɧɵɦ ɫɨɫɬɚɜɨɦ
ɢ ɫɜɨɣɫɬɜɚɦɢ. ȼ ɷɬɢɯ ɫɥɭɱɚɹɯ ɦɨɠɧɨ ɨɞɧɨɜɪɟɦɟɧɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɩɨɥɟɡɧɵɟ ɫɜɨɣɫɬɜɚ ɨɬɞɟɥɶɧɵɯ
ɤɨɦɩɨɧɟɧɬɨɜ, ɞɨɛɢɬɶɫɹ ɥɭɱɲɟɣ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɫɬɢ ɩɢɬɚɬɟɥɶɧɵɯ ɜɟɳɟɫɬɜ ɜ ɝɨɬɨɜɨɦ ɩɪɨɞɭɤɬɟ.
Ɋɟɝɭɥɹɪɧɨɟ ɩɨɬɪɟɛɥɟɧɢɟ ɬɚɤɢɯ ɩɪɨɞɭɤɬɨɜ ɜ ɫɨɫɬɚɜɟ ɩɢɳɟɜɨɝɨ ɪɚɰɢɨɧɚ ɫɨɨɬɜɟɬɫɬɜɭɟɬ ɩɪɢɧɰɢɩɚɦ
ɡɞɨɪɨɜɨɝɨ ɩɢɬɚɧɢɹ, ɞɨɫɬɨɜɟɪɧɨ ɭɥɭɱɲɚɹ ɫɨɫɬɨɹɧɢɟ ɡɞɨɪɨɜɶɹ ɢ ɫɭɳɟɫɬɜɟɧɧɨ ɫɧɢɠɚɹ ɪɢɫɤ ɜɨɡɧɢɤɧɨɜɟɧɢɹ ɡɚɛɨɥɟɜɚɧɢɣ [1, 4].
Ɋɚɡɧɨɨɛɪɚɡɢɬɶ ɚɫɫɨɪɬɢɦɟɧɬ ɦɹɝɤɢɯ ɫɵɪɨɜ ɢ ɬɜɨɪɨɠɧɵɯ ɩɪɨɞɭɤɬɨɜ ɫ ɡɟɪɧɨɜɵɦɢ ɢɥɢ ɡɟɪɧɨɛɨɛɨɜɵɦɢ ɧɚɩɨɥɧɢɬɟɥɹɦɢ ɩɨɡɜɨɥɹɟɬ ɜɧɟɫɟɧɢɟ ɧɚɬɭɪɚɥɶɧɵɯ ɜɤɭɫɨɜɵɯ ɢ ɚɪɨɦɚɬɢɱɟɫɤɢɯ ɞɨɛɚɜɨɤ, ɲɢɪɨɤɢɣ ɫɩɟɤɬɪ ɤɨɬɨɪɵɯ ɢɦɟɟɬɫɹ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ.
ɉɨɜɵɫɢɬɶ ɫɪɨɤ ɝɨɞɧɨɫɬɢ ɩɪɨɞɭɤɬɚ ɛɟɡ ɩɪɢɦɟɧɟɧɢɹ ɤɨɧɫɟɪɜɚɧɬɨɜ ɦɨɝɭɬ ɫɨɜɪɟɦɟɧɧɵɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɩɪɢɟɦɵ, ɜ ɱɚɫɬɧɨɫɬɢ ɬɟɪɦɢɡɚɰɢɹ, ɥɢɨɮɢɥɢɡɚɰɢɹ, ɡɚɦɨɪɚɠɢɜɚɧɢɟ, ɚɫɟɩɬɢɱɟɫɤɚɹ ɭɩɚɤɨɜɤɚ ɢ ɬ.ɞ.
ɂɬɚɤ, ɩɪɨɞɭɦɚɧɧɵɣ ɜɵɛɨɪ ɧɚɩɨɥɧɢɬɟɥɟɣ ɩɨɡɜɨɥɢɬ ɩɪɢɞɚɬɶ ɬɜɨɪɨɝɭ ɢ ɦɹɝɤɢɦ ɫɵɪɚɦ ɞɢɟɬɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ, ɫɧɢɡɢɬɶ ɫɟɛɟɫɬɨɢɦɨɫɬɶ, ɭɥɭɱɲɢɬɶ ɫɬɪɭɤɬɭɪɧɨ-ɦɟɯɚɧɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ ɢ ɜɥɚɝɨɫɜɹɡɵɜɚɸɳɭɸ ɫɩɨɫɨɛɧɨɫɬɶ, ɩɪɢ ɝɪɚɦɨɬɧɨɦ ɨɛɨɫɧɨɜɚɧɢɢ ɪɟɰɟɩɬɭɪɵ – ɫɛɚɥɚɧɫɢɪɨɜɚɬɶ ɩɪɨɞɭɤɬ ɩɨ
ɫɨɞɟɪɠɚɧɢɸ ɨɫɧɨɜɧɵɯ ɧɭɬɪɢɟɧɬɨɜ.
ȼ ɰɟɥɨɦ, ɷɬɨ ɧɚɩɪɚɜɥɟɧɢɟ ɧɟ ɹɜɥɹɟɬɫɹ ɫɨɜɟɪɲɟɧɧɨ ɧɨɜɵɦ, ɟɝɨ ɢɫɬɨɤɢ ɡɚɥɨɠɟɧɵ ɧɟɫɤɨɥɶɤɨ ɞɟɫɹɬɤɨɜ ɥɟɬ ɧɚɡɚɞ. ɍɠɟ ɜ 1966 ɝ. ɛɵɥ ɢɡɜɟɫɬɟɧ ɫɩɨɫɨɛ ɩɨɥɭɱɟɧɢɹ ɦɨɥɨɱɧɨ-ɛɟɥɤɨɜɵɯ ɩɪɨɞɭɤɬɨɜ, ɜ
ɱɚɫɬɧɨɫɬɢ ɬɜɨɪɨɠɧɨɣ ɦɚɫɫɵ, ɫɨɞɟɪɠɚɳɟɣ ɦɭɤɭ ɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ. ɂɡɭɱɟɧɚ ɜɨɡɦɨɠɧɨɫɬɢ ɩɪɢɦɟɧɟɧɢɹ ɛɟɥɤɨɜ ɧɭɬɚ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɦɨɥɨɱɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɜ ɪɟɡɭɥɶɬɚɬɟ ɱɟɝɨ ɪɚɡɪɚɛɨɬɚɧ ɫɩɨɫɨɛ
ɩɨɥɭɱɟɧɢɹ ɛɟɥɤɨɜɨɝɨ ɩɪɨɞɭɤɬɚ, ɩɪɟɞɧɚɡɧɚɱɟɧɧɨɝɨ ɞɥɹ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɬɜɨɪɨɝɚ.
Ɋɚɡɪɚɛɨɬɚɧɵ ɬɟɯɧɨɥɨɝɢɢ ɬɜɨɪɨɠɧɵɯ ɩɪɨɞɭɤɬɨɜ ɢ ɤɪɟɦɨɜ ɫ ɤɥɟɬɱɚɬɤɨɣ ɡɟɪɧɨɜɵɯ, ɩɭɞɢɧɝɨɜ ɢɡ ɧɟɠɢɪɧɨɝɨ ɬɜɨɪɨɝɚ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɜ ɤɚɱɟɫɬɜɟ ɧɚɩɨɥɧɢɬɟɥɟɣ ɦɭɤɢ ɪɢɫɨɜɨɣ, ɤɭɤɭɪɭɡɧɨɣ, ɹɱɦɟɧɧɨɣ,
ɨɜɫɹɧɨɣ, ɡɚɪɨɞɵɲɟɣ ɩɲɟɧɢɰɵ, ɩɲɟɧɢɱɧɵɯ ɨɬɪɭɛɟɣ. Ɂɚɩɚɬɟɧɬɨɜɚɧ ɫɩɨɫɨɛ ɩɨɥɭɱɟɧɢɹ ɦɨɥɨɱɧɨɝɨ
ɩɪɨɞɭɤɬɚ ɫ ɤɪɭɩɨɣ (ɪɢɫɨɜɨɣ, ɝɪɟɱɧɟɜɨɣ, ɩɲɟɧɧɨɣ). ɉɪɢ ɢɡɝɨɬɨɜɥɟɧɢɢ ɩɪɨɞɭɤɬɚ ɩɢɬɚɧɢɹ ɞɥɹ ɩɨɠɢɥɵɯ ɥɸɞɟɣ, ɜ ɤɚɱɟɫɬɜɟ ɦɨɥɨɱɧɨɣ ɨɫɧɨɜɵ ɢɫɩɨɥɶɡɭɟɬɫɹ ɬɜɨɪɨɝ ɧɟɠɢɪɧɵɣ, ɜ ɤɚɱɟɫɬɜɟ ɡɟɪɧɨɜɨɣ
– ɤɪɭɩɚ ɝɪɟɱɧɟɜɚɹ ɢɥɢ ɦɚɧɧɚɹ. ȼ Ʉɟɦɟɪɨɜɨ ɪɚɡɪɚɛɨɬɚɧɚ ɬɟɯɧɨɥɨɝɢɹ ɩɨɥɭɱɟɧɢɹ ɦɨɥɨɱɧɨ-ɛɟɥɤɨɜɨɣ
ɩɚɫɬɵ, ɫɨɞɟɪɠɚɳɟɣ ɩɪɨɞɭɤɬ ɬɟɪɦɨɦɟɯɚɧɢɱɟɫɤɨɣ ɨɛɪɚɛɨɬɤɢ ɹɱɦɟɧɹ, ɬɟɯɧɨɥɨɝɢɹ ɩɨɥɭɱɟɧɢɹ ɬɜɨɪɨɠɧɨɣ ɦɚɫɫɵ, ɜɵɪɚɛɚɬɵɜɚɟɦɨɣ ɧɚ ɨɫɧɨɜɟ ɧɟɠɢɪɧɨɝɨ ɬɜɨɪɨɝɚ ɫ ɞɨɛɚɜɥɟɧɢɟɦ ɨɛɠɚɪɟɧɧɵɯ ɨɜɫɹɧɵɯ
ɯɥɨɩɶɟɜ, ɬɜɨɪɨɠɧɨ-ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɞɭɤɬɚ ɫ ɩɲɟɧɢɱɧɵɦɢ ɡɚɪɨɞɵɲɟɜɵɦɢ ɯɥɨɩɶɹɦɢ ɢ ɫ ɩɲɟɧɢɱɧɵɦɢ ɨɬɪɭɛɹɦɢ. Ȼɨɥɟɟ ɞɟɬɚɥɶɧɨ ɢɫɬɨɪɢɹ ɷɬɨɝɨ ɧɚɭɱɧɨɝɨ ɧɚɩɪɚɜɥɟɧɢɹ ɨɫɜɟɳɟɧɚ ɜ ɪɚɛɨɬɟ [2, 3].
ȼ ɩɪɨɢɡɜɨɞɫɬɜɟ ɦɹɝɤɢɯ ɫɵɪɨɜ ɲɢɪɨɤɨɟ ɩɪɢɦɟɧɟɧɢɟ ɧɚɲɥɢ ɩɪɨɞɭɤɬɵ ɩɟɪɟɪɚɛɨɬɤɢ ɫɨɢ (ɦɨɥɨɤɨ, ɤɨɧɰɟɧɬɪɚɬ, ɛɟɥɨɤ ɢ ɞɪ.). ɉɪɢ ɜɵɪɚɛɨɬɤɟ ɦɹɝɤɢɯ ɫɵɪɨɜ ɩɪɢɦɟɧɹɸɬ ɠɢɪɨɜɵɟ ɤɨɦɩɨɡɢɰɢɢ ɢɡ
ɪɚɫɬɢɬɟɥɶɧɵɯ ɦɚɫɟɥ (ɪɚɩɫɨɜɨɝɨ, ɨɥɢɜɤɨɜɨɝɨ, ɨɛɥɟɩɢɯɨɜɨɝɨ ɢ ɞɪ.). Ɇɹɝɤɢɟ ɫɵɪɵ ɤɨɦɛɢɧɢɪɭɸɬ ɫ
ɡɟɪɧɨɜɵɦɢ ɤɨɦɩɨɧɟɧɬɚɦɢ: ɩɲɟɧɢɱɧɵɦɢ ɡɚɪɨɞɵɲɟɜɵɦɢ ɯɥɨɩɶɹɦɢ, ɩɲɟɧɢɱɧɵɦɢ ɢɥɢ ɪɠɚɧɵɦɢ
ɨɬɪɭɛɹɦɢ, ɩɨɥɢɫɨɥɨɞɨɜɵɦ ɷɤɫɬɪɚɤɬɨɦ [2].
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɪɚɡɪɚɛɨɬɤɢ, ɩɪɟɞɭɫɦɚɬɪɢɜɚɸɳɢɟ ɜɧɟɫɟɧɢɟ ɜ ɪɟɰɟɩɬɭɪɭ ɬɜɨɪɨɠɧɵɯ ɩɪɨɞɭɤɬɨɜ ɢ
ɦɹɝɤɢɯ ɫɵɪɨɜ ɡɟɪɧɨɜɵɯ ɢ/ɢɥɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɨɦɩɨɧɟɧɬɨɜ, ɦɨɠɧɨ ɫɱɢɬɚɬɶ ɩɟɪɫɩɟɤɬɢɜɧɵɦɢ. Ʉɪɨɦɟ
ɬɨɝɨ, ɲɢɪɨɤɢɣ ɫɩɟɤɬɪ ɡɟɪɧɨɜɨɝɨ ɢ ɡɟɪɧɨɛɨɛɨɜɨɝɨ ɫɵɪɶɹ ɩɨɡɜɨɥɹɟɬ ɧɚɞɟɹɬɶɫɹ ɧɚ ɫɨɨɬɜɟɬɫɬɜɭɸɳɟɟ
ɪɚɫɲɢɪɟɧɢɟ ɚɫɫɨɪɬɢɦɟɧɬɚ ɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɬɨɜ ɫ ɬɚɤɢɦɢ ɧɚɩɨɥɧɢɬɟɥɹɦɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
332
Ƚɚɜɪɢɥɨɜɚ ɇ.Ȼ., ɒɢɥɨɜɚ ɇ.Ɇ. ɂɫɫɥɟɞɨɜɚɧɢɟ ɜɥɢɹɧɢɹ ɡɟɪɧɨɜɨɣ ɞɨɛɚɜɤɢ ɧɚ ɛɢɨɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɩɚɪɚɦɟɬɪɵ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɢɫɥɨɦɨɥɨɱɧɨɝɨ ɩɪɨɞɭɤɬɚ // Ɇɨɥɨɱɧɚɹ ɩɪɨɦɵɲɥɟɧɧɨɫɬɶ ɋɢɛɢɪɢ: ɋɛ. ɦɚɬ. IV
ɫɩɟɰɢɚɥɢɡɢɪ. ɤɨɧɝɪ. 2004.- Ȼɚɪɧɚɭɥ
Ɇɭɫɢɧɚ Ɉ.ɇ. Ʉɨɦɛɢɧɢɪɨɜɚɧɧɵɟ ɩɪɨɞɭɤɬɵ ɜ ɨɬɟɱɟɫɬɜɟɧɧɨɦ ɫɵɪɨɞɟɥɢɢ: Ɇɨɧɨɝɪɚɮɢɹ. – Ȼɚɪɧɚɭɥ, 2007. –
170 ɫ.
Ɇɭɫɢɧɚ Ɉ.ɇ. ɉɪɢɦɟɧɟɧɢɟ ɡɟɪɧɨɜɵɯ ɤɨɦɩɨɧɟɧɬɨɜ ɜ ɦɨɥɨɱɧɨɣ ɨɬɪɚɫɥɢ // Ɇɨɥɨɱɧɚɹ ɩɪɨɦɵɲɥɟɧɧɨɫɬɶ.2006.-ʋ10.-ɋ.60–61
4.
5.
6.
Ɇɭɫɢɧɚ Ɉ.ɇ., ɓɟɬɢɧɢɧ Ɇ.ɉ., ɋɚɯɪɵɧɢɧ Ɇ.ɇ. ɋɨɫɬɨɹɧɢɟ ɢ ɬɟɧɞɟɧɰɢɢ ɪɚɡɜɢɬɢɹ ɛɢɨɬɟɯɧɨɥɨɝɢɢ ɤɨɦɛɢɧɢɪɨɜɚɧɧɵɯ ɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɬɨɜ: Ɇɨɧɨɝɪɚɮɢɹ. – Ȼɚɪɧɚɭɥ, 2006. – 335 ɫ.
ɐɚɪɟɜɚ ɇ.ɂ. ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɩɟɧɨɨɛɪɚɡɭɸɳɢɯ ɫɜɨɣɫɬɜ ɛɨɛɨɜɵɯ ɜ ɬɟɯɧɨɥɨɝɢɢ ɜɡɛɢɜɧɵɯ ɬɜɨɪɨɠɧɵɯ ɞɟɫɟɪɬɨɜ: ɚɜɬɨɪɟɮ. ɞɢɫ. ɤɚɧɞ.ɬɟɯɧ.ɧɚɭɤ – Ɉɪɟɥ, 2007. – 23 ɫ.
əɧɤɨɜɫɤɚɹ ȼ.ɋ. ɉɪɨɟɤɬɢɪɨɜɚɧɢɟ ɬɜɨɪɨɠɧɵɯ ɩɪɨɞɭɤɬɨɜ ɞɥɹ ɩɢɬɚɧɢɹ ɦɨɥɨɞɟɠɢ // Ɇɨɥɨɱɧɚɹ ɩɪɨɦɵɲɥɟɧɧɨɫɬɶ. 2007. ʋ12. ɋ. 71–72.
ɍȾɄ 636.294.03(571.511)
ȺɆɂɇɈɄɂɋɅɈɌɇȺə ɂ ɀɂɊɇɈɄɂɋɅɈɌɇȺə
ɏȺɊȺɄɌȿɊɂɋɂɄȺ ɋȻȺɅɈɇɋɂɊɈȼȺɇɇɈɋɌɂ
ɋɍȻɉɊɈȾɍɄɌɈȼ ɋȿȼȿɊɇɕɏ ɈɅȿɇȿɃ
ɆȺɊɐȿɏȺ ȿ.ȼ., ɒȿɅȿɉɈȼ ȼ.Ƚ. *,
ɎȽȻɇɍ ɇɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ
ɢ ɷɤɨɥɨɝɢɢ Ⱥɪɤɬɢɤɢ (ɊɎ ɝ. ɇɨɪɢɥɶɫɤ).
* ɎȽȻɍ “ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ”
(ɊɎ, ɩɨɫ. Ʉɪɚɫɧɨɨɛɫɤ ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ). magistrat79@mail.ru
Ⱥɧɚɥɢɡ ɚɦɢɧɨɤɢɫɥɨɬɧɨɝɨ ɫɨɫɬɚɜɚ ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɨ
ɩɪɟɨɛɥɚɞɚɧɢɢ ɧɟɡɚɦɟɧɢɦɵɯ ɚɦɢɧɨɤɢɫɥɨɬ (ɬɚɛɥ. 1). ɉɪɟɨɛɥɚɞɚɧɢɟ ɧɟɡɚɦɟɧɢɦɵɯ ɧɚɞ ɡɚɦɟɧɢɦɵɦɢ
ɚɦɢɧɨɤɢɫɥɨɬɚɦɢ ɫɨɫɬɚɜɥɹɟɬ ɨɬ 40,3 ɞɨ 73,6 %. ɉɨ ɨɬɧɨɲɟɧɢɸ ɧɟɡɚɦɟɧɢɦɵɯ ɤ ɡɚɦɟɧɢɦɵɦ ɩɪɟɜɚɥɢɪɭɸɬ ɫɟɥɟɡɺɧɤɚ, ɫɟɪɞɰɟ ɢ ɥɺɝɤɨɟ. ɋɨɞɟɪɠɚɧɢɟ ɠɟ ɧɟɡɚɦɟɧɢɦɵɯ ɚɦɢɧɨɤɢɫɥɨɬ ɜ ɝɭɛɚɯ ɢ ɹɡɵɤɟ
ɫɨɫɬɚɜɥɹɟɬ 78–83 ɢ 74 % ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ. ɉɪɟɨɛɥɚɞɚɸɬ ɬɚɤɢɟ ɧɟɡɚɦɟɧɢɦɵɟ ɚɦɢɧɨɤɢɫɥɨɬɵ, ɤɚɤ
ɥɢɡɢɧ, ɜɚɥɢɧ ɢ ɢɡɨɥɟɣɰɢɧ. Ɂɚɫɥɭɠɢɜɚɟɬ ɜɧɢɦɚɧɢɹ ɞɨɜɨɥɶɧɨ ɜɵɫɨɤɨɟ ɫɨɞɟɪɠɚɧɢɟ ɬɪɟɯ ɧɚɢɛɨɥɟɟ
ɞɟɮɢɰɢɬɧɵɯ ɚɦɢɧɨɤɢɫɥɨɬ ɬɪɢɩɬɨɮɚɧɚ, ɮɟɧɢɥɚɥɚɧɢɧɚ ɢ ɫɭɦɦɵ ɫɟɪɨɫɨɞɟɪɠɚɳɢɯ (ɦɟɬɢɨɧɢɧ ɢ
ɦɟɬɢɨɧɢɧ+ɰɢɫɬɢɧ).
Ɍɚɛɥɢɰɚ 1
Ⱥɦɢɧɨɤɢɫɥɨɬɧɵɣ ɫɨɫɬɚɜ ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ 1 ɢ 2 ɤɚɬɟɝɨɪɢɢ (ɝ/100ɝ, ɜ ɫɭɯɨɦ ɜɟɳɟɫɬɜɟ)
Ⱥɦɢɧɨɤɢɫɥɨɬɵ
Ʌɺɝɤɨɟ
ɋɟɪɞɰɟ
ɉɨɱɤɢ
ɋɟɥɟɡɺɧɤɚ
ɉɟɱɟɧɶ
Ƚɭɛɵ
əɡɵɤ
Ɍɪɢɩɬɨɮɚɧ
0,66±0,01
0,70±0,003
0,67±0,01
0,73±0,02
0,66±0,01
0,57±0,03
0,66±0,11
Ɉɤɫɢɩɪɨɥɢɧ
0,03±0,003
0,04±0,003
0,05±0,003
0,03±0,003
0,05±0,003
0,03±0,003
0,04±0,003
ɂɡɨɥɟɣɰɢɧ
0,74±0,01
1,39±0,11
1,39±0,12
1,99±0,41
1,53±0,28
2,84±0,10
3,43±0,15
Ɍɪɟɨɧɢɧ
2,89±0,06
3,02±0,01
2,90±0,03
3,12±0,06
2,87±0,04
2,57±0,10
2,60±0,32
ɋɟɪɢɧ
1,61±0,43
0,93±0,02
1,03±0,04
0,65±0,08
1,03±0,01
2,57±0,08
3,31±0,05
Ƚɥɢɰɢɧ
0,82±0,05
1,05±0,02
1,15±0,04
0,74±0,04
1,15±0,02
2,83±0,08
3,52±0,08
Ⱥɥɚɧɢɧ
1,19±0,17
1,25±0,04
1,46±0,05
0,82±0,06
1,42±0,05
3,70±0,15
4,89±0,12
ȼɚɥɢɧ
1,03±0,08
1,03±0,03
1,21±0,04
0,61±0,06
1,18±0,04
4,75±0,20
6,47±0,15
Ɇɟɬɢɨɧɢɧ
1,23±0,02
1,27±0,03
1,24±0,01
1,28±0,04
1,23±0,02
1,10±0,04
1,14±0,17
Ɇɟɬɢɨɧɢɧ+ɰɢɫɬɢɧ
2,29±0,05
2,41±0,01
2,31±0,02
2,49±0,06
2,27±0,03
2,01±0,09
2,15±0,32
Ʌɟɣɰɢɧ
0,69±0,35
2,25±0,24
2,41±0,29
3,13±0,75
2,65±0,55
5,15±0,17
6,32±0,28
Ƚɥɭɬɚɦɢɧ
2,82±0,13
3,19±0,09
3,87±0,16
1,70±0,24
3,79±0,10
14,87±0,64
20,17±0,46
ɉɪɨɥɢɧ
0,01±0,003
0,53±0,07
1,20±0,16
-
1,08±0,17
2,38±0,22
4,29±0,14
Ɏɟɧɢɥɚɥɚɧɢɧ+ɬɢɪɨɡɢɧ
0,63±0,16
0,72±0,02
0,92±0,04
0,53±0,14
0,89±0,04
2,50±0,12
3,50±0,08
Ʌɢɡɢɧ
4,29±0,07
4,48±0,02
4,31±0,04
4,60±0,09
4,27±0,05
3,83±0,14
4,15±0,52
Ⱥɪɝɢɧɢɧ
1,23±0,10
1,89±0,10
1,62±0,23
0,95±0,19
1,68±0,21
4,09±0,01
4,80±0,18
ɇɟɡɚɦɟɧɢɦɵɟ
14,76±0,23
17,27±0,35
17,36±0,40
18,49±1,46
17,55±0,94
25,33±0,40
30,42±1,24
Ɂɚɦɟɧɢɦɵɟ
7,70±0,67
8,88±0,33
10,37±0,66
4,89±0,45
10,20±0,32
30,47±1,15
41,02±1,01
ɋɭɦɦɚ ɚɦɢɧɨɤɢɫɥɨɬ
22,46±0,86
26,14±0,03
27,73±0,89
23,38±1,91
27,75±1,17
55,80±0,92
71,44±2,24
Ɉɬɧɨɲɟɧɢɟ ɧɟɡɚɦɟɧɢɦɵɯ ɤ ɡɚɦɟɧɢɦɵɦ
1,94±0,15
1,95±0,12
1,69±0,11
3,79±0,06
1,72±0,07
0,83±0,04
0,74±0,01
333
Ȼɢɨɥɨɝɢɱɟɫɤɭɸ ɰɟɧɧɨɫɬɶ ɛɟɥɤɨɜ ɨɩɪɟɞɟɥɹɸɬ ɩɭɬɟɦ ɫɪɚɜɧɟɧɢɹ ɚɦɢɧɨɤɢɫɥɨɬɧɨɝɨ ɫɨɫɬɚɜɚ ɢɡɭɱɚɟɦɨɝɨ ɛɟɥɤɚ ɫɨ ɫɩɪɚɜɨɱɧɨɣ ɲɤɚɥɨɣ ɚɦɢɧɨɤɢɫɥɨɬ ɝɢɩɨɬɟɬɢɱɟɫɤɨɝɨ ɢɞɟɚɥɶɧɨɝɨ ɛɟɥɤɚ ɢɥɢ ɚɦɢɧɨɝɪɚɦɦɚɦɢ ɜɵɫɨɤɨɤɚɱɟɫɬɜɟɧɧɵɯ ɫɬɚɧɞɚɪɬɧɵɯ ɛɟɥɤɨɜ. ɗɬɨɬ ɦɟɬɨɞɢɱɟɫɤɢɣ ɩɪɢɟɦ ɩɨɥɭɱɢɥ ɧɚɡɜɚɧɢɟ ɚɦɢɧɨɤɢɫɥɨɬɧɨɝɨ ɫɤɨɪɚ. ɉɪɢ ɷɬɨɦ ɩɪɢɧɹɬɨ, ɱɬɨ ɚɦɢɧɨɤɢɫɥɨɬɨɣ, ɥɢɦɢɬɢɪɭɸɳɟɣ ɛɢɨɥɨɝɢɱɟɫɤɭɸ ɰɟɧɧɨɫɬɶ ɛɟɥɤɚ, ɫɱɢɬɚɟɬɫɹ ɬɚ, ɫɤɨɪ ɤɨɬɨɪɨɣ ɢɦɟɟɬ ɧɚɢɦɟɧɶɲɟɟ ɡɧɚɱɟɧɢɟ. ȼ ɢɞɟɚɥɶɧɨɦ ɢɥɢ
ɫɬɚɧɞɚɪɬɧɨɦ ɛɟɥɤɟ ɚɦɢɧɨɤɢɫɥɨɬɧɵɣ ɫɤɨɪ ɤɚɠɞɨɣ ɧɟɡɚɦɟɧɢɦɨɣ ɚɦɢɧɨɤɢɫɥɨɬɵ ɩɪɢɧɢɦɚɸɬ ɡɚ 1,00
ɢɥɢ ɟɫɥɢ ɪɚɫɱɺɬ ɜ ɩɪɨɰɟɧɬɚɯ, ɬɨ 100 %. ɗɬɨ ɜ ɫɜɨɸ ɨɱɟɪɟɞɶ ɫɨɨɬɜɟɬɫɬɜɭɟɬ ɡɚɤɨɧɭ Ʌɢɛɢɯɚ.
Ⱥɥɝɨɪɢɬɦ ɪɚɫɱɺɬɚ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɰɟɧɧɨɫɬɢ ɫɨɫɬɨɢɬ ɜ ɬɨɦ, ɱɬɨ ɞɥɹ ɤɚɠɞɨɣ ɧɟɡɚɦɟɧɢɦɨɣ ɚɦɢɧɨɤɢɫɥɨɬɵ ɪɚɫɫɱɢɬɵɜɚɟɬɫɹ ɫɤɨɪ, ɬɨ ɟɫɬɶ ɨɬɧɨɲɟɧɢɟ ɫɨɞɟɪɠɚɧɢɹ ɚɦɢɧɨɤɢɫɥɨɬɵ ɜ ɫɦɟɫɢ ɤ ɢɞɟɚɥɶɧɨɦɭ
ɛɟɥɤɭ (ɲɤɚɥɚ). ɋɨɞɟɪɠɚɧɢɟ ɚɦɢɧɨɤɢɫɥɨɬ ɞɨɥɠɧɨ ɜɵɪɚɠɚɬɶɫɹ ɜ ɝ/100 ɝ ɛɟɥɤɚ ɢɥɢ ɛɟɥɤɨɜɨɝɨ ɷɤɜɢɜɚɥɟɧɬɚ. ȿɫɥɢ ɜɫɟ ɩɨɥɭɱɟɧɧɵɟ ɫɤɨɪɵ ɪɚɜɧɵ ɢɥɢ ɛɨɥɶɲɟ 1 (100 %), ɬɨ ɪɚɫɫɦɚɬɪɢɜɚɟɦɚɹ ɚɦɢɧɨɤɢɫɥɨɬɧɚɹ ɫɦɟɫɶ ɫɱɢɬɚɟɬɫɹ ɩɨɥɧɨɰɟɧɧɨɣ ɢ ɟɺ ɛɢɨɥɨɝɢɱɟɫɤɚɹ ɰɟɧɧɨɫɬɶ ɫɨɫɬɚɜɥɹɟɬ – 100 %.
Ⱥɦɢɧɨɤɢɫɥɨɬɧɵɣ ɫɤɨɪ ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ ɤ ɢɞɟɚɥɶɧɨɦɭ ɛɟɥɤɭ ɎȺɈ/ȼɈɁ
ɩɪɢɜɟɞɟɧ ɜ ɬɚɛɥɢɰɟ 2.
ɉɪɢ ɪɚɫɱɺɬɟ ɚɦɢɧɨɤɢɫɥɨɬɧɨɝɨ ɫɤɨɪɚ (ɬɚɛɥ. 6) ɬɪɚɞɢɰɢɨɧɧɨ ɢɫɩɨɥɶɡɭɟɦɵɯ ɜ ɩɢɳɭ ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ ɦɵ ɜɢɞɢɦ, ɱɬɨ ɥɢɲɶ 2 ɜɢɞɚ ɫɭɛɩɪɨɞɭɤɬɨɜ ɫɨɨɬɜɟɬɫɬɜɭɸɬ ɢɞɟɚɥɶɧɨɦɭ
ɛɟɥɤɭ. ɉɪɢɱɺɦ ɧɚɢɛɨɥɶɲɚɹ ɫɭɦɦɚ ɚɦɢɧɨɤɢɫɥɨɬ ɨɬɦɟɱɟɧɚ ɜ ɹɡɵɤɟ ɫ ɩɨɤɚɡɚɬɟɥɟɦ 48,7 ɝ/100ɝ ɛɟɥɤɚ,
ɢɥɢ 135,3 % ɢ ɝɭɛɚɯ – 37,64 ɢ 104,6 ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ. ɇɚɢɦɟɧɶɲɟɟ ɡɧɚɱɟɧɢɟ ɛɵɥɨ ɨɬɦɟɱɟɧɨ ɜ ɥɺɝɤɨɦ – 18,81 ɝ/100ɝ ɛɟɥɤɚ ɢ 52,3 % ɨɬ ɢɞɟɚɥɶɧɨɝɨ ɛɟɥɤɚ.
Ʌɢɦɢɬɢɪɭɸɳɢɦɢ ɚɦɢɧɨɤɢɫɥɨɬɚɦɢ ɩɪɟɢɦɭɳɟɫɬɜɟɧɧɨ ɜ ɛɨɥɶɲɢɧɫɬɜɟ ɨɛɪɚɡɰɨɜ ɹɜɥɹɥɢɫɶ ɢɡɨɥɟɣɰɢɧ, ɜɚɥɢɧ, ɥɟɣɰɢɧ ɢ ɮɟɧɢɥɚɥɚɧɢɧ+ɬɢɪɨɡɢɧ.
ɉɨ ɤɚɱɟɫɬɜɟɧɧɨɦɭ ɛɟɥɤɨɜɨɦɭ ɩɨɤɚɡɚɬɟɥɸ ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ (ɬɚɛɥ. 3) ɜɢɞɧɨ,
ɱɬɨ ɥɭɱɲɟɟ ɫɨɨɬɧɨɲɟɧɢɟ ɦɵɲɟɱɧɵɯ ɢ ɫɨɟɞɢɧɢɬɟɥɶɧɨ-ɬɤɚɧɧɵɯ ɛɟɥɤɨɜ ɢɦɟɥɢ ɥɺɝɤɨɟ ɢ ɝɭɛɵ – 21,5
ɢ 20, ɹɡɵɤ ɢ ɫɟɪɞɰɟ – 17,7 ɢ 17,6 ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ, ɯɭɞɲɟɟ – ɩɟɱɟɧɶ ɫ ɩɨɤɚɡɚɬɟɥɟɦ 12,4.
ɂɡɜɟɫɬɧɨ, ɱɬɨ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɚɹ ɞɢɟɬɚ ɞɨɥɠɧɚ ɫɨɞɟɪɠɚɬɶ ɨɝɪɚɧɢɱɟɧɧɨɟ ɤɨɥɢɱɟɫɬɜɨ ɠɢɪɨɜ.
ɉɨɷɬɨɦɭ ɜɚɠɧɨ ɩɪɚɜɢɥɶɧɨ ɜɵɛɪɚɬɶ ɢɯ ɢɫɬɨɱɧɢɤ. Ɉɛɵɱɧɨ ɜ ɩɢɬɚɧɢɢ ɫɨɜɪɟɦɟɧɧɨɝɨ ɱɟɥɨɜɟɤɚ, ɧɟɫɦɨɬɪɹ ɧɚ ɜɵɫɨɤɨɟ ɨɛɳɟɟ ɩɨɬɪɟɛɥɟɧɢɟ ɠɢɪɨɜ, ɧɟ ɯɜɚɬɚɟɬ ɧɟɡɚɦɟɧɢɦɵɯ ɠɢɪɧɵɯ ɤɢɫɥɨɬ. ȼ ɰɟɥɹɯ
ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɤɨɦɩɶɸɬɟɪɧɨɝɨ ɦɨɞɟɥɢɪɨɜɚɧɢɹ ɢ ɨɩɬɢɦɢɡɚɰɢɢ ɠɢɪɧɨɤɢɫɥɨɬɧɨɝɨ
ɫɨɫɬɚɜɚ ɩɪɨɞɭɤɬɨɜ ɮɭɧɤɰɢɨɧɚɥɶɧɨɝɨ ɩɢɬɚɧɢɹ ɧɚ ɨɫɧɨɜɟ ɫɭɛɩɪɨɞɭɤɬɨɜ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ ɧɟɨɛɯɨɞɢɦɨ ɩɪɨɜɟɫɬɢ ɚɧɚɥɢɡ ɚɞɟɤɜɚɬɧɨɫɬɢ ɠɢɪɨɜɵɯ ɤɨɦɩɨɧɟɧɬɨɜ ɞɥɹ ɞɚɧɧɨɝɨ ɜɢɞɚ ɫɵɪɶɹ.
Ɋɭɤɨɜɨɞɫɬɜɭɹɫɶ ɷɬɢɦ, ɦɵ ɩɪɨɜɟɥɢ ɚɧɚɥɢɡ ɤɚɱɟɫɬɜɟɧɧɨɝɨ ɫɨɫɬɚɜɚ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɜ ɫɭɛɩɪɨɞɭɤɬɚɯ, ɩɨɥɭɱɟɧɧɵɟ ɪɟɡɭɥɶɬɚɬɵ ɩɪɟɞɫɬɚɜɥɟɧɵ ɜ ɬɚɛɥ.4.
Ɍɚɛɥɢɰɚ 2
Ⱥɦɢɧɨɤɢɫɥɨɬɧɵɣ ɫɤɨɪ ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ ɤ ɢɞɟɚɥɶɧɨɦɭ ɛɟɥɤɭ ɎȺɈ/ȼɈɁ, ( ɝ/100ɝ ɛɟɥɤɚ)
Ⱥɦɢɧɨɤɢɫɥɨɬɵ
Ɍɪɢɩɬɨɮɚɧ
ɂɡɨɥɟɣɰɢɧ
Ɍɪɟɨɧɢɧ
ȼɚɥɢɧ
Ɇɟɬɢɨɧɢɧ +ɰɢɫɬɢɧ
Ʌɟɣɰɢɧ
Ɏɟɧɢɥɚɥɚɧɢɧ +ɬɢɪɨɡɢɧ
Ʌɢɡɢɧ
ɋɭɦɦɚ
Ȼɟɥɨɤ
ɩɨ
ɎȺɈ
/ȼɈɁ
1,0
4,0
4,0
5,0
3,5
7,0
6,0
5,5
36,0
Ȼɟɥɨɤ ɜ ɫɭɛɩɪɨɞɭɤɬɚɯ
Ʌɟɝɤɨɟ
ɝ/ %
0,86
0,96
3,76
1,34
4,58
0,90
0,82
5,59
18,8
ɋɟɪɞɰɟ
%
86
24
94
26,8
130,9
12,9
13,7
101,6
52,3
ɝ/ %
0,88
1,74
3,79
1,29
4,62
2,82
0,90
5,62
21,6
%
88
43,5
94,8
25,8
132
40,3
15
102,2
60,2
ɉɨɱɤɢ
ɝ/ %
0,87
1,80
3,75
1,57
4,60
3,12
1,19
5,58
22,4
%
87
45
93,8
31,4
134,4
44,6
19,8
101,5
62,4
ɉɟɱɟɧɶ
ɝ/ %
0,87
2,01
3,71
1,55
4,60
3,48
1,17
5,60
22,9
Ƚɭɛɵ
%
ɝ/ %
87
0,80
50,3 4,51
92,8 3,61
31
7,28
131,4 4,34
49,7 7,83
19,5 3,83
101,8 5,44
63,9 37,64
%
80
112,8
90,3
145,6
124
111,9
63,8
98,9
104,6
əɡɵɤ
ɝ/ %
1,06
5,51
4,17
10,3
5,28
10,1
5,62
6,66
48,7
%
106
137,8
104,3
207,8
150,9
145
93,7
121,1
135,3
Ɍɚɛɥɢɰɚ 3
Ʉɚɱɟɫɬɜɟɧɧɵɣ ɛɟɥɤɨɜɵɣ ɩɨɤɚɡɚɬɟɥɶ (ɄȻɉ) ɫɭɛɩɪɨɞɭɤɬɨɜ ɞɢɤɨɝɨ ɫɟɜɟɪɧɨɝɨ ɨɥɟɧɹ
Ⱥɦɢɧɨɤɢɫɥɨɬɚ
Ɍɪɢɩɬɨɮɚɧ
Ɉɤɫɢɩɪɨɥɢɧ
ɄȻɉ
334
Ʌɟɝɤɨɟ
ɋɟɪɞɰɟ
ɉɨɱɤɢ
ɉɟɱɟɧɶ
Ƚɭɛɵ
əɡɵɤ
0,86
0,04
21,5
0,88
0,05
17,6
0,87
0,06
14,5
0,87
0,07
12,4
0,80
0,04
20
1,06
0,06
17,7
Ɍɚɛɥɢɰɚ 4
ɋɨɫɬɚɜ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɜ ɫɭɛɩɪɨɞɭɤɬɚɯ ɞɢɤɢɯ ɫɟɜɟɪɧɵɯ ɨɥɟɧɟɣ, ɝ/ɤɝ
ɀɢɪɧɵɟ ɤɢɫɥɨɬɵ
Ʌɚɭɪɢɧɨɜɚɹ
Ɇɢɪɢɫɬɢɧɨɜɚɹ
ɉɚɥɶɦɢɬɢɧɨɜɚɹ
ɋɬɟɚɪɢɧɨɜɚɹ
Ⱥɪɚɯɢɧɨɜɚɹ
™ ɇɀɄ
ɉɚɥɶɦɢɬɨ-ɥɟɢɧɨɜɚɹ
Ɉɥɟɢɧɨɜɚɹ
™ ɆɇɀɄ
Ʌɢɧɨɥɟɜɚɹ
Ʌɢɧɨɥɟɧɨɜɚɹ
™ ɉɇɀɄ
ɋɭɦɦɚ ɤɢɫɥɨɬ
Ɉɬɧɨɲɟɧɢɟ ɧɟɧɚɫɵɳɟɧɧɵɯ ɤ ɧɚɫɵɳɟɧɧɵɦ
Ʌɺɝɤɨɟ
0,61±0,01
0,60±0,04
7,07±0,26
4,23±0,34
0,11±0,01
12,62
0,87±0,09
7,74±0,08
8,61
0,90±0,08
0,25±0,01
1,15
22,38±0,29
ɋɟɪɞɰɟ
0,64±0,01
0,45±0,02
6,35±0,02
5,98±0,28
0,09±0,003
13,512
0,98±0,06
8,03±0,03
9,01
1,25±0,04
0,20±0,01
1,45
23,96±0,25
ɉɨɱɤɢ
0,66±0,05
0,40±0,02
5,82±0,10
5,43±0,31
0,08
12,39
1,38±0,04
8,43±0,04
9,81
0,87±0,05
0,18±0,01
1,05
23,25±0,31
ɋɟɥɟɡɺɧɤɚ
0,73±0,10
0,66±0,08
6,49±0,67
2,12±0,62
0,12±0,003
10,12
1,33±0,25
7,97±0,30
9,3
0,55±0,04
0,27±0,03
0,82
20,23±0,50
ɉɟɱɟɧɶ
0,62±0,04
0,36±0,02
5,42±0,10
5,47±0,46
0,51±0,22
12,38
1,56±0,21
8,53±0,02
10,09
0,91±0,06
0,16±0,01
1,07
23,56±0,53
Ƚɭɛɵ
1,79±0,20
23,75±0,55
12,92±0,02
38,46
2,81±0,14
30,0±0,20
32,81
4,88±0,01
1,54±0,44
6,42
77,69±0,07
əɡɵɤ
0,48±0,13
19,61±0,50
14,62±0,10
34,71
3,93±0,06
31,44±0,06
35,37
4,03±0,12
0,36±0,01
4,39
74,46±0,36
0,77±0,02
0,78±0,02
1,93±0,05
1,03±0,13
0,91±0,06
1,02±0,04
1,15±0,02
ȼ ɪɟɡɭɥɶɬɚɬɟ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɜɵɹɜɥɟɧɨ ɩɪɟɨɛɥɚɞɚɧɢɟ ɧɟɧɚɫɵɳɟɧɧɵɯ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɜ 5 ɢɡ 8 ɨɛɪɚɡɰɨɜ. ȼɨ ɜɫɟɯ ɨɛɪɚɡɰɚɯ ɩɪɟɨɛɥɚɞɚɟɬ ɨɥɟɢɧɨɜɚɹ ɤɢɫɥɨɬɚ. ɋɨɨɬɧɨɲɟɧɢɟ ɧɟɧɚɫɵɳɟɧɧɵɯ ɤ ɧɚɫɵɳɟɧɧɵɦ ɠɢɪɧɵɦ ɤɢɫɥɨɬɚɦ ɧɚɯɨɞɢɥɨɫɶ ɜ ɩɪɟɞɟɥɚɯ ɨɬ 0,77:1 (ɥɺɝɤɨɟ) ɞɨ 1,93:1 (ɩɨɱɤɢ).
ɇɚɢɛɨɥɶɲɟɟ ɤɨɥɢɱɟɫɬɜɨ ɧɟɧɚɫɵɳɟɧɧɵɯ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɨɬɦɟɱɟɧɨ ɜ ɹɡɵɤɟ ɢ ɩɨɱɤɚɯ, ɢɯ ɭɪɨɜɟɧɶ
ɫɨɫɬɚɜɥɹɟɬ 1,15 ɢ 1,93 ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ.
Ɍɚɤɢɟ ɤɢɫɥɨɬɵ, ɤɚɤ ɥɢɧɨɥɟɜɚɹ ɢ ɥɢɧɨɥɟɧɨɜɚɹ, ɞɥɹ ɨɪɝɚɧɢɡɦɚ ɱɟɥɨɜɟɤɚ ɱɪɟɡɜɵɱɚɣɧɨ ɜɚɠɧɵ –
ɨɧɢ ɫɩɨɫɨɛɫɬɜɭɸɬ ɫɧɢɠɟɧɢɸ ɯɨɥɟɫɬɟɪɢɧɚ ɜ ɤɪɨɜɢ. ɉɨɫɤɨɥɶɤɭ ɥɢɧɨɥɟɜɚɹ ɢ ɥɢɧɨɥɟɧɨɜɚɹ ɤɢɫɥɨɬɵ
ɧɟ ɫɢɧɬɟɡɢɪɭɸɬɫɹ ɜ ɧɚɲɟɦ ɨɪɝɚɧɢɡɦɟ, ɬɨ ɜ ɪɚɰɢɨɧɟ ɩɢɬɚɧɢɹ ɨɛɹɡɚɬɟɥɶɧɨ ɞɨɥɠɧɵ ɩɪɢɫɭɬɫɬɜɨɜɚɬɶ
ɩɪɨɞɭɤɬɵ, ɫɨɞɟɪɠɚɳɢɟ ɢɯ. Ɍɚɤ, ɢɯ ɧɚɢɛɨɥɶɲɟɟ ɫɨɞɟɪɠɚɧɢɟ ɡɚɪɟɝɢɫɬɪɢɪɨɜɚɧɨ ɜ ɝɭɛɚɯ ɢ ɹɡɵɤɟ,
ɫɭɦɦɚɪɧɵɣ ɭɪɨɜɟɧɶ ɞɚɧɧɵɯ ɤɢɫɥɨɬ ɜ ɜɟɪɯɧɟɣ ɝɭɛɟ ɫɨɫɬɚɜɥɹɟɬ 5,33 ɝ/ɤɝ, ɜ ɧɢɠɧɟɣ – 6,42 ɢ ɜ ɹɡɵɤɟ – 4,39 ɝ/ɤɝ.
Ʌɢɩɚɬɨɜɵɦ ɇ.ɇ. ɜ ɫɨɚɜɬɨɪɫɬɜɟ ɩɪɟɞɥɨɠɟɧ ɠɢɪɧɨɤɢɫɥɨɬɧɵɣ ɫɨɫɬɚɜ ɤɜɚɡɢɷɬɚɥɨɧɚ ɞɥɹ ɞɟɬɟɣ ɞɨ
10 ɥɟɬ, ɤɨɬɨɪɵɣ ɦɨɠɧɨ ɩɪɢɦɟɧɢɬɶ ɢ ɞɥɹ ɮɭɧɤɰɢɨɧɚɥɶɧɨɝɨ ɩɢɬɚɧɢɹ ɥɸɞɟɣ ɜ ɫɬɚɞɢɢ ɪɟɚɛɢɥɢɬɚɰɢɢ
ɩɨɫɥɟ ɩɟɪɟɧɟɫɟɧɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ. Ɉɧ ɨɫɧɨɜɚɧ ɧɚ ɫɪɚɜɧɟɧɢɢ ɫ ɤɜɚɡɢɷɬɚɥɨɧɨɦ ɠɢɪɧɨɤɢɫɥɨɬɧɨɝɨ
ɫɨɫɬɚɜɚ ɩɪɨɞɭɤɬɨɜ ɠɢɜɨɬɧɨɝɨ ɢ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ. ɇɚɦɢ ɛɵɥɢ ɩɪɨɜɟɞɟɧɵ ɫɪɚɜɧɢɬɟɥɶɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɠɢɪɧɨɤɢɫɥɨɬɧɨɝɨ ɫɨɫɬɚɜɚ ɫɭɛɩɪɨɞɭɤɬɨɜ ɫ ɤɜɚɡɢɷɬɚɥɨɧɨɦ. (ɬɚɛɥ. 5).
Ɍɚɛɥɢɰɚ 5
ɋɪɚɜɧɢɬɟɥɶɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɤɨɷɮɮɢɰɢɟɧɬɚ ɠɢɪɧɨɤɢɫɥɨɬɧɨɣ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɫɬɢ ɫɭɛɩɪɨɞɭɤɬɨɜ
ɫ ɤɜɚɡɢɷɬɚɥɨɧɨɦ (ɩɨ ɇ.ɇ. Ʌɢɩɚɬɨɜɭ)
ɉɨɤɚɡɚɬɟɥɶ (ɜɢɞ
ɩɪɨɞɭɤɬɚ)
Ʉɜɚɡɢɷɬɚɥɨɧ
ɀɢɪ ɫɟɜɟɪɧɵɯ
ɨɥɟɧɟɣ
ɋɟɥɟɡɺɧɤɚ
Ƚɭɛɵ
ɉɟɱɟɧɶ
ɉɨɱɤɢ
əɡɵɤ
ɋɟɪɞɰɟ
Ʌɺɝɤɢɟ
ɀɢɪɧɵɟ ɤɢɫɥɨɬɵ
ɋɨɞɟɪɠɚɧɢɟ ɠɢɪɚ,, ɝ/100
ɝ ɫɭɯɨɝɨ ɜɟɳɟɫɬɜɚ
2,84±0,35
18,64±1,99
8,22±0,69
8,36±0,69
29,15±0,96
4,02±0,23
5,38±1,0
™ ɇɀɄ
™ ɆɇɀɄ
™ ɉɇɀɄ
Ʉɨɷɮɮɢɰɢɟɧɬ ɠɢɪɧɨɤɢɫɥɨɬɧɨɣ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɫɬɢ RL, ɞɨɥ.ɟɞ, i= 1…3
32,95
55,76
10,61
0,4964
34,56
29,18
33,62
0,5400
10,12
38,45
12,38
12,39
34,71
13,51
12,62
9,3
32,81
10,09
9,81
35,37
9,01
8,61
0,82
6,42
1,07
1,05
4,39
1,45
1,15
1,00
0,9677
0,9014
0,8775
0,87
0,7742
0,7733
ɉɨ ɩɨɤɚɡɚɬɟɥɸ ɪɚɰɢɨɧɚɥɶɧɨɫɬɢ ɠɢɪɧɨɤɢɫɥɨɬɧɨɝɨ ɫɨɫɬɚɜɚ, ɭɱɢɬɵɜɚɸɳɢɦ ɫɨɨɬɧɨɲɟɧɢɹ ɫɭɦɦ
ɧɚɫɵɳɟɧɧɵɯ, ɦɨɧɨɧɚɫɵɳɟɧɧɵɯ ɢ ɩɨɥɢɧɚɫɵɳɟɧɧɵɯ ɠɢɪɧɵɯ ɤɢɫɥɨɬ RL, (i= 1…3) ɫɭɛɩɪɨɞɭɤɬɵ ɩɨ
ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɫɬɢ ɨɛɥɚɞɚɸɬ (ɜ ɩɨɪɹɞɤɟ ɭɛɵɜɚɧɢɹ): ɫɟɥɟɡɟɧɤɚ –1,0, Ƚɭɛɵ – 0,967, ɩɟɱɟɧɶ, 0,90
(RL, ɞɨɥ.ɟɞ, i= 1…3). ɇɚɢɦɟɧɶɲɢɣ ɤɨɷɮɮɢɰɢɟɧɬ ɠɢɪɧɨɤɢɫɥɨɬɧɨɣ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɫɬɢ (RL, ɞɨɥ.ɟɞ,
i= 1…3) ɨɬɦɟɱɟɧ ɭ ɥɺɝɤɢɯ.
335
ɋ ɭɱɟɬɨɦ ɬɨɝɨ, ɱɬɨ ɜ ɫɭɛɩɪɨɞɭɤɬɚɯ ɨɬɫɭɬɫɬɜɭɟɬ ɚɪɚɯɢɞɨɧɨɜɚɹ ɠɢɪɧɚɹ ɤɬɢɫɥɨɬɚ ɢɯ ɤɨɦɩɥɟɤɫɧɚɹ
ɠɢɪɧɨɤɢɫɥɨɬɧɚɹ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɨɫɬɶ (RL, ɞɨɥ.ɟɞ, i= 1…6) ɪɚɜɧɚ ɧɭɥɸ.
ɀɢɪ ɫɟɜɟɪɧɵɯ ɨɥɟɧɟɣ ɩɨ ɫɨɞɟɪɠɚɧɢɸ ɧɟɧɚɫɵɳɟɧɧɵɯ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɛɥɢɡɨɤ ɤ ɤɜɚɡɢɷɬɚɥɨɧɭ,
ɧɨ ɭɫɬɭɩɚɟɬ ɩɨ ɫɨɞɟɪɠɚɧɢɸ ɦɨɧɨɧɚɫɵɳɟɧɧɵɯ ɢ ɜ ɞɜɚ ɪɚɡɚ ɩɪɟɜɵɲɚɟɬ ɩɨ ɩɨɥɢɧɚɫɵɳɟɧɧɵɦ ɠɢɪɧɵɦ ɤɢɫɥɨɬɚɦ.
ɇɚɢɛɨɥɟɟ ɛɥɢɡɤɢ ɤ ɤɜɚɡɢɷɬɚɥɨɧɭ ɩɨ ɫɨɞɟɪɠɚɧɢɸ ɠɢɪɧɵɯ ɤɢɫɥɨɬ ɝɭɛɵ ɢ ɹɡɵɤ, ɤɨɬɨɪɵɟ ɫɨɞɟɪɠɚɬ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ 18,6 ɢ 29, 15 ɝ/100 ɝ ɠɢɪɚ ɜ ɫɭɯɨɦ ɜɟɳɟɫɬɜɟ ɫɭɛɩɪɨɞɭɤɬɨɜ.
ɂɫɯɨɞɹ ɢɡ ɪɟɡɭɥɶɬɚɬɨɜ ɩɪɨɜɟɞɟɧɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɫɥɟɞɭɟɬ, ɱɬɨ ɫɭɛɩɪɨɞɭɤɬɵ ɞɢɤɢɯ ɫɟɜɟɪɧɵɯ
ɨɥɟɧɟɣ 1 ɤɚɬɟɝɨɪɢɢ ɦɨɠɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɜ ɩɪɢɝɨɬɨɜɥɟɧɢɢ ɩɚɲɬɟɬɨɜ ɫ ɰɟɥɶɸ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɢɯ ɜ
ɮɭɧɤɰɢɨɧɚɥɶɧɨɦ ɩɢɬɚɧɢɢ.
ɍȾɄ 637.146.344
ɐȿɅȿȻɇɕɃ ȻɂɈɃɈȽɍɊɌ ɂɁ ȼȿɊȻɅɘɀɖȿȽɈ ɆɈɅɈɄȺ
ɌɈɏȺɇɈȼ Ɇ.Ɍ., ɌɈɏȺɇɈȼ Ȼ.Ɇ., ɈɆɂɊɁȺɄɈȼȺ Ⱥ.ɀ.,
ɊȽɉ ɧɚ ɉɏȼ «ɘɠɧɨ-Ʉɚɡɚɯɫɬɚɧɫɤɢɣ ɝɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɭɧɢɜɟɪɫɢɬɟɬ ɢɦ. Ɇ. Ⱥɭɷɡɨɜɚ»,
ɇɂɂ «ɉɪɨɛɥɟɦ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ ɢ ɜɨɞɧɵɯ ɪɟɫɭɪɫɨɜ», ɝ. ɒɵɦɤɟɧɬ,
Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ
ȼ ɦɢɪɟ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɢɫɥɨɦɨɥɨɱɧɨɝɨ ɢ ɞɟɬɫɤɨɝɨ ɩɢɬɚɧɢɹ, ɚɤɬɢɦɟɥɹ, ɢɦɦɭɧɧɟɥɢ ɢ ɣɨɝɭɪɬɚ,
ɢɫɩɨɥɶɡɭɸɬ ɤɨɪɨɜɶɟ ɦɨɥɨɤɨ. Ʉɨɪɨɜɶɟ ɦɨɥɨɤɨ ɩɨ ɩɪɢɪɨɞɟ ɱɭɠɟɪɨɞɧɨ ɞɥɹ ɪɚɡɜɢɜɚɸɳɟɝɨ ɞɟɬɫɤɨɝɨ
ɨɪɝɚɧɢɡɦɚ. ɗɬɨ ɫɭɪɪɨɝɚɬ ɞɥɹ ɪɟɛɟɧɤɚ. ɋɨɫɬɚɜɧɵɟ ɱɚɫɬɢ ɤɨɪɨɜɶɟɝɨ ɦɨɥɨɤɚ ɝɟɧɟɬɢɱɟɫɤɢ ɞɚɥɟɤɢ ɨɬ
ɦɚɬɟɪɢɧɫɤɨɝɨ ɦɨɥɨɤɚ, ɩɨ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɦ ɫɜɨɣɫɬɜɚɦ ɹɜɥɹɟɬɫɹ ɤɚɡɟɢɧɨɜɵɦ.
ȼ ɤɨɪɨɜɶɟɦ ɦɨɥɨɤɟ ɫɨɞɟɪɠɢɬɫɹ ɚɥɥɟɪɝɟɧ, ɤɨɬɨɪɵɣ ɪɚɡɪɭɲɚɟɬ ɤɥɟɬɤɢ ɩɨɞɠɟɥɭɞɨɱɧɨɣ ɠɟɥɟɡɵ,
ɭɝɥɟɜɨɞɧɨɝɨ ɨɛɦɟɧɚ, ɱɬɨ ɩɪɢɜɨɞɢɬ ɤ ɧɚɪɭɲɟɧɢɸ ɨɛɪɚɡɨɜɚɧɢɹ ɢɧɫɭɥɢɧɚ, ɭ ɨɬɞɟɥɶɧɵɯ ɥɸɞɟɣ ɜɟɞɟɬ
ɤ ɬɹɠɟɥɨɦɭ ɡɚɛɨɥɟɜɚɧɢɸ – ɫɚɯɚɪɧɨɦɭ ɞɢɚɛɟɬɭ. ɉɨ ɞɚɧɧɵɦ ɜɫɟɦɢɪɧɨɝɨ ɨɛɳɟɫɬɜɚ ɡɞɪɚɜɨɨɯɪɚɧɟɧɢɹ
(ȼɈɁ) ɤɚɠɞɵɣ 10 ɫɟɤɭɧɞ ɨɞɢɧ ɱɟɥɨɜɟɤ ɜ ɦɢɪɟ ɭɦɢɪɚɟɬ ɨɬ ɫɚɯɚɪɧɨɝɨ ɞɢɚɛɟɬɚ.
ɍɧɢɤɚɥɶɧɨɫɬɶ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ ɡɚɤɥɸɱɚɟɬɫɹ ɜ ɬɨɦ, ɱɬɨ ɨɧ ɩɨ ɫɜɨɢɦ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɢɦ
ɫɜɨɣɫɬɜɚɦ ɹɜɥɹɟɬɫɹ ɚɥɶɛɭɦɢɧɨɜɵɦ, ɤɚɤ ɦɚɬɟɪɢɧɫɤɨɟ ɦɨɥɨɤɨ ɢ ɨɬɥɢɱɚɟɬɫɹ ɨɬ ɜɫɟɯ ɨɫɬɚɥɶɧɵɯ ɜɢɞɨɜ
ɦɨɥɨɤɚ ɠɢɜɨɬɧɵɯ. Ɉɛɥɚɞɚɟɬ ɫɩɟɰɢɮɢɱɟɫɤɢɦ ɜɤɭɫɨɦ, ɧɚɫɵɳɟɧ ɜɢɬɚɦɢɧɚɦɢ ɢ ɩɨɥɭɧɚɫɵɳɟɧɧɵɦɢ
ɠɢɪɧɵɦɢ ɤɢɫɥɨɬɚɦɢ, ɛɨɝɚɬ ɫɨɫɬɚɜɨɦ, ɧɚɫɵɳɟɧ ɦɢɤɪɨ ɢ ɦɚɤɪɨɷɥɟɦɟɧɬɚɦɢ. ɉɨɥɭɱɟɧɧɵɣ ɢɡ ɧɢɯ
ɲɭɛɚɬ ɨɛɨɝɚɳɟɧ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɦɢ ɫɨɟɞɢɧɟɧɢɹɦɢ, ɹɜɥɹɸɳɢɟɫɹ ɥɟɱɚɳɢɦ ɛɢɨɥɨɝɢɱɟɫɤɢɦ
ɥɟɤɚɪɫɬɜɨɦ ɢ ɟɫɬɟɫɬɜɟɧɧɵɦ ɛɢɨɫɨɜɦɟɫɬɢɦɵɦ ɩɪɨɞɭɤɬɨɦ ɞɥɹ ɱɟɥɨɜɟɱɟɫɤɨɝɨ ɨɪɝɚɧɢɡɦɚ. ȼ ɫɜɹɡɢ ɫ
ɜɨɡɪɚɫɬɚɸɳɟɣ ɩɨɬɪɟɛɧɨɫɬɶɸ ɨɬɟɱɟɫɬɜɟɧɧɨɝɨ ɢ ɦɢɪɨɜɨɝɨ ɪɵɧɤɚ ɜ ɤɢɫɥɨɦɨɥɨɱɧɨɣ ɩɪɨɞɭɤɰɢɢ ɪɚɡɪɚɛɨɬɤɚ ɢ ɪɚɫɲɢɪɟɧɢɟ ɚɫɫɨɪɬɢɦɟɧɬɚ ɤɢɫɥɨɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɰɢɢ ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ ɹɜɥɹɟɬɫɹ
ɚɤɬɭɚɥɶɧɵɦ. Ʉɢɫɥɨɦɨɥɨɱɧɨɣ ɩɪɨɞɭɤɰɢɟɣ ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ ɡɚɢɧɬɟɪɟɫɨɜɚɧɵ ɜɟɞɭɳɢɟ ɤɨɦɩɚɧɢɢ – ɩɪɨɢɡɜɨɞɢɬɟɥɢ ɧɚ ɪɵɧɤɟ ɦɨɥɨɱɧɨɣ ɢɧɞɭɫɬɪɢɢ əɩɨɧɢɢ, ȿɜɪɨɫɨɸɡɚ, ɋɒȺ ɢ Ⱥɜɫɬɪɚɥɢɢ. Ɉ
ɱɟɦ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɪɟɲɟɧɢɟ Ⱦɟɩɚɪɬɚɦɟɧɬɨɦ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɢ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ
ɈɈɇ ɩɨ ɨɛɟɫɩɟɱɟɧɢɸ ɧɚɫɟɥɟɧɢɹ ȿɜɪɨɩɵ, Ⱥɦɟɪɢɤɢ, Ⱥɮɪɢɤɢ ɢ Ⱥɡɢɢ ɤɢɫɥɨɦɨɥɨɱɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ
ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ.[1]
Ɇɟɬɨɞɢɤɚ ɢ ɪɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɹ
ȼ ɰɟɥɹɯ ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɬɟɯɧɨɥɨɝɢɢ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɛɢɨɣɨɝɭɪɬ ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ
ɩɪɨɜɟɞɟɧɧɵɣ ɩɨ ɦɟɬɨɞɢɤɟ ɊɌɋ 166–97 «Ɇɨɥɨɤɨ ɜɟɪɛɥɸɠɶɟ ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɲɭɛɚɬ», ɫ ɪɚɡɥɢɱɧɵɦɢ ɧɚɩɨɥɧɢɬɟɥɹɦɢ ɢɡ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ.
Ɋɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɹ ɨɛɪɚɡɰɨɜ ɛɢɨɣɨɝɭɪɬɨɜ ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ ɢ ɤɨɪɨɜɶɟɝɨ ɦɨɥɨɤɚ ɚɩɪɨɛɢɪɨɜɚɧɵ ɜ ɝ. Ⱥɥɦɚɬɵ ɁȺɈ «Ⱥɤɚɞɟɦɢɹ ɩɢɬɚɧɢɹ» ɊɄ, ɞɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɩɨɥɧɨɝɨ ɛɢɨɯɢɦɢɱɟɫɤɨɝɨ
ɚɧɚɥɢɡɚ, ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ ɢ ɫɨɞɟɪɠɚɧɢɟ ɜɢɬɚɦɢɧɨɜ ɢ ɦɢɤɪɨɷɥɟɦɟɧɬɨɜ [2,3].
ȼ ɪɟɡɭɥɶɬɚɬɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɭɫɬɚɧɨɜɥɟɧɨ: ɉɨ ɩɢɳɟɜɵɦ ɢ ɛɢɨɯɢɦɢɱɟɫɤɢɦ ɩɨɤɚɡɚɬɟɥɹɦ ɛɢɨɣɨɝɭɪɬɚ ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤ ɩɪɟɜɨɫɯɨɞɢɬ ɣɨɝɭɪɬ ɢɡ ɤɨɪɨɜɶɟɝɨ ɦɨɥɨɤɚ ɩɨ ɫɨɞɟɪɠɚɧɢɢ ɛɟɥɤɚ ɧɚ 57 %,
ɠɢɪɚ ɧɚ 52 % ɢ ɷɧɟɪɝɟɬɢɱɟɫɤɨɣ ɤɚɥɨɪɢɢ ɧɚ 27,8 ɤɤɚɥ, ɩɨ ɫɨɞɟɪɠɚɧɢɢ ɜɢɬɚɦɢɧɨɜ ɋ, ɊɊ, ȿ ɢ ɦɢɤɪɨɷɥɟɦɟɧɬɨɜ ɤɚɥɶɰɢɹ, ɦɚɝɧɢɹ, ɠɟɥɟɡɚ ɫɨɨɬɜɟɬɫɬɜɟɧɧɨ ɧɚ 79,7 %, 66,1 %, 51,4 %, 38,7 %, 48,7 %,
28,7 %. ɋ ɞɨɛɚɜɥɟɧɢɟɦ ɰɟɥɟɛɧɵɯ ɧɚɩɨɥɧɢɬɟɥɟɣ ɢɡ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ ɜ ɪɚɡɪɚɛɨɬɚɧɧɵɣ
ɛɢɨɣɨɝɭɪɬ ɢɡ ɜɟɪɛɥɸɠɶɟɝɨ ɦɨɥɨɤɚ ɷɮɮɟɤɬɢɜɧɨ ɭɫɢɥɢɜɚɟɬɫɹ ɢɯ ɥɟɱɟɛɧɨ-ɩɢɳɟɜɵɟ ɰɟɧɧɨɫɬɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
336
http://museum.agropolis.fr
ɉɪɨɬɨɤɨɥ ɢɫɩɵɬɚɧɢɣ ɩɢɬɶɟɜɨɝɨ ɣɨɝɭɪɬɚ. ʋ2–16/281 ɨɬ 10.10.2007ɝ., ɌɈɈ «ɇɭɬɪɢɬɟɫɬ», ɁȺɈ «Ʉɚɡɚɯɫɬɚɧɫɤɚɹ Ⱥɤɚɞɟɦɢɹ ɩɢɬɚɧɢɹ» ɆɁɏ ɊɄ.
3.
ɉɪɨɬɨɤɨɥ ɢɫɩɵɬɚɧɢɣ 4-ɯ ɨɛɪɚɡɰɨɜ ɣɨɝɭɪɬ. ʋ2–16/285 ɨɬ 16.07.2008ɝ., ɌɈɈ «ɇɭɬɪɢɬɟɫɬ», ɁȺɈ «Ʉɚɡɚɯɫɬɚɧɫɤɚɹ Ⱥɤɚɞɟɦɢɹ ɩɢɬɚɧɢɹ» ɆɁɏ ɊɄ.
ɍȾɄ 664.78
ɉɈɌɊȿȻɅȿɇɂȿ ɄɊɍɉəɇɕɏ ɉɊɈȾɍɄɌɈȼ
ɇȺɋȿɅȿɇɂȿɆ ɄȺɁȺɏɋɌȺɇȺ
ɑȺɄȺɇɈȼȺ ɀ.Ɇ., ɒȺɃɆȿɊȾȿɇɈȼȺ Ⱦ.Ⱥ., ȻɈɊɈȼɋɄɂɃ Ⱥ.ɘ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ», Ⱥɫɬɚɧɚ, Ʉɚɡɚɯɫɬɚɧ, e-mail: niizpp_pprs@mail.ru
ɂɡɦɟɧɟɧɢɟ ɭɫɥɨɜɢɣ ɜɟɞɟɧɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ, ɩɨɹɜɥɟɧɢɟ ɧɨɜɵɯ ɢɫɬɨɱɧɢɤɨɜ ɩɢɳɟɜɨɝɨ ɫɵɪɶɹ ɢ ɬɟɯɧɨɥɨɝɢɣ ɟɝɨ ɩɟɪɟɪɚɛɨɬɤɢ ɧɚɪɹɞɭ ɫɨ ɫɥɨɠɧɨɣ ɷɤɨɥɨɝɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɨɣ
ɬɪɟɛɭɟɬ ɪɚɡɪɚɛɨɬɤɢ ɧɚɭɱɧɨ-ɨɛɨɫɧɨɜɚɧɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɢ ɪɟɤɨɦɟɧɞɚɰɢɣ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɪɨɞɭɤɬɨɜ
ɩɢɬɚɧɢɹ, ɫ ɨɛɟɫɩɟɱɟɧɢɟɦ ɢɯ ɤɚɱɟɫɬɜɚ ɢ ɛɟɡɨɩɚɫɧɨɫɬɢ, ɩɨɡɜɨɥɹɸɳɢɯ ɩɪɨɢɡɜɨɞɢɬɟɥɹɦ ɷɤɨɧɨɦɢɱɟɫɤɢ ɜɵɝɨɞɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɢɯ ɜ ɩɪɨɢɡɜɨɞɫɬɜɟ.
ɂɦɟɧɧɨ ɩɨɷɬɨɦɭ ɫɭɳɟɫɬɜɟɧɧɨ ɜɨɡɪɚɫɬɚɟɬ ɡɧɚɱɟɧɢɟ ɤɚɤ ɧɚɭɱɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɜ ɨɛɥɚɫɬɢ ɩɢɬɚɧɢɹ
– ɢɡɭɱɟɧɢɟ ɩɨɬɪɟɛɧɨɫɬɟɣ ɨɪɝɚɧɢɡɦɚ ɱɟɥɨɜɟɤɚ ɜ ɨɫɧɨɜɧɵɯ ɩɢɳɟɜɵɯ ɜɟɳɟɫɬɜɚɯ ɢ ɷɧɟɪɝɢɢ, ɬɚɤ ɢ ɩɪɚɤɬɢɱɟɫɤɢɯ, ɫɜɹɡɚɧɧɵɯ ɫ ɢɡɭɱɟɧɢɟɦ ɩɢɳɟɜɨɝɨ ɩɨɜɟɞɟɧɢɹ ɪɚɡɥɢɱɧɵɯ ɝɪɭɩɩ ɧɚɫɟɥɟɧɢɹ. [1, 2, 3, 4, 5]
Ɋɚɧɟɟ ɭɱɺɧɵɦɢ Ʉɚɡɚɯɫɬɚɧɚ ɩɪɨɜɨɞɢɥɢɫɶ ɢɫɫɥɟɞɨɜɚɧɢɹ ɢ ɛɵɥɢ ɩɨɥɭɱɟɧɵ ɞɚɧɧɵɟ ɨ ɤɪɚɬɧɨɫɬɢ
ɩɨɬɪɟɛɥɟɧɢɹ ɨɬɞɟɥɶɧɵɯ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ, ɩɨɥɭɱɟɧɧɵɟ ɜ ɪɟɡɭɥɶɬɚɬɟ ɢɡɭɱɟɧɢɹ ɩɢɳɟɜɨɝɨ ɩɨɜɟɞɟɧɢɹ ɢ ɩɢɳɟɜɵɯ ɩɪɢɜɵɱɟɤ ɝɨɪɨɞɫɤɨɝɨ ɧɚɫɟɥɟɧɢɹ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ. Ɍɚɤ, Ⱥɯɦɟɬɨɜɵɦ ɋ. ȼ.
ɛɵɥɚ ɨɛɫɥɟɞɨɜɚɧɚ ɫɥɭɱɚɣɧɚɹ, ɫɬɪɚɬɢɮɢɰɢɪɨɜɚɧɧɚɹ ɩɨ ɩɨɥɭ ɢ ɜɨɡɪɚɫɬɭ ɜɵɛɨɪɤɚ ɢɡ ɱɢɫɥɚ ɠɢɬɟɥɟɣ
ɝɨɪɨɞɨɜ Ʉɚɡɚɯɫɬɚɧɚ ɜ ɜɨɡɪɚɫɬɟ 18–73 ɥɟɬ. ɂɫɫɥɟɞɨɜɚɧɢɟ ɜɵɩɨɥɧɹɥɨɫɶ ɩɨ ɫɩɟɰɢɚɥɶɧɨ ɪɚɡɪɚɛɨɬɚɧɧɨɣ ɚɧɤɟɬɟ, ɜɤɥɸɱɚɸɳɟɣ ɞɟɬɚɥɢɡɢɪɨɜɚɧɧɵɟ ɜɨɩɪɨɫɵ ɩɨ ɨɰɟɧɤɟ ɩɢɳɟɜɨɝɨ ɩɨɜɟɞɟɧɢɹ ɢ ɩɪɢɜɵɱɟɤ
ɩɢɬɚɧɢɹ, ɜɨɩɪɨɫɵ ɨ ɫɨɰɢɚɥɶɧɨ-ɷɤɨɧɨɦɢɱɟɫɤɨɦ ɫɬɚɬɭɫɟ ɢ ɯɚɪɚɤɬɟɪɟ ɩɢɬɚɧɢɹ. Ɉɛɳɟɟ ɱɢɫɥɨ ɨɛɫɥɟɞɨɜɚɧɧɵɯ – 8219 ɱɟɥɨɜɟɤ.
ȼ ɪɟɡɭɥɶɬɚɬɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɜɵɹɫɧɢɥɨɫɶ, ɱɬɨ ɤɪɭɩɵ, ɧɟɫɦɨɬɪɹ ɧɚ ɢɯ ɜɵɫɨɤɭɸ ɛɢɨɥɨɝɢɱɟɫɤɭɸ
ɰɟɧɧɨɫɬɶ, ɩɨ ɱɚɫɬɨɬɟ ɩɨɬɪɟɛɥɟɧɢɹ ɩɪɢɪɚɜɧɟɧɵ ɤ ɦɚɤɚɪɨɧɧɵɦ ɢɡɞɟɥɢɹɦ, ɧɟ ɨɛɥɚɞɚɸɳɢɦ ɩɢɬɚɬɟɥɶɧɵɦɢ ɞɨɫɬɨɢɧɫɬɜɚɦɢ ɤɪɭɩ (ɪɢɫ. 1).
Ɋɢɫ. 1. ɑɚɫɬɨɬɚ ɩɨɬɪɟɛɥɟɧɢɹ ɯɥɟɛɨɛɭɥɨɱɧɵɯ, ɦɚɤɚɪɨɧɧɵɯ, ɦɭɱɧɵɯ ɤɨɧɞɢɬɟɪɫɤɢɯ ɢɡɞɟɥɢɣ
ɢ ɤɪɭɩ ɝɨɪɨɞɫɤɢɦ ɧɚɫɟɥɟɧɢɟɦ Ʉɚɡɚɯɫɬɚɧɚ (ɫɪɟɞɧɟɝɨɞɨɜɵɟ ɩɨɤɚɡɚɬɟɥɢ). [6]
Ⱥɧɚɥɢɡ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ Ʉɨɦɢɬɟɬ ɩɨ ɫɬɚɬɢɫɬɢɤɟ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ ɨɫɭɳɟɫɬɜɥɹɟɬ ɚɧɚɥɨɝɢɱɧɭɸ ɪɚɛɨɬɭ ɩɭɬɟɦ ɨɛɫɥɟɞɨɜɚɧɢɹ ɞɨɦɨɯɨɡɹɣɫɬɜ, ɤɨɬɨɪɨɟ ɩɪɨɜɨɞɢɬɫɹ ɟɠɟɤɜɚɪɬɚɥɶɧɨ ɩɨ ɜɫɟɣ ɫɬɪɚɧɟ.
Ɍɚɤ, ɩɨ ɞɚɧɧɵɦ Ʉɨɦɢɬɟɬɚ, ɜ ɫɪɟɞɧɟɦ ɧɚ ɞɭɲɭ ɧɚɫɟɥɟɧɢɹ ɡɚ 9 ɦɟɫɹɰɟɜ 2014 ɝɨɞɚ ɩɨɬɪɟɛɥɟɧɨ ɦɨɥɨɤɚ
ɢ ɦɨɥɨɱɧɵɯ ɩɪɨɞɭɤɬɨɜ 178,5 ɤɝ, ɯɥɟɛɨɩɪɨɞɭɤɬɨɜ ɢ ɤɪɭɩɹɧɵɯ ɢɡɞɟɥɢɣ – 82,2 ɤɝ, ɦɹɫɚ ɢ ɦɹɫɨɩɪɨɞɭɤɬɨɜ – 44,1 ɤɝ, ɹɣɰɚ – 144 ɲɬɭɤɢ.
ɉɨ ɞɚɧɧɵɦ ɜɵɛɨɪɨɱɧɨɝɨ ɨɛɫɥɟɞɨɜɚɧɢɹ ɞɨɦɚɲɧɢɯ ɯɨɡɹɣɫɬɜ ɡɚ 9 ɦɟɫɹɰɟɜ 2014 ɝɨɞɚ ɢɡ ɝɪɭɩɩɵ
«ɯɥɟɛɨɩɪɨɞɭɤɬɵ ɢ ɤɪɭɩɹɧɵɟ ɢɡɞɟɥɢɹ» ɜ ɫɪɟɞɧɟɦ ɧɚ ɞɭɲɭ ɩɨɬɪɟɛɥɟɧɨ ɯɥɟɛɚ ɩɲɟɧɢɱɧɨɝɨ ɢɡ ɦɭɤɢ
ɩɟɪɜɨɝɨ ɫɨɪɬɚ 41,3 ɤɝ, ɦɚɤɚɪɨɧɧɵɯ ɢɡɞɟɥɢɣ – 10,8 ɤɝ, ɦɭɤɢ ɩɲɟɧɢɱɧɨɣ ɜɵɫɲɟɝɨ ɫɨɪɬɚ – 8,2 ɤɝ,
ɪɢɫɚ – 7,9 ɤɝ, ɝɪɟɱɤɢ – 5,2 ɤɝ [7].
337
ɉɨ ɫɬɚɬɢɫɬɢɱɟɫɤɢɦ ɞɚɧɧɵɦ, ɡɚ 2014 ɝɨɞ ɢɡ ɝɪɭɩɩɵ «ɯɥɟɛɨɩɪɨɞɭɤɬɵ ɢ ɤɪɭɩɹɧɵɟ ɢɡɞɟɥɢɹ» ɜ
ɫɪɟɞɧɟɦ ɧɚ ɞɭɲɭ ɧɚɫɟɥɟɧɢɹ ɩɨɬɪɟɛɥɟɧɨ 124,5 ɤɝ [8].
Ɍɚɤ ɠɟ ɢɡɭɱɟɧɢɟɦ ɞɚɧɧɨɝɨ ɜɨɩɪɨɫɚ ɡɚɧɢɦɚɥɨɫɶ ɱɚɫɬɧɨɟ ɚɝɟɧɬɫɬɜɨ GOOD («Brand management/
consultancy agency», ɩɪɟɞɨɫɬɚɜɥɹɸɳɢɟ ɭɫɥɭɝɢ ɜ ɨɛɥɚɫɬɢ ɫɬɪɚɬɟɝɢɱɟɫɤɨɝɨ ɤɨɧɫɚɥɬɢɧɝɚ ɢ ɤɪɟɚɬɢɜɧɨɣ ɨɰɟɧɤɢ, ɪɚɡɪɚɛɨɬɤɢ, ɜɵɜɟɞɟɧɢɢ ɛɪɟɧɞɚ ɧɚ ɪɵɧɨɤ ɢ ɬ.ɞ.). ȼɨɬ ɱɬɨ ɛɵɥɨ ɨɩɭɛɥɢɤɨɜɚɧɨ ɧɚ ɢɯ
ɨɮɢɰɢɚɥɶɧɨɦ ɫɚɣɬɟ ɩɨ ɞɚɧɧɨɣ ɬɟɦɚɬɢɤɟ (ɪɢɫɭɧɨɤ 2):
- Ʉɥɸɱɟɜɚɹ ɤɭɥɶɬɭɪɚ ɩɨɬɪɟɛɥɟɧɢɹ – ɪɢɫ. Ɋɨɫɫɢɹɧɢɧ ɢ ɟɜɪɨɩɟɟɰ ɫɴɟɞɚɸɬ ɩɨ 5 ɤɝ ɪɢɫɚ ɜ ɝɨɞ, ɹɩɨɧɟɰ – 57 ɤɝ, ɤɢɬɚɟɰ – 80 ɤɝ., ɤɚɡɚɯɫɬɚɧɟɰ ɨɤɨɥɨ 7 ɤɝ.
- Ƚɪɟɱɤɚ ɜ ɪɚɰɢɨɧɟ ɤɚɡɚɯɫɬɚɧɰɚ ɡɚɧɢɦɚɟɬ ɨɤɨɥɨ – 2,9 ɤɝ ɜ ɝɨɞ, ɪɨɫɫɢɹɧɢɧɚ 3,5 ɤɝ.
- Ɉɤɨɥɨ 60 % ɜɫɟɯ ɤɪɭɩ ɭɯɨɞɢɬ ɧɚ ɝɚɪɧɢɪɵ ɢ ɜɬɨɪɵɟ ɛɥɸɞɚ, 30 % ɧɚ ɤɚɲɢ, 10 % ɫɭɩɵ ɢ ɩɨɯɥɺɛɤɢ.
- Ɋɨɫɬ ɪɵɧɤɚ ɩɪɨɢɫɯɨɞɢɬ ɡɚ ɫɱɟɬ ɭɜɟɥɢɱɟɧɢɹ ɩɨɬɪɟɛɥɟɧɢɹ ɜɵɫɨɤɨɤɚɱɟɫɬɜɟɧɧɵɯ ɤɪɭɩ, ɯɥɨɩɶɟɜ,
ɝɨɬɨɜɵɯ ɡɟɪɧɨɜɵɯ ɡɚɜɬɪɚɤɨɜ, ɦɸɫɥɢ ɢ ɬ. ɞ. Ⱥ ɬɚɤɠɟ ɡɚ ɫɱɺɬ ɩɟɪɟɯɨɞɚ ɤ ɤɪɭɩɚɦ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ. [9]
Ɋɢɫ. 2. ɋɬɪɭɤɬɭɪɚ ɢ ɱɚɫɬɨɬɚ ɩɨɬɪɟɛɥɟɧɢɹ ɤɪɭɩ ɜ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɭɱɟɧɵɦɢ ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ» ɪɚɡɪɚɛɚɬɵɜɚɸɬɫɹ ɬɟɯɧɨɥɨɝɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɪɭɩ ɛɵɫɬɪɨɝɨ
ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ.
ɇɚ ɩɟɪɜɨɦ ɷɬɚɩɟ ɪɚɛɨɬɵ ɛɵɥ ɩɨɜɟɞɺɧ ɚɧɚɥɢɡ ɨɛɟɫɩɟɱɟɧɢɹ ɨɩɪɟɞɟɥɺɧɧɵɯ ɝɪɭɩɩ ɧɚɫɟɥɟɧɢɹ
Ʉɚɡɚɯɫɬɚɧɚ ɤɪɭɩɹɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ ɩɢɬɚɧɢɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ ɢ ɢɡɭɱɟɧ ɪɚɰɢɨɧ ɩɢɬɚɧɢɹ ɨɫɧɨɜɧɵɯ ɫɥɨɺɜ ɧɚɫɟɥɟɧɢɹ Ɋɟɫɩɭɛɥɢɤɢ.
Ⱦɥɹ ɜɵɩɨɥɧɟɧɢɹ ɩɨɫɬɚɜɥɟɧɧɨɣ ɰɟɥɢ ɩɪɨɜɨɞɢɥɨɫɶ ɚɧɤɟɬɢɪɨɜɚɧɢɟ. Ⱥɧɤɟɬɢɪɨɜɚɧɢɟ ɩɪɨɜɨɞɢɥɨɫɶ ɩɨ ɫɩɟɰɢɚɥɶɧɨ ɪɚɡɪɚɛɨɬɚɧɧɨɣ ɚɧɤɟɬɟ. ȼ ɨɩɪɨɫɟ ɩɪɢɧɹɥɨ ɭɱɚɫɬɢɟ 185 ɱɟɥɨɜɟɤ ɨɬ 15 ɞɨ 63 ɥɟɬ,
ɩɪɨɠɢɜɚɸɳɢɟ ɜ Ⱥɤɦɨɥɢɧɫɤɨɣ, Ⱥɥɦɚɬɢɧɫɤɨɣ, Ʉɚɪɚɝɚɧɞɢɧɫɤɨɣ, Ʉɨɫɬɚɧɚɣɫɤɨɣ ɢ ɞɪɭɝɢɯ ɨɛɥɚɫɬɹɯ
Ʉɚɡɚɯɫɬɚɧɚ.
ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ ɢɫɫɥɟɞɨɜɚɧɢɹ 56 % ɨɩɪɨɲɟɧɧɵɯ ɭɤɚɡɚɥɢ ɧɚ ɬɨ, ɱɬɨ ɢɫɩɨɥɶɡɭɸɬ ɜ ɫɜɨɺɦ ɩɢɬɚɧɢɢ ɤɪɭɩɵ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ. 29 % ɨɩɪɨɲɟɧɧɵɯ ɭɤɚɡɚɥɢ ɧɚ ɧɟɞɨɫɬɚɬɨɤ ɚɫɫɨɪɬɢɦɟɧɬɚ ɤɪɭɩ
ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɜ ɦɟɫɬɚɯ ɢɯ ɪɟɚɥɢɡɚɰɢɢ. 16 % ɨɩɪɨɲɟɧɧɵɯ ɜ ɫɜɨɢɯ ɩɨɠɟɥɚɧɢɹɯ ɭɤɚɡɚɥɢ
ɧɚ ɬɨ, ɱɬɨ ɧɚ ɤɚɡɚɯɫɬɚɧɫɤɨɦ ɪɵɧɤɟ ɧɟɞɨɫɬɚɬɨɱɧɵɣ ɚɫɫɨɪɬɢɦɟɧɬ ɨɬɟɱɟɫɬɜɟɧɧɵɯ ɤɪɭɩ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ, ɚ ɢɦɟɸɳɢɟɫɹ ɚɧɚɥɨɝɢ ɧɟ ɫɨɨɬɜɟɬɫɬɜɭɸɬ ɡɚɩɪɨɫɚɦ ɩɨɬɪɟɛɢɬɟɥɟɣ ɰɟɧɨɜɨɣ ɢɥɢ ɤɚɱɟɫɬɜɟɧɧɨɣ ɫɬɨɪɨɧɨɣ.
Ɉɩɢɪɚɹɫɶ ɧɚ ɪɟɡɭɥɶɬɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɹ ɢ ɧɚ ɬɨ, ɱɬɨ ɫ ɪɨɫɬɨɦ ɮɢɧɚɧɫɨɜɨɝɨ ɫɨɫɬɨɹɧɢɹ ɧɚɫɟɥɟɧɢɹ
ɪɚɫɬɺɬ ɫɩɪɨɫ ɢ ɧɚ ɩɪɨɞɭɤɬɵ ɩɢɬɚɧɢɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ, ɦɨɠɧɨ ɫɞɟɥɚɬɶ ɜɵɜɨɞɵ, ɱɬɨ
ɪɚɡɪɚɛɚɬɵɜɚɟɦɵɟ ɬɟɯɧɨɥɨɝɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɪɭɩ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ
ɰɟɧɧɨɫɬɢ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ ɩɨɡɜɨɥɢɬ ɩɨɜɵɫɢɬɶ ɫɬɟɩɟɧɶ ɢ ɝɥɭɛɢɧɭ ɩɟɪɟɪɚɛɨɬɤɢ
ɡɟɪɧɨɜɨɝɨ ɫɵɪɶɹ, ɤɨɦɩɥɟɤɫɧɨɟ ɟɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ, ɛɨɥɟɟ ɩɨɥɧɨɟ ɢɡɜɥɟɱɟɧɢɟ ɢɡ ɧɟɝɨ ɰɟɧɧɵɯ ɤɨɦɩɨɧɟɧɬɨɜ, ɪɚɫɲɢɪɢɬɶ ɚɫɫɨɪɬɢɦɟɧɬ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɧɚ ɨɫɧɨɜɟ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ, ɚ ɬɚɤɠɟ ɪɟɲɢɬɶ
ɩɪɨɛɥɟɦɭ ɞɟɮɢɰɢɬɚ ɦɢɤɪɨɧɭɬɪɢɟɧɬɚɦɢ ɜ ɩɢɬɚɧɢɢ ɧɚɫɟɥɟɧɢɹ Ʉɚɡɚɯɫɬɚɧɚ.
338
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
8.
9.
ɒɚɪɦɚɧɨɜ Ɍ.ɒ., ɐɨɣ ɂ.Ƚ. ɇɚɭɱɧɵɟ ɨɫɧɨɜɵ ɧɚɰɢɨɧɚɥɶɧɨɣ ɩɨɥɢɬɢɤɢ ɡɞɨɪɨɜɨɝɨ ɩɢɬɚɧɢɹ Ɋɟɫɩɭɛɥɢɤɢ
Ʉɚɡɚɯɫɬɚɧ //Ɂɞɨɪɨɜɶɟ ɢ ɛɨɥɟɡɧɶ.-2007.- ʋ4 (60).- ɋ.9–11.
Tell L., Dalenov E., Lyssenkov S. Nutrition and Health //Ɂɞɨɪɨɜɶɟ ɢ ɛɨɥɟɡɧɶ.-2007.- ʋ4 (60).- ɋ.86–93.
ɉɨɬɟɦɤɢɧɚ Ɋ.Ⱥ., Ƚɥɚɡɭɧɨɜ ɂ.ɋ. Ɋɚɡɪɚɛɨɬɤɚ ɫɢɫɬɟɦɵ ɦɨɧɢɬɨɪɢɪɨɜɚɧɢɹ ɩɨɜɟɞɟɧɱɟɫɤɢɯ ɮɚɤɬɨɪɨɜ ɪɢɫɤɚ ɧɟɢɧɮɟɤɰɢɨɧɧɵɯ ɡɚɛɨɥɟɜɚɧɢɣ // ɉɪɨɮɢɥɚɤɬɢɤɚ ɡɚɛɨɥɟɜɚɧɢɣ ɢ ɭɤɪɟɩɥɟɧɢɟ ɡɞɨɪɨɜɶɹ.- 2007.-ʋ2.ɋ. 7–12.
Ʉɚɦɚɪɞɢɧɚ Ɍ.ȼ., Ɇ.ȼ. ɉɨɩɨɜɢɱ, Ⱥ.Ɇ. ɋɚɮɪɨɧɨɜɚ ɢ ɞɪ. – Ɋɭɤɨɜɨɞɫɬɜɨ ɩɨ ɨɰɟɧɤɟ ɮɚɤɬɢɱɟɫɤɨɝɨ ɩɢɬɚɧɢɹ
ɢ ɩɢɳɟɜɵɯ ɩɪɢɜɵɱɟɤ ɧɚɫɟɥɟɧɢɹ: Ɇ.,2002.- 48 ɫ.
ɉɨɥɟɫɫɤɢɣ ȼ.Ⱥ., Ʉɪɚɫɢɥɶɳɢɤɨɜ Ɇ.ɂ. Ƚɢɝɢɟɧɢɱɟɫɤɨɟ ɨɛɭɱɟɧɢɟ ɢ ɜɨɫɩɢɬɚɧɢɟ – ɢɧɫɬɪɭɦɟɧɬ ɪɟɚɥɢɡɚɰɢɢ
ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɣ ɩɨɥɢɬɢɤɢ ɜ ɨɛɥɚɫɬɢ ɡɞɨɪɨɜɨɝɨ ɩɢɬɚɧɢɹ //ȼɨɩɪɨɫɵ ɩɢɬɚɧɢɹ.-2008.- ʋ5.-ɋ. 49–53.
Ⱥɯɦɟɬɨɜ ɋ.ȼ. «ɑɚɫɬɨɬɚ ɩɨɬɪɟɛɥɟɧɢɹ ɨɬɞɟɥɶɧɵɯ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɝɨɪɨɞɫɤɢɦ ɧɚɫɟɥɟɧɢɟɦ Ʉɚɡɚɯɫɬɚɧɚ»
www.soltustik.stat.kz
www.stat.gov.kz
www.good.kz
ɍȾɄ 631.576.331.2.664.723:635.65
ɈȻȿɋɉȿɑȿɇɂȿ ɋɈɏɊȺɇɇɈɋɌɂ ɁȿɊɇɈȻɈȻɈȼɕɏ
ɂ ɆȺɋɅɂɑɇɕɏ ɄɍɅɖɌɍɊ ɇȺ ɈɋɇɈȼȿ
ɋɈȼȿɊɒȿɇɋɌȼɈȼȺɇɂə ɌȿɏɇɈɅɈȽɂɂ
ɉɈɋɅȿɍȻɈɊɈɑɇɈɃ ɈȻɊȺȻɈɌɄɂ ɂ ɏɊȺɇȿɇɂə
ɒȺɃɆȿɊȾȿɇɈȼȺ ɉ.Ɋ., ɑȺɄȺɇɈȼȺ ɀ.Ɇ., ȺȻȾɊȺɏɆȺɇɈȼ ɏ.Ⱥ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ», Ⱥɫɬɚɧɚ, Ʉɚɡɚɯɫɬɚɧ, e-mail: niizpp_pprs@mail.ru
Ⱦɨ ɧɟɞɚɜɧɟɝɨ ɜɪɟɦɟɧɢ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɚɹ ɛɟɡɨɩɚɫɧɨɫɬɶ Ʉɚɡɚɯɫɬɚɧɚ ɜ ɨɫɧɨɜɧɨɦ ɨɛɟɫɩɟɱɢɜɚɥɚɫɶ
«ɡɟɪɧɨɜɨɣ ɫɨɫɬɚɜɥɹɸɳɟɣ». Ɉɞɧɚɤɨ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɛɥɚɝɨɞɚɪɹ ɞɢɧɚɦɢɱɧɨɦɭ ɪɚɡɜɢɬɢɸ ɷɤɨɧɨɦɢɤɢ Ʉɚɡɚɯɫɬɚɧɚ ɢ ɪɚɫɬɭɳɟɦɭ ɦɢɪɨɜɨɦɭ ɫɩɪɨɫɭ ɧɚ ɦɚɫɥɢɱɧɵɟ ɢ ɡɟɪɧɨɛɨɛɨɜɵɟ ɤɭɥɶɬɭɪɵ ɢ ɩɪɨɞɭɤɬɵ
ɢɯ ɩɟɪɟɪɚɛɨɬɤɢ ɧɚɡɪɟɥɚ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɨɛɟɫɩɟɱɟɧɢɹ ɫɬɪɚɧɵ ɩɪɨɞɭɤɰɢɟɣ ɩɨɥɭɱɟɧɧɨɣ ɢɡ ɷɬɨɝɨ ɫɵɪɶɹ. Ɂɚ ɩɨɫɥɟɞɧɢɟ ɩɹɬɶ ɥɟɬ Ʉɚɡɚɯɫɬɚɧ ɭɤɪɟɩɢɥ ɫɜɨɢ ɩɨɡɢɰɢɢ ɩɪɨɢɡɜɨɞɢɬɟɥɹ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ. ȼ ɫɜɹɡɢ ɫ ɱɟɦ, ɧɚɛɥɸɞɚɟɬɫɹ ɟɠɟɝɨɞɧɚɹ ɬɟɧɞɟɧɰɢɹ ɪɨɫɬɚ ɩɨɫɟɜɧɨɣ ɩɥɨɳɚɞɢ ɞɚɧɧɵɯ
ɤɭɥɶɬɭɪ. Ɍɚɤ, ɜɢɰɟ-ɦɢɧɢɫɬɪ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ ɋɚɩɚɪɯɚɧ Ɉɦɚɪɨɜ ɨɬɦɟɬɢɥ, ɱɬɨ ɜ ɷɬɨɦ ɝɨɞɭ ɩɨɫɟɜɵ
ɩɲɟɧɢɰɵ ɭɦɟɧɶɲɚɬɫɹ ɧɚ 235 ɬɵɫɹɱ ɝɟɤɬɚɪɨɜ ɢɥɢ ɧɚ 2 %, ɪɢɫɚ – ɧɚ 8,5 ɬɵɫɹɱɢ ɝɟɤɬɚɪɨɜ ɢɥɢ ɧɚ 9 %.
ȼ ɬɨ ɠɟ ɜɪɟɦɹ ɩɥɨɳɚɞɢ ɡɟɪɧɨɮɭɪɚɠɧɵɯ, ɛɨɛɨɜɵɯ, ɦɚɫɥɢɱɧɵɯ ɢ ɤɪɭɩɹɧɵɯ ɤɭɥɶɬɭɪ ɜɨɡɪɚɫɬɭɬ ɧɚ
104 ɬɵɫɹɱɢ ɝɟɤɬɚɪ ɢɥɢ ɧɚ 4 %. ɍɜɟɥɢɱɟɧɢɟ ɪɨɫɬɚ ɩɨɫɟɜɧɵɯ ɩɥɨɳɚɞɟɣ ɩɨɬɪɟɛɭɟɬ ɫɨɨɬɜɟɬɫɬɜɭɸɳɟɣ
ɦɨɞɟɪɧɢɡɚɰɢɢ ɢ ɪɟɤɨɧɫɬɪɭɤɰɢɢ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɦɨɳɧɨɫɬɟɣ ɢ ɬɟɯɧɢɱɟɫɤɨɣ ɛɚɡɵ ɞɥɹ ɨɛɟɫɩɟɱɟɧɢɹ ɫɨɯɪɚɧɧɨɫɬɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɢ ɦɚɫɥɢɱɧɵɯ ɤɭɥɶɬɭɪ, ɪɚɡɪɚɛɨɬɤɢ ɧɨɜɵɯ ɢ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ
ɞɟɣɫɬɜɭɸɳɢɯ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ ɯɪɚɧɟɧɢɹ.
Ⱦɥɹ Ʉɚɡɚɯɫɬɚɧɚ ɨɞɧɨɣ ɢɡ ɩɪɢɱɢɧ ɫɥɨɠɧɨɫɬɢ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ ɯɪɚɧɟɧɢɹ ɦɚɫɥɢɱɧɵɯ
ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ ɹɜɥɹɟɬɫɹ ɭɡɤɨɩɪɨɮɢɥɶɧɨɫɬɶ ɞɟɣɫɬɜɭɸɳɢɯ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɡɚɝɨɬɨɜɢɬɟɥɶɧɵɯ ɩɪɟɞɩɪɢɹɬɢɣ. ɗɥɟɜɚɬɨɪɵ ɢ ɏɉɉ ɫɟɜɟɪɧɵɯ ɪɟɝɢɨɧɨɜ ɪɟɫɩɭɛɥɢɤɢ ɨɪɢɟɧɬɢɪɨɜɚɧɵ, ɜ ɨɫɧɨɜɧɨɦ, ɧɚ ɩɪɢɟɦɤɭ, ɨɛɪɚɛɨɬɤɭ ɢ ɯɪɚɧɟɧɢɟ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ. Ⱦɥɹ ɷɬɨɝɨ ɢɦɟɟɬɫɹ ɨɩɪɟɞɟɥɟɧɧɚɹ ɬɟɯɧɢɱɟɫɤɚɹ ɛɚɡɚ, ɩɟɪɟɱɟɧɶ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɢ ɧɨɪɦɚɬɢɜɧɵɯ ɬɪɟɛɨɜɚɧɢɣ, ɨɩɪɟɞɟɥɟɧɚ ɫɢɫɬɟɦɚ ɤɨɧɬɪɨɥɹ
ɢ ɩɪɨɜɟɞɟɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ, ɩɪɨɜɨɞɢɬɫɹ ɩɨɞɝɨɬɨɜɤɚ ɢ ɤɨɦɩɥɟɤɬɚɰɢɹ ɩɪɟɞɩɪɢɹɬɢɣ
ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɦɢ ɤɚɞɪɚɦɢ.
Ɂɚɝɨɬɨɜɤɚ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ ɬɪɟɛɭɟɬ ɡɧɚɱɢɬɟɥɶɧɵɯ ɢɡɦɟɧɟɧɢɣ ɤɚɤ ɬɟɯɧɢɱɟɫɤɨɝɨ, ɬɚɤ ɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɯɚɪɚɤɬɟɪɚ. ɇɟɨɛɯɨɞɢɦɨ ɨɬɦɟɬɢɬɶ, ɱɬɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɬɪɟɛɨɜɚɧɢɹ
ɩɨ ɡɚɝɨɬɨɜɤɟ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ, ɤɨɬɨɪɵɦɢ ɪɭɤɨɜɨɞɫɬɜɭɸɬɫɹ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ
ɩɪɟɞɩɪɢɹɬɢɹ, ɧɟ ɜ ɩɨɥɧɨɣ ɦɟɪɟ ɨɛɟɫɩɟɱɢɜɚɸɬ ɭɪɨɜɟɧɶ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɢ ɷɤɫɩɨɪɬɧɨɝɨ ɩɨɬɟɧɰɢɚɥɚ ɫɬɪɚɧɵ.
ɇɟ ɜɵɡɵɜɚɟɬ ɫɨɦɧɟɧɢɹ, ɱɬɨ ɨɰɟɧɤɚ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɢ ɩɢɳɟɜɵɯ ɞɨɫɬɨɢɧɫɬɜ ɡɟɪɧɨɛɨɛɨɜɵɯ
ɤɭɥɶɬɭɪ, ɚ ɬɚɤɠɟ ɨɛɟɫɩɟɱɟɧɢɟ ɛɟɡɨɩɚɫɧɨɫɬɢ ɩɪɨɞɭɤɰɢɢ, ɫɨɯɪɚɧɧɨɫɬɢ ɩɪɢ ɞɥɢɬɟɥɶɧɨɦ ɯɪɚɧɟɧɢɢ
ɧɚɩɪɹɦɭɸ ɡɚɜɢɫɢɬ ɨɬ ɤɚɱɟɫɬɜɚ ɩɪɨɜɟɞɟɧɢɹ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ – ɨɱɢɫɬɤɢ ɢ ɫɭɲɤɢ. ɇɨ ɜ
ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɢɦɟɸɳɟɟɫɹ ɨɛɨɪɭɞɨɜɚɧɢɟ ɧɟ ɜ ɩɨɥɧɨɣ ɦɟɪɟ ɨɛɟɫɩɟɱɢɜɚɟɬ ɪɟɲɟɧɢɟ ɜɨɩɪɨɫɨɜ ɜɵɫɨɤɨɷɮɮɟɤɬɢɜɧɨɣ ɩɨɞɝɨɬɨɜɤɢ ɫɵɪɶɹ ɞɥɹ ɛɟɡɨɩɚɫɧɨɝɨ ɢ ɞɥɢɬɟɥɶɧɨɝɨ ɯɪɚɧɟɧɢɹ. ɂ ɜ ɫɜɹɡɢ ɫ ɷɬɢɦ ɩɟ339
ɪɟɞ ɩɪɟɞɩɪɢɹɬɢɹɦɢ ɩɨ ɡɚɝɨɬɨɜɤɟ ɢ ɩɟɪɜɢɱɧɨɣ ɨɛɪɚɛɨɬɤɟ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ ɨɫɬɪɨ
ɜɫɬɚɟɬ ɜɨɩɪɨɫ ɩɪɢɦɟɧɟɧɢɹ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɧɨɜɵɯ ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ
ɨɛɨɪɭɞɨɜɚɧɢɹ ɧɨɜɨɝɨ ɩɨɤɨɥɟɧɢɹ. Ɉɫɨɛɟɧɧɨ ɷɬɨ ɨɬɧɨɫɢɬɫɹ ɤ ɫɟɜɟɪɧɨɦɭ ɪɟɝɢɨɧɭ Ʉɚɡɚɯɫɬɚɧɚ, ɝɞɟ
ɨɠɢɞɚɟɬɫɹ ɡɧɚɱɢɬɟɥɶɧɨɟ ɪɚɫɲɢɪɟɧɢɟ ɩɨɫɟɜɨɜ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ, ɩɪɢɫɭɳ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɣ, ɪɟɡɤɨ-ɤɨɧɬɢɧɟɧɬɚɥɶɧɵɣ ɤɥɢɦɚɬ, ɭɫɥɨɠɧɹɸɳɢɣ ɡɚɞɚɱɭ ɩɨ ɨɛɟɫɩɟɱɟɧɢɸ ɷɮɮɟɤɬɢɜɧɨɣ
ɨɛɪɚɛɨɬɤɢ ɢ ɫɨɯɪɚɧɧɨɫɬɢ ɫɨɛɪɚɧɧɨɝɨ ɭɪɨɠɚɹ.
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ, ɨɞɧɨɣ ɢɡ ɚɤɬɭɚɥɶɧɵɯ ɩɪɨɛɥɟɦ ɧɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɹɜɥɹɟɬɫɹ ɧɟɨɛɯɨɞɢɦɨɫɬɶ
ɢɫɫɥɟɞɨɜɚɧɢɣ ɜ ɨɛɥɚɫɬɢ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ ɩɨɞɝɨɬɨɜɤɢ ɤ ɞɥɢɬɟɥɶɧɨɦɭ ɯɪɚɧɟɧɢɸ, ɪɚɡɪɚɛɨɬɤɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɨɩɟɪɚɰɢɣ ɫ ɭɱɟɬɨɦ ɩɪɨɜɟɞɟɧɢɹ ɩɟɪɜɢɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨ ɭ ɫɟɥɶɯɨɡɬɨɜɚɪɨɩɪɨɢɡɜɨɞɢɬɟɥɹ (ɋɏɌɉ), ɦɨɞɟɪɧɢɡɚɰɢɢ ɞɟɣɫɬɜɭɸɳɟɝɨ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɧɨɜɨɝɨ
ɨɛɨɪɭɞɨɜɚɧɢɹ, ɩɨɡɜɨɥɹɸɳɢɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢ ɝɪɚɦɨɬɧɨ ɢ ɦɚɤɫɢɦɚɥɶɧɨ ɷɮɮɟɤɬɢɜɧɨ ɨɛɟɫɩɟɱɢɜɚɬɶ
ɫɨɯɪɚɧɧɨɫɬɶ ɤɚɱɟɫɬɜɚ ɜ ɩɟɪɢɨɞ ɨɬ ɡɚɝɨɬɨɜɤɢ ɞɨ ɨɬɝɪɭɡɤɢ ɧɚ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɟ ɩɪɟɞɩɪɢɹɬɢɹ.
ɇɚɱɢɧɚɹ ɫ 2015 ɝɨɞɚ ɥɚɛɨɪɚɬɨɪɢɟɣ ɩɟɪɜɢɱɧɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɫɵɪɶɹ ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ
ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ» ɧɚɱɚɬɵ ɬɪɟɯɥɟɬɧɢɟ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɟ ɪɚɛɨɬɵ 212 ɩɪɨɝɪɚɦɦɵ ɩɨ ɬɟɦɟ «Ɉɛɟɫɩɟɱɟɧɢɟ ɫɨɯɪɚɧɧɨɫɬɢ
ɡɟɪɧɨɛɨɛɨɜɵɯ ɢ ɦɚɫɥɢɱɧɵɯ ɤɭɥɶɬɭɪ ɧɚ ɨɫɧɨɜɟ ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɬɟɯɧɨɥɨɝɢɢ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ
ɨɛɪɚɛɨɬɤɢ ɢ ɯɪɚɧɟɧɢɹ».
Ɉɫɧɨɜɧɨɣ ɰɟɥɶɸ ɪɚɛɨɬɵ ɹɜɥɹɟɬɫɹ ɪɚɡɪɚɛɨɬɤɚ ɧɚɭɱɧɨ-ɨɛɨɫɧɨɜɚɧɧɵɯ ɪɟɤɨɦɟɧɞɚɰɢɣ ɢ ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɨ ɨɛɟɫɩɟɱɟɧɢɸ ɫɨɯɪɚɧɧɨɫɬɢ ɢ ɤɚɱɟɫɬɜɟɧɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɡɟɪɧɨɛɨɛɨɜɵɯ
(ɝɨɪɨɯ, ɧɭɬ) ɢ ɦɚɫɥɢɱɧɵɯ (ɥɟɧ, ɪɚɩɫ) ɤɭɥɶɬɭɪ ɫ ɪɚɡɪɚɛɨɬɤɨɣ ɢ ɜɧɟɞɪɟɧɢɟɦ ɧɨɜɵɯ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɥɢɧɢɣ, ɦɨɞɟɪɧɢɡɚɰɢɟɣ ɩɪɢɦɟɧɹɟɦɨɝɨ ɨɱɢɫɬɢɬɟɥɶɧɨ-ɫɭɲɢɥɶɧɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɨɪɭɞɨɜɚɧɢɹ ɧɚ ɩɪɟɞɩɪɢɹɬɢɹɯ ɩɨ ɡɚɝɨɬɨɜɤɟ ɢ ɯɪɚɧɟɧɢɸ ɫɵɪɶɹ, ɪɚɡɪɚɛɨɬɤɨɣ ɨɱɢɫɬɢɬɟɥɶɧɨ-ɫɭɲɢɥɶɧɵɯ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɥɢɧɢɣ ɦɚɥɨɣ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɞɥɹ ɭɱɚɫɬɤɨɜ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ
ɨɛɪɚɛɨɬɤɢ ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨ ɭ ɋɏɌɉ.
ɉɪɢ ɪɚɡɪɚɛɨɬɤɟ ɛɭɞɟɬ ɩɪɨɜɟɞɟɧ ɪɚɫɲɢɪɟɧɧɵɣ ɚɧɚɥɢɡ ɬɟɯɧɨɥɨɝɢɢ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ
ɯɪɚɧɟɧɢɹ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ ɧɚ ɩɪɟɞɩɪɢɹɬɢɹɯ ɩɨ ɡɚɝɨɬɨɜɤɟ ɢ ɯɪɚɧɟɧɢɸ – ɷɥɟɜɚɬɨɪɵ, ɏɉɉ ɢ ɧɟɩɨɫɪɟɞɫɬɜɟɧɧɨ ɭ ɋɏɌɉ, ɨɩɪɟɞɟɥɟɧɵ ɧɚɢɛɨɥɟɟ ɩɪɨɛɥɟɦɧɵɟ ɜɨɩɪɨɫɵ ɜ ɬɟɯɧɨɥɨɝɢɢ
ɡɚɝɨɬɨɜɤɢ ɢ ɨɛɟɫɩɟɱɟɧɢɹ ɛɟɡɨɩɚɫɧɨɫɬɢ ɯɪɚɧɟɧɢɹ ɢ ɜɨɡɦɨɠɧɨɫɬɢ ɩɨ ɪɟɲɟɧɢɸ ɢɯ, ɫɨɡɞɚɧɢɹ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɧɨɜɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ ɯɪɚɧɟɧɢɹ, ɛɭɞɟɬ ɨɩɪɟɞɟɥɟɧɨ ɜɥɢɹɧɢɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɢ ɪɟɠɢɦɨɜ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ ɯɪɚɧɟɧɢɹ ɧɚ ɫɩɟɰɢɮɢɱɟɫɤɢɟ ɮɢɡɢɤɨɦɟɯɚɧɢɱɟɫɤɢɟ, ɛɢɨɥɨɝɢɱɟɫɤɢɟ ɫɜɨɣɫɬɜɚ ɢ ɯɢɦɢɱɟɫɤɢɣ ɫɨɫɬɚɜ ɡɟɪɧɨɛɨɛɨɜɵɯ ɢ ɦɚɫɥɢɱɧɵɯ ɤɭɥɶɬɭɪ.
Ȼɭɞɭɬ ɪɚɡɪɚɛɨɬɚɧɵ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɥɢɧɢɢ ɞɥɹ ɫɩɟɰɢɚɥɢɡɢɪɨɜɚɧɧɵɯ ɩɪɟɞɩɪɢɹɬɢɣ ɢ ɞɥɹ ɭɱɚɫɬɤɨɜ
ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɋɏɌɉ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɫɨɜɪɟɦɟɧɧɵɯ ɦɟɬɨɞɨɜ ɨɱɢɫɬɤɢ ɢ ɫɭɲɤɢ.
ɉɨɥɭɱɟɧɧɵɟ ɧɚɭɱɧɵɟ ɪɟɡɭɥɶɬɚɬɵ – ɬɟɯɧɨɥɨɝɢɢ ɢ ɦɟɬɨɞɵ ɩɨɫɥɟɭɛɨɪɨɱɧɨɣ ɨɛɪɚɛɨɬɤɢ ɢ ɯɪɚɧɟɧɢɹ ɦɚɫɥɢɱɧɵɯ ɢ ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɭɥɶɬɭɪ ɩɨɡɜɨɥɹɬ ɨɛɟɫɩɟɱɢɬɶ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɟ ɩɪɟɞɩɪɢɹɬɢɹ ɢ
ɧɚɫɟɥɟɧɢɟ ɫɬɪɚɧɵ ɜɵɫɨɤɨɤɚɱɟɫɬɜɟɧɧɵɦ ɛɟɥɤɨɜɵɦ ɢ ɦɚɫɥɢɱɧɵɦ ɫɵɪɶɟɦ, ɪɟɲɚɬ ɩɪɨɛɥɟɦɭ ɢɦɩɨɪɬɨɡɚɦɟɳɟɧɢɹ ɞɚɧɧɨɣ ɩɪɨɞɭɤɰɢɢ. ɉɪɨɟɤɬ ɫɨɡɞɚɫɬ ɜɨɡɦɨɠɧɨɫɬɢ ɞɥɹ ɩɨɜɵɲɟɧɢɹ ɷɤɫɩɨɪɬɧɨɝɨ ɩɨɬɟɧɰɢɚɥɚ ɪɟɫɩɭɛɥɢɤɢ, ɚ ɬɚɤɠɟ ɛɭɞɟɬ ɫɩɨɫɨɛɫɬɜɨɜɚɬɶ ɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɨɦɭ ɢɫɩɨɥɶɡɨɜɚɧɢɸ ɢ ɭɜɟɥɢɱɟɧɢɸ
ɩɪɢɪɨɞɧɵɯ ɪɟɫɭɪɫɨɜ, ɫɨɡɞɚɫɬ ɭɫɥɨɜɢɹ ɞɥɹ ɷɮɮɟɤɬɢɜɧɨɣ ɢɧɬɟɝɪɚɰɢɢ ɧɚɭɤɢ ɢ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ,
ɨɛɟɫɩɟɱɢɬ ɮɨɪɦɢɪɨɜɚɧɢɟ ɨɫɧɨɜ ɩɨɜɵɲɟɧɢɹ ɤɨɧɤɭɪɟɧɬɨɫɩɨɫɨɛɧɨɫɬɢ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɜ
ɭɫɥɨɜɢɹɯ ɪɵɧɤɚ.
ɍȾɄ 664.76:661/636
ɋɈɋɌɈəɇɂȿ ɉȿɊȿɊȺȻȺɌɕȼȺɘɓȿȽɈ ɋȿɄɌɈɊȺ
ɋȿɅɖɋɄɈȽɈ ɏɈɁəɃɋɌȼȺ ɄȺɁȺɏɋɌȺɇȺ:
ɉɊɈȻɅȿɆɕ ɂ ɉɍɌɂ Ɋȿɒȿɇɂə
ɒȺɃɆȿɊȾȿɇɈȼȺ Ⱦ.Ⱥ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ», ɝ.Ⱥɫɬɚɧɚ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, darigash@mailru
ɋȺɊȻȺɋɈȼȺ Ƚ.Ɍ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ», ɝ. Ⱥɫɬɚɧɚ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, sargt@mailru
ɉɟɪɟɪɚɛɨɬɤɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ, ɚ ɬɚɤɠɟ ɩɪɨɢɡɜɨɞɫɬɜɨ ɤɚɱɟɫɬɜɟɧɧɵɯ, ɞɨɫɬɭɩɧɵɯ ɢ
ɤɨɧɤɭɪɟɧɬɨɫɩɨɫɨɛɧɵɯ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɧɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɹɜɥɹɸɬɫɹ ɨɞɧɢɦɢ ɢɡ ɩɪɢɨɪɢɬɟɬ340
ɧɵɯ ɡɚɞɚɱ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ Ʉɚɡɚɯɫɬɚɧɚ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɯ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɭɸ ɛɟɡɨɩɚɫɧɨɫɬɶ ɫɬɪɚɧɵ.
ɉɨ ɞɚɧɧɵɦ ɷɤɫɩɟɪɬɨɜ, ɞɥɹ ɩɨɥɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɫɬɪɚɧɵ ɧɟɨɛɯɨɞɢɦɨ ɢɦɟɬɶ ɩɨɤɚɡɚɬɟɥɢ ɧɚ ɭɪɨɜɧɟ ɩɪɢɧɹɬɵɯ ɧɨɪɦɚɬɢɜɨɜ ɩɨ ɪɹɞɭ ɢɧɞɢɤɚɬɨɪɨɜ, ɨɫɧɨɜɧɵɦ ɢɡ
ɤɨɬɨɪɵɯ ɹɜɥɹɟɬɫɹ ɨɛɴɟɦ ɩɟɪɟɯɨɞɹɳɢɯ ɡɚɩɚɫɨɜ ɡɟɪɧɚ, ɨɫɬɚɸɳɢɯɫɹ ɧɚ ɯɪɚɧɟɧɢɟ ɞɨ ɭɛɨɪɤɢ ɫɥɟɞɭɸɳɟɝɨ ɭɪɨɠɚɹ. ȼ ɦɢɪɟ ɩɨɪɨɝɨɜɵɦ ɡɧɚɱɟɧɢɟɦ ɩɟɪɟɯɨɞɹɳɢɯ ɡɚɩɚɫɨɜ ɫɱɢɬɚɟɬɫɹ ɡɚɩɚɫ, ɪɚɜɧɵɣ 60 ɞɧɹɦ
ɢɥɢ 17 % ɝɨɞɨɜɨɝɨ ɦɢɪɨɜɨɝɨ ɩɨɬɪɟɛɥɟɧɢɹ, ɜ ɬɨ ɜɪɟɦɹ ɤɚɤ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɭɪɨɜɟɧɶ ɡɚɩɚɫɚ ɩɟɪɟɫɦɨɬɪɟɧ ɜ ɫɬɨɪɨɧɭ ɭɜɟɥɢɱɟɧɢɹ ɢ ɩɪɢɧɹɬ ɧɚ ɭɪɨɜɧɟ ɧɟ ɦɟɧɟɟ 25 % ɝɨɞɨɜɨɝɨ ɩɨɬɪɟɛɥɟɧɢɹ ɢɥɢ ɪɚɜɟɧ 90
ɞɧɹɦ.
ɋɥɟɞɭɸɳɢɦ ɧɟ ɦɟɧɟɟ ɜɚɠɧɵɦ ɢɧɞɢɤɚɬɨɪɨɦ ɹɜɥɹɟɬɫɹ ɩɪɨɢɡɜɨɞɫɬɜɨ ɡɟɪɧɚ ɜ ɪɚɫɱɟɬɟ ɧɚ ɞɭɲɭ ɧɚɫɟɥɟɧɢɹ, ɩɪɢɧɹɬɨɟ ɜ ɦɢɪɟ ɜ ɩɪɟɞɟɥɚɯ ɧɟ ɦɟɧɟɟ 1 ɬɨɧɧɵ ɡɟɪɧɚ, ɬɨɝɞɚ ɤɚɤ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɨɧ ɪɚɜɟɧ 1,617
ɬɨɧɧɚɦ. Ɍɨ ɟɫɬɶ, ɜ ɜɨɩɪɨɫɚɯ ɨɛɟɫɩɟɱɟɧɢɹ ɫɬɪɚɧɵ ɡɟɪɧɨɦ Ʉɚɡɚɯɫɬɚɧ ɧɟ ɢɫɩɵɬɵɜɚɟɬ ɩɪɨɛɥɟɦ.
Ɉɞɧɚɤɨ, ɩɨ ɬɚɤɨɦɭ ɢɧɞɢɤɚɬɨɪɭ, ɤɚɤ ɢɦɩɨɪɬ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɵɯ ɩɪɨɞɭɤɬɨɜ, ɤɨɬɨɪɵɣ ɞɨɥɠɟɧ ɫɨɫɬɚɜɥɹɬɶ ɧɟ ɛɨɥɟɟ 20 %, Ʉɚɡɚɯɫɬɚɧ ɢɦɟɟɬ ɩɨɤɚɡɚɬɟɥɶ – 33 %, ɱɬɨ ɩɨɞɬɜɟɪɠɞɚɸɬ ɞɚɧɧɵɟ ɚɧɚɥɢɬɢɤɨɜ
– ɢɦɩɨɪɬ ɜɫɟɯ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɜ ɫɬɪɚɧɭ ɜ 2014 ɝɨɞɭ ɫɨɫɬɚɜɢɥ $3 ɦɥɪɞ ɇɚ ɩɟɪɜɨɦ ɦɟɫɬɟ ɩɨ ɢɦɩɨɪɬɭ ɩɪɨɞɭɤɬɨɜ ɫɬɨɹɬ ɤɨɧɞɢɬɟɪɫɤɢɟ ɢɡɞɟɥɢɹ, ɫɨɫɬɚɜɥɹɹ 400–500 ɦɥɧ ɞɨɥɥ. ȼ ɩɟɪɟɱɧɟ ɢɦɩɨɪɬɢɪɭɟɦɵɯ ɩɪɨɞɭɤɬɨɜ, ɨɤɚɡɵɜɚɸɳɢɯ ɡɧɚɱɢɬɟɥɶɧɭɸ ɧɚɝɪɭɡɤɭ ɧɚ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɭɸ ɛɟɡɨɩɚɫɧɨɫɬɶ ɧɚɲɟɣ
ɫɬɪɚɧɵ, ɩɨ ɞɚɧɧɵɦ Ɇɋɏ ɊɄ, ɬɚɤɠɟ ɜɯɨɞɹɬ ɦɨɥɨɱɧɵɟ ɩɪɨɞɭɤɬɵ – 13 %, ɫɚɯɚɪ – 8 %, ɦɹɫɨ ɩɬɢɰɵ
– 6 %, ɩɥɨɞɨɨɜɨɳɧɵɟ ɤɨɧɫɟɪɜɵ – 6 % , ɱɚɣ – 5 %, ɪɚɫɬɢɬɟɥɶɧɨɟ ɦɚɫɥɨ – 3 %, ɚ ɬɚɤɠɟ ɤɨɥɛɚɫɧɵɟ
ɢɡɞɟɥɢɹ. Ɉɛɟɫɩɟɱɟɧɢɟ Ʉɚɡɚɯɫɬɚɧɚ ɩɟɪɟɱɢɫɥɟɧɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ ɧɚɩɪɹɦɭɸ ɡɚɜɢɫɢɬ ɨɬ ɫɨɫɬɨɹɧɢɹ
ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɨɬɪɚɫɥɢ ɢ ɧɚɥɢɱɢɹ ɤɚɱɟɫɬɜɟɧɧɨɝɨ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ.
ȼɫɟɫɬɨɪɨɧɧɢɣ ɚɧɚɥɢɡ ɫɢɬɭɚɰɢɢ ɜ ɫɬɪɚɧɟ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɞɥɹ ɪɚɡɜɢɬɢɹ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ
ɨɬɪɚɫɥɢ ɫɥɨɠɢɥɢɫɶ ɛɥɚɝɨɩɪɢɹɬɧɵɟ ɭɫɥɨɜɢɹ. Ɍɚɤ, ɉɪɟɡɢɞɟɧɬ Ʉɚɡɚɯɫɬɚɧɚ ɇɭɪɫɭɥɬɚɧ ɇɚɡɚɪɛɚɟɜ
ɩɪɟɞɥɨɠɢɥ ɫɨɡɞɚɬɶ ɜ Ʉɚɡɚɯɫɬɚɧɟ 10 ɤɪɭɩɧɵɯ ɡɚɜɨɞɨɜ ɩɨ ɩɟɪɟɪɚɛɨɬɤɟ ɫɟɥɶɯɨɡɫɵɪɶɹ ɫ ɭɱɚɫɬɢɟɦ
ɬɪɚɧɫɧɚɰɢɨɧɚɥɶɧɵɯ ɤɨɪɩɨɪɚɰɢɣ. “… ɉɟɪɟɪɚɛɨɬɤɚ ɫɟɥɶɯɨɡɫɵɪɶɹ, ɤɭɞɚ ɧɚɞɨ ɧɚɩɪɚɜɥɹɬɶ ɛɨɥɶɲɟɟ
ɤɨɥɢɱɟɫɬɜɨ ɞɟɧɟɝ, ɫɬɚɧɨɜɢɬɫɹ ɜɚɠɧɵɦ ɜɨɩɪɨɫɨɦ. ȼ ɷɬɨɦ ɩɥɚɧɟ ɧɟɨɛɯɨɞɢɦɨ ɩɪɢɫɬɭɩɢɬɶ ɤ ɪɟɚɥɢɡɚɰɢɢ ɩɨɪɹɞɤɚ 10 ɤɪɭɩɧɵɯ ɩɪɨɟɤɬɨɜ ɫ ɭɱɚɫɬɢɟɦ ɬɪɚɧɫɧɚɰɢɨɧɚɥɶɧɵɯ ɤɨɦɩɚɧɢɣ ɜ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ
ɨɬɪɚɫɥɢ”, – ɫɤɚɡɚɥ ɇ. ɇɚɡɚɪɛɚɟɜ ɧɚ XVI ɫɴɟɡɞɟ ɩɚɪɬɢɢ “ɇɭɪ Ɉɬɚɧ” 11 ɦɚɪɬɚ 2015 ɝɨɞɚ. “ɉɪɢɱɟɦ
ɫɟɥɶɫɤɢɟ ɩɪɨɢɡɜɨɞɢɬɟɥɢ ɩɨɱɬɢ ɧɟ ɩɥɚɬɹɬ ɧɚɥɨɝɢ, ɦɵ ɩɨɡɜɨɥɹɟɦ ɢɦ, ɱɬɨɛɵ ɨɧɢ ɜɫɬɚɥɢ ɧɚ ɧɨɝɢ, ɧɨ,
ɫɤɨɥɶɤɨ ɠɟ ɨɧɢ ɦɨɝɭɬ ɜɫɬɚɜɚɬɶ ɧɚ ɧɨɝɢ? ɋɟɝɨɞɧɹ ɩɨɷɬɨɦɭ ɜɚɠɧɨ ɪɚɡɜɢɜɚɬɶ ɫɟɤɬɨɪ ɩɟɪɟɪɚɛɨɬɤɢ
ɫɟɥɶɯɨɡɫɵɪɶɹ ɧɚ ɨɫɧɨɜɟ ɧɨɜɨɣ ɤɨɦɩɥɟɤɫɧɨɣ ɩɪɨɝɪɚɦɦɵ”, – ɫɤɚɡɚɥ ɩɪɟɡɢɞɟɧɬ.
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɪɚɜɢɬɟɥɶɫɬɜɨ Ʉɚɡɚɯɫɬɚɧɚ ɨɞɨɛɪɢɥɨ ɉɪɨɝɪɚɦɦɭ “Ɋɚɡɜɢɬɢɟ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ ɜ Ɋɟɫɩɭɛɥɢɤɟ Ʉɚɡɚɯɫɬɚɧ ɧɚ 2015–2019 ɝɨɞɵ”, ɤɨɬɨɪɚɹ ɫɬɚɜɢɬ ɫɜɨɟɣ ɡɚɞɚɱɟɣ ɪɚɡɜɢɬɶ
ɫɨɛɫɬɜɟɧɧɨɟ ɩɪɨɢɡɜɨɞɫɬɜɨ ɢ ɫɜɟɫɬɢ ɤ ɦɢɧɢɦɭɦɭ ɢɦɩɨɪɬ ɩɪɨɞɭɤɬɨɜ. ȼ ɪɚɦɤɚɯ ɉɪɨɝɪɚɦɦɵ Ɇɋɏ
ɊɄ ɪɚɫɫɱɢɬɵɜɚɟɬ ɤ 2019 ɝɨɞɭ ɭɜɟɥɢɱɢɬɶ ɢɧɜɟɫɬɢɰɢɢ ɜ ɨɫɧɨɜɧɨɣ ɤɚɩɢɬɚɥ ɩɢɳɟɜɨɣ ɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɨɬɪɚɫɥɢ ɜ 3 ɪɚɡɚ – ɞɨ 97 ɦɥɪɞ ɬɟɧɝɟ (ɜ 2013 ɝɨɞɭ – 33 ɦɥɪɞ ɬɟɧɝɟ). Ɉɛɴɟɦ ɩɪɨɢɡɜɨɞɫɬɜɚ
ɩɢɳɟɜɨɣ ɩɪɨɞɭɤɰɢɢ ɞɨɥɠɟɧ ɜɵɪɚɫɬɢ ɧɚ 30 % – ɞɨ 1271 ɦɥɪɞ ɬɟɧɝɟ (ɜ 2013 ɝɨɞɭ – 973 ɦɥɪɞ ɬɟɧɝɟ),
ɢɦɩɨɪɬ, ɩɨ ɩɪɨɝɧɨɡɚɦ, ɞɨɥɠɟɧ ɫɧɢɡɢɬɶɫɹ ɜ ɬɪɢ ɪɚɡɚ (ɞɨ 1322 ɦɥɧ ɞɨɥɥɚɪɨɜ ɩɪɨɬɢɜ 2977 ɦɥɧ ɞɨɥɥɚɪɨɜ ɜ 2013 ɝɨɞɭ).
ɋɬɚɬɢɫɬɢɱɟɫɤɢɟ ɞɚɧɧɵɟ ɩɨɤɚɡɵɜɚɸɬ, ɱɬɨ ɜ 2013 ɝɨɞɭ ɨɛɴɟɦ ɩɟɪɟɪɚɛɨɬɚɧɧɨɣ ɫɟɥɶɯɨɡɩɪɨɞɭɤɰɢɢ
ɫɨɫɬɚɜɢɥ 1 ɬɪɥɧ. ɬɟɧɝɟ, ɬɨɝɞɚ ɤɚɤ ɜ 2009-ɦ ɝɨɞɭ ɷɬɨɬ ɩɨɤɚɡɚɬɟɥɶ ɫɨɫɬɚɜɥɹɥ 600 ɦɥɪɞ ɬɟɧɝɟ, ɬɨ ɟɫɬɶ
ɧɚɛɥɸɞɚɟɬɫɹ ɪɨɫɬ ɜ 65 %.
ɏɨɥɞɢɧɝɭ «Ȼɚɣɬɟɪɟɤ», ɦɢɫɫɢɟɣ ɤɨɬɨɪɨɝɨ ɹɜɥɹɟɬɫɹ ɮɢɧɚɧɫɨɜɨ-ɢɧɜɟɫɬɢɰɢɨɧɧɚɹ ɩɨɞɞɟɪɠɤɚ ɧɟɫɵɪɶɟɜɨɝɨ ɫɟɤɬɨɪɚ, ɨɛɟɫɩɟɱɟɧɢɟ ɭɫɬɨɣɱɢɜɨɝɨ ɪɚɡɜɢɬɢɹ ɢ ɞɢɜɟɪɫɢɮɢɤɚɰɢɹ ɷɤɨɧɨɦɢɤɢ Ʉɚɡɚɯɫɬɚɧɚ,
ɩɪɢɜɥɟɱɟɧɢɟ ɢɧɜɟɫɬɢɰɢɣ, ɪɚɡɜɢɬɢɟ ɤɥɚɫɬɟɪɨɜ, ɉɪɚɜɢɬɟɥɶɫɬɜɨɦ ɊɄ ɞɚɧɨ ɡɚɞɚɧɢɟ ɨ ɜɵɞɟɥɟɧɢɢ 17
ɦɥɪɞɬɟɧɝɟ (ɨɤ. 100 ɦɥɧ ɞɨɥɥ. ɋɒȺ) ɧɚ ɪɚɡɜɢɬɢɟ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ.
Ⱦɨɝɨɜɨɪ ɨ ȿɜɪɚɡɢɣɫɤɨɦ ɷɤɨɧɨɦɢɱɟɫɤɨɦ ɫɨɸɡɟ, ɤɨɬɨɪɵɣ ɜɫɬɭɩɢɥ ɜ ɫɢɥɭ ɫ 1 ɹɧɜɚɪɹ 2015 ɝɨɞɚ,
ɪɚɫɲɢɪɹɟɬ ɝɪɚɧɢɰɵ ɪɵɧɤɚ ɢ ɭɜɟɥɢɱɢɜɚɟɬ ɤɨɥɢɱɟɫɬɜɨ ɩɨɬɪɟɛɢɬɟɥɟɣ ɩɪɨɢɡɜɨɞɢɦɨɣ ɩɪɨɞɭɤɰɢɢ ɩɪɢ
ɭɫɥɨɜɢɢ ɟɟ ɫɨɨɬɜɟɬɫɬɜɢɹ ɬɪɟɛɨɜɚɧɢɹɦ ɩɪɢɧɹɬɵɯ Ɍɟɯɧɢɱɟɫɤɢɯ ɪɟɝɥɚɦɟɧɬɨɜ ɞɨ 170 ɦɥɧ ɱɟɥɨɜɟɤ.
ȼ ɬɚɤɢɯ ɭɫɥɨɜɢɹɯ ɩɟɪɟɞ ɚɝɪɚɪɧɨɣ ɧɚɭɤɨɣ ɜ ɨɛɥɚɫɬɢ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ
ɫɬɨɹɬ ɤɨɧɤɪɟɬɧɵɟ ɡɚɞɚɱɢ – ɩɪɟɞɥɨɠɢɬɶ ɢɧɧɨɜɚɰɢɨɧɧɵɟ ɪɚɡɪɚɛɨɬɤɢ ɢ ɬɟɯɧɨɥɨɝɢɢ ɞɥɹ ɨɛɟɫɩɟɱɟɧɢɹ
ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɨɣ ɛɟɡɨɩɚɫɧɨɫɬɢ ɫɬɪɚɧɵ ɢ ɞɥɹ ɫɧɢɠɟɧɢɹ ɢɦɩɨɪɬɨɡɚɜɢɫɢɦɨɫɬɢ.
ɉɪɨɜɟɞɟɧɧɵɣ ɜɵɲɟ ɚɧɚɥɢɡ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɩɪɨɢɡɜɨɞɫɬɜɨ ɜ ɫɬɪɚɧɟ ɡɟɪɧɚ, ɤɨɬɨɪɨɟ ɹɜɥɹɟɬɫɹ ɨɫɧɨɜɨɣ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɫ ɜɵɫɨɤɨɣ ɞɨɛɚɜɥɟɧɧɨɣ ɫɬɨɢɦɨɫɬɶɸ (ɜɵɫɨɤɚɹ ɢɦɩɨɪɬɨɡɚɜɢɫɢɦɨɫɬɶ), ɧɚɯɨɞɢɬɫɹ ɧɚ ɞɨɫɬɚɬɨɱɧɨɦ ɭɪɨɜɧɟ. Ɉɞɧɚɤɨ, ɨɫɧɨɜɧɵɦ ɫɞɟɪɠɢɜɚɸɳɢɦ ɮɚɤɬɨɪɨɦ ɜ
ɩɪɨɢɡɜɨɞɫɬɜɟ ɞɚɧɧɵɯ ɜɢɞɨɜ ɩɪɨɞɭɤɬɨɜ ɹɜɥɹɟɬɫɹ ɨɬɫɭɬɫɬɜɢɟ ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɟɪɟɪɚɛɨɬɤɢ ɢ ɩɨɥɧɚɹ ɢɦɩɨɪɬɨɡɚɜɢɫɢɦɨɫɬɶ ɨɬ ɤɨɦɩɨɧɟɧɬɨɜ, ɢɫɩɨɥɶɡɭɟɦɵɯ ɜ ɢɯ ɩɪɨɢɡɜɨɞɫɬɜɟ.
Ɍɚɤ, ɧɚɲɚ ɫɬɪɚɧɚ ɹɜɥɹɟɬɫɹ ɢɦɩɨɪɬɨɡɚɜɢɫɢɦɨɣ ɜ ɨɬɧɨɲɟɧɢɢ ɥɟɰɢɬɢɧɚ, ɩɨɬɪɟɛɧɨɫɬɶ ɜ ɤɨɬɨɪɨɦ
ɫɨɫɬɚɜɥɹɟɬ ɛɨɥɟɟ 200 ɬɵɫɹɱ ɬɨɧɧ ɜ ɝɨɞ.
341
ɒɢɪɨɤɨ ɢɫɩɨɥɶɡɭɟɦɵɟ ɜ ɩɪɨɢɡɜɨɞɫɬɜɟ ɤɨɧɞɢɬɟɪɫɤɢɯ ɢɡɞɟɥɢɣ ɪɚɡɥɢɱɧɵɟ ɫɢɪɨɩɵ ɢ ɩɚɬɨɤɢ ɢɦɩɨɪɬɢɪɭɸɬɫɹ ɜ ɫɬɪɚɧɭ ɧɚ ɫɭɦɦɭ 500 ɦɥɧ ɞɨɥɥ. ɋɒȺ.
ɉɨɬɪɟɛɧɨɫɬɶ ɜ ɷɮɢɪɧɵɯ ɦɚɫɥɚɯ ɫɨɫɬɚɜɥɹɟɬ ɧɟ ɦɟɧɟɟ 1 ɬɵɫɹɱɢ ɬɨɧɧ ɜ ɝɨɞ ɩɪɢ ɰɟɧɟ ɨɬ 1,6 ɞɨ 3990
ɞɨɥɥɚɪɨɜ ɡɚ 1 ɤɝ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɞɥɹ ɭɜɟɥɢɱɟɧɢɹ ɜ ɤɨɧɟɱɧɵɯ ɩɪɨɞɭɤɬɚɯ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ ɞɨɥɢ ɤɚɡɚɯɫɬɚɧɫɤɨɝɨ ɫɨɞɟɪɠɚɧɢɹ ɟɞɢɧɫɬɜɟɧɧɵɦ ɫɬɪɚɬɟɝɢɱɟɫɤɢ ɩɪɚɜɢɥɶɧɵɦ ɜɵɯɨɞɨɦ ɹɜɥɹɟɬɫɹ
ɪɚɡɜɢɬɢɟ ɜ ɫɬɪɚɧɟ ɤɨɦɩɥɟɤɫɧɨɣ ɢ ɝɥɭɛɨɤɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɫɵɪɶɹ ɞɥɹ ɭɤɪɟɩɥɟɧɢɹ ɫɜɨɟɝɨ ɜɧɭɬɪɟɧɧɟɝɨ ɪɵɧɤɚ ɢ ɫɨɡɞɚɧɢɹ ɩɪɨɞɭɤɰɢɢ ɫ ɜɵɫɨɤɨɣ ɞɨɛɚɜɥɟɧɧɨɣ ɫɬɨɢɦɨɫɬɶɸ, ɫɩɨɫɨɛɧɨɣ ɛɵɬɶ ɤɨɧɤɭɪɟɧɬɧɨɫɩɨɫɨɛɧɵɦ ɬɨɜɚɪɨɦ.
ɂɦɟɧɧɨ ɧɚ ɷɬɨ ɧɚɩɪɚɜɥɟɧɵ ɢɫɫɥɟɞɨɜɚɧɢɹ ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ
ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ» (ɞɚɥɟɟ – ɂɧɫɬɢɬɭɬ). Ɂɚ ɩɨɫɥɟɞɧɢɟ 5 ɥɟɬ ɂɧɫɬɢɬɭɬɨɦ
ɪɚɡɪɚɛɨɬɚɧɵ ɛɨɥɟɟ 20 ɬɟɯɧɨɥɨɝɢɣ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɨɜɵɯ ɢ ɦɚɫɥɢɱɧɵɯ ɬɚɤɢɯ ɩɪɨɞɭɤɬɨɜ, ɤɚɤ ɤɪɚɯɦɚɥ ɢ ɦɨɞɢɮɢɰɢɪɨɜɚɧɧɵɟ ɤɪɚɯɦɚɥɵ (ɪɟɡɢɫɬɟɬɧɵɟ, ɮɨɫɮɚɬɧɵɟ, ɷɤɫɬɪɭɡɢɨɧɧɵɟ) ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ;
ɤɪɚɯɦɚɥɶɧɚɹ ɩɚɬɨɤɚ; ɝɥɸɤɨɡɧɨ-ɮɪɭɤɬɨɡɧɵɟ ɫɢɪɨɩɵ; ɷɬɢɥɥɚɤɬɚɬ; ɦɨɥɨɱɧɚɹ ɤɢɫɥɨɬɚ; ɤɚɪɛɨɤɫɢɦɟɬɢɥɤɪɚɯɦɚɥ; ɤɚɪɛɨɤɫɢɦɟɬɢɥɰɟɥɥɸɥɨɡɚ; ɫɨɪɛɢɬ; ɫɨɪɝɨɜɵɣ ɫɢɪɨɩ; ɰɟɥɥɸɥɨɡɚ ɢɡ ɨɬɯɨɞɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ; ɤɪɢɫɬɚɥɥɢɱɟɫɤɚɹ ɝɥɸɤɨɡɚ; ɤɫɢɥɨɡɚ; ɤɫɢɥɢɬ; ɩɟɪɟɷɬɢɮɢɰɢɪɨɜɚɧɧɵɟ
ɠɢɪɵ ɢ ɞɪ. ȼɫɟ ɩɨɥɭɱɟɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ ɡɚɳɢɳɟɧɵ ɩɚɬɟɧɬɚɦɢ. Ɍɚɤ, ɢɧɫɬɢɬɭɬ ɨɛɥɚɞɚɟɬ ɛɨɥɟɟ ɱɟɦ
40 ɢɧɧɨɜɚɰɢɨɧɧɵɦɢ ɩɚɬɟɧɬɚɦɢ ɊɄ ɢ 2 ȿɜɪɚɡɢɣɫɤɢɦɢ ɩɚɬɟɧɬɚɦɢ.
Ⱥɧɚɥɢɡ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɪɚɡɜɢɬɢɟ ɝɥɭɛɨɤɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɨɜɨɝɨ ɫɵɪɶɹ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɩɨɡɜɨɥɢɬ ɜɨɜɥɟɱɶ ɜ ɧɚɪɨɞɧɨɯɨɡɹɣɫɬɜɟɧɧɵɣ ɨɛɨɪɨɬ ɟɠɟɝɨɞɧɵɟ ɩɟɪɟɯɨɞɹɳɢɟ ɨɫɬɚɬɤɢ ɡɟɪɧɚ ɜ ɤɨɥɢɱɟɫɬɜɟ
ɨɬ 2 ɞɨ 4 ɦɥɧ ɬɨɧɧ ɢ ɨɬɯɨɞɵ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɜ ɤɨɥɢɱɟɫɬɜɟ ɞɨ 10 ɦɥɧ ɬɨɧɧ.
ȼ ɫɪɟɞɧɟɦ ɜ ɪɟɫɩɭɛɥɢɤɟ ɟɠɟɝɨɞɧɨ ɩɪɨɢɡɜɨɞɢɬɫɹ ɨɬ 13 ɞɨ 26 ɦɥɧ ɬɨɧɧ ɡɟɪɧɚ, ɢɡ ɧɢɯ 8 ɦɥɧ ɬɨɧɧ
ɩɪɢɯɨɞɢɬɫɹ ɧɚ ɜɧɭɬɪɟɧɧɟɟ ɩɨɬɪɟɛɥɟɧɢɟ, ɨɬ 4 ɞɨ 8 ɦɥɧ ɬɨɧɧ – ɧɚ ɷɤɫɩɨɪɬ ɢ ɜ ɢɡɛɵɬɤɟ ɨɫɬɚɟɬɫɹ ɩɪɢɛɥɢɡɢɬɟɥɶɧɨ 2–4 ɦɥɧ ɬɨɧɧ.
Ɉɞɧɢɦ ɢɡ ɩɟɪɫɩɟɤɬɢɜɧɵɯ ɧɚɩɪɚɜɥɟɧɢɣ ɜ ɪɚɡɜɢɬɢɢ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ Ɋɟɫɩɭɛɥɢɤɢ
Ʉɚɡɚɯɫɬɚɧ ɹɜɥɹɟɬɫɹ ɫɨɡɞɚɧɢɟ ɜɵɫɨɤɨɬɟɯɧɨɥɨɝɢɱɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɪɨɞɭɤɬɨɜ ɝɥɭɛɨɤɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɧɚ ɨɫɧɨɜɟ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ.
ɉɨ ɪɚɫɱɟɬɚɦ ɫɩɟɰɢɚɥɢɫɬɨɜ, ɪɟɧɬɚɛɟɥɶɧɨɫɬɶ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɪɚɯɦɚɥɚ ɜɵɲɟ, ɱɟɦ ɦɭɤɢ ɢ ɦɚɤɚɪɨɧɧɵɯ ɢɡɞɟɥɢɣ. Ȼɨɥɟɟ ɝɥɭɛɨɤɚɹ ɩɟɪɟɪɚɛɨɬɤɚ ɩɨɜɵɲɚɟɬ ɤɨɧɟɱɧɭɸ ɫɬɨɢɦɨɫɬɶ ɩɪɨɞɭɤɬɚ, ɱɬɨ ɢ ɩɨɡɜɨɥɹɟɬ ɝɨɜɨɪɢɬɶ ɨ ɧɟɣ ɤɚɤ ɨ ɩɪɨɢɡɜɨɞɫɬɜɟ ɩɪɨɞɭɤɬɨɜ ɫ ɜɵɫɨɤɨɣ ɞɨɛɚɜɥɟɧɧɨɣ ɫɬɨɢɦɨɫɬɶɸ.
ȼɵɫɨɤɢɣ ɬɟɦɩ ɢɧɧɨɜɚɰɢɣ, ɧɚɛɥɸɞɚɟɦɵɣ ɜ ɩɨɫɥɟɞɧɟɟ ɜɪɟɦɹ ɜ ɨɛɥɚɫɬɢ ɝɥɭɛɨɤɨɣ ɩɟɪɟɪɚɛɨɬɤɢ
ɡɟɪɧɚ, ɩɪɟɠɞɟ ɜɫɟɝɨ, ɫɜɹɡɚɧ ɫ ɪɚɡɪɚɛɨɬɤɨɣ ɪɚɡɥɢɱɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɦɨɞɢɮɢɤɚɰɢɢ ɧɚɬɢɜɧɨɝɨ ɤɪɚɯɦɚɥɚ, ɬ.ɟ. ɰɟɥɟɧɚɩɪɚɜɥɟɧɧɨɝɨ ɮɢɡɢɤɨ-ɯɢɦɢɱɟɫɤɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ, ɩɨɡɜɨɥɹɸɳɟɝɨ ɭɩɪɚɜɥɹɬɶ ɟɝɨ ɩɪɚɤɬɢɱɟɫɤɢ ɰɟɧɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɱɬɨ ɤɪɚɣɧɟ ɜɚɠɧɨ ɞɥɹ ɩɢɳɟɜɨɣ ɢ ɞɪɭɝɢɯ ɨɬɪɚɫɥɟɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ.
ȼ ɦɢɪɟ ɜɵɩɭɫɤɚɟɬɫɹ ɲɢɪɨɤɚɹ ɝɚɦɦɚ ɦɨɞɢɮɢɰɢɪɨɜɚɧɧɵɯ ɤɪɚɯɦɚɥɨɜ, ɤɨɬɨɪɵɟ ɲɢɪɨɤɨ ɢɫɩɨɥɶɡɭɸɬɫɹ ɜ ɩɢɳɟɜɨɣ ɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ, ɰɟɥɥɸɥɨɡɧɨ-ɛɭɦɚɠɧɨɣ, ɬɟɤɫɬɢɥɶɧɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ,
ɫɬɪɨɣɢɧɞɭɫɬɪɢɢ, ɞɥɹ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɮɨɪɦɨɜɨɱɧɵɯ ɫɦɟɫɟɣ ɜ ɥɢɬɟɣɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ, ɤɚɤ ɤɨɦɩɨɧɟɧɬ ɦɨɸɳɢɯ ɫɪɟɞɫɬɜ, ɜ ɤɚɱɟɫɬɜɟ ɮɨɬɨɪɟɚɝɟɧɬɨɜ ɞɥɹ ɫɬɚɛɢɥɢɡɚɰɢɢ ɛɭɪɨɜɵɯ ɪɚɫɬɜɨɪɨɜ ɩɪɢ ɧɟɮɬɟɛɭɪɟɧɢɢ, ɜ ɦɟɞɢɰɢɧɟ, ɪɚɞɢɨɬɟɯɧɢɤɟ, ɩɪɢ ɢɡɝɨɬɨɜɥɟɧɢɢ ɭɩɚɤɨɜɨɱɧɵɯ ɛɢɨɪɚɡɪɭɲɚɟɦɵɯ ɦɚɬɟɪɢɚɥɨɜ
ɢ ɩɨɫɭɞɵ ɪɚɡɨɜɨɝɨ ɩɨɥɶɡɨɜɚɧɢɹ ɢ ɞɪɭɝɢɯ.
ȼ ɊɄ ɜ ɫɪɟɞɧɟɦ ɡɚ 2011–2013 ɝɨɞɵ ɢɦɩɨɪɬ ɦɨɞɢɮɢɰɢɪɨɜɚɧɧɵɯ ɤɪɚɯɦɚɥɨɜ ɢ ɞɪ. ɫɨɫɬɚɜɢɥ 2393,4
ɬɨɧɧ ɜ ɝɨɞ, ɩɨɫɬɚɜɳɢɤɢ – ɋɒȺ, ȿɋ. Ɉɞɧɚɤɨ, ɩɪɢ ɞɨɥɠɧɨɦ ɪɚɡɜɢɬɢɢ ɜ ɫɬɪɚɧɟ ɩɢɳɟɜɨɣ ɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɨɬɪɚɫɥɟɣ ɩɨɬɪɟɛɧɨɫɬɶ ɜ ɦɨɞɢɮɢɰɢɪɨɜɚɧɧɵɯ ɤɪɚɯɦɚɥɚɯ ɡɧɚɱɢɬɟɥɶɧɨ ɭɜɟɥɢɱɢɬɫɹ.
Ƚɥɭɛɨɤɚɹ ɩɟɪɟɪɚɛɨɬɤɚ ɡɟɪɧɨɜɵɯ ɫ ɩɪɨɢɡɜɨɞɫɬɜɨɦ ɩɪɨɞɭɤɬɨɜ ɫ ɜɵɫɨɤɨɣ ɞɨɛɚɜɥɟɧɧɨɣ ɫɬɨɢɦɨɫɬɶɸ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɜ ɪɟɫɩɭɛɥɢɤɟ ɧɚ ɞɜɭɯ ɩɪɟɞɩɪɢɹɬɢɹɯ ɫ ɨɛɳɢɦ ɨɛɴɟɦɨɦ
ɩɟɪɟɪɚɛɨɬɤɢ ɜɫɟɝɨ 100 ɬɵɫ. ɬɨɧɧ ɤɭɤɭɪɭɡɵ ɜ ɝɨɞ.
ȼ ɨɬɥɢɱɢɟ ɨɬ ɫɬɪɚɧ ȿɜɪɨɩɵ, ɜ ɤɨɬɨɪɵɯ ɧɟɬ ɛɨɥɶɲɢɯ ɩɪɨɛɥɟɦ ɧɟ ɬɨɥɶɤɨ ɫ ɩɪɨɞɭɤɬɚɦɢ ɩɢɬɚɧɢɹ,
ɧɨ ɢ ɫ ɢɯ ɤɚɱɟɫɬɜɨɦ ɢ ɚɫɫɨɪɬɢɦɟɧɬɨɦ, ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɟ ɨɬɪɚɫɥɢ ȺɉɄ Ʉɚɡɚɯɫɬɚɧɚ ɞɨ ɫɢɯ ɩɨɪ ɯɚɪɚɤɬɟɪɢɡɭɸɬɫɹ ɱɪɟɡɜɵɱɚɣɧɨ ɧɟɷɮɮɟɤɬɢɜɧɨɣ ɫɬɪɭɤɬɭɪɨɣ ɩɟɪɟɪɚɛɨɬɤɢ ɫɵɪɶɹ ɢ ɜɵɪɚɛɨɬɤɢ ɝɨɬɨɜɨɣ
ɩɪɨɞɭɤɰɢɢ.
Ȼɨɥɶɲɟ ɩɨɥɨɜɢɧɵ ɨɛɨɪɨɬɚ ɫɨɜɪɟɦɟɧɧɨɣ ɦɢɪɨɜɨɣ ɛɢɨɢɧɞɭɫɬɪɢɢ ɩɪɢɯɨɞɢɬɫɹ ɧɚ ɞɨɥɸ ɋɒȺ. Ⱦɥɹ
ɫɪɚɜɧɟɧɢɹ, ɨɛɴɟɦ ɮɢɧɚɧɫɢɪɨɜɚɧɢɹ ɛɢɨɬɟɯɧɨɥɨɝɢɢ ɜ ɋɒȺ ɫɨɫɬɚɜɥɹɟɬ 160 ɦɥɪɞ ɞɨɥɥ., Ʉɢɬɚɟ – 3
ɦɥɪɞ ɞɨɥɥ., ɜ Ɋɨɫɫɢɢ – 0,6 ɦɥɪɞ ɞɨɥɥ. ɜ ɝɨɞ, ɫɬɪɚɧɚɯ ȿɋ – 83 ɦɥɪɞ ɞɨɥɥ., ɜ ɬɨ ɜɪɟɦɹ ɤɚɤ ɜ Ʉɚɡɚɯɫɬɚɧɟ
ɜ ɝɨɞ ɜ ɛɸɞɠɟɬɟ ɪɟɫɩɭɛɥɢɤɢ ɧɚ ɰɟɥɟɜɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɢ ɪɚɡɪɚɛɨɬɤɢ ɜ ɨɛɥɚɫɬɢ ɛɢɨɬɟɯɧɨɥɨɝɢɢ ɡɚɤɥɚɞɵɜɚɟɬɫɹ ɫɭɦɦɚ ɩɨɪɹɞɤɚ 2 ɦɥɧ ɞɨɥɥ. (0,002 ɦɥɪɞ ɞɨɥɥ. ɋɒȺ).
«Ȼɟɥɚɹ» ɛɢɨɬɟɯɧɨɥɨɝɢɹ ɜ ɋɒȺ ɩɪɟɞɫɬɚɜɥɟɧɚ ɜ ɨɫɧɨɜɧɨɦ ɝɥɭɛɨɤɨɣ ɩɟɪɟɪɚɛɨɬɤɨɣ ɡɟɪɧɚ, ɝɥɚɜɧɵɦ ɢɡ ɤɨɬɨɪɵɯ ɹɜɥɹɟɬɫɹ ɤɭɤɭɪɭɡɚ: ɟɠɟɝɨɞɧɨ 145 ɦɥɧ ɬ ɤɭɤɭɪɭɡɵ – 36 % ɜɫɟɝɨ ɭɪɨɠɚɹ, ɩɨɞɜɟɪɝɚɟɬɫɹ ɝɥɭɛɨɤɨɣ ɩɟɪɟɪɚɛɨɬɤɟ, ɱɬɨ ɩɨɱɬɢ ɜɬɪɨɟ ɩɪɟɜɵɲɚɟɬ ɟɟ ɷɤɫɩɨɪɬ (51 ɦɥɧ ɬɨɧɧ).
342
ɉɨ ɞɚɧɧɵɦ ɷɤɫɩɟɪɬɨɜ, ɜ Ɋɨɫɫɢɢ ɧɚ ɬɟɤɭɳɢɣ ɦɨɦɟɧɬ ɮɚɤɬɢɱɟɫɤɢ ɨɬɫɭɬɫɬɜɭɸɬ ɩɪɨɦɵɲɥɟɧɧɵɟ
ɨɛɪɚɡɰɵ ɩɪɢɦɟɪɨɜ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɛɢɨɬɟɯɧɨɥɨɝɢɢ ɜ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ, ɧɨ ɩɪɢ ɷɬɨɦ ɪɨɫɫɢɣɫɤɚɹ ɧɚɭɱɧɚɹ ɛɚɡɚ ɩɨ ɧɟɤɨɬɨɪɵɦ ɩɟɪɫɩɟɤɬɢɜɧɵɦ ɧɚɩɪɚɜɥɟɧɢɹɦ (ɧɚɩɪɢɦɟɪ, ɩɨɥɭɱɟɧɢɟ ɛɢɨɞɟɝɪɚɞɢɪɭɟɦɵɯ
ɩɨɥɢɦɟɪɨɜ) ɩɨɡɜɨɥɹɟɬ ɩɪɢ ɧɚɥɢɱɢɢ ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɯ ɨɛɴɟɦɨɜ ɮɢɧɚɧɫɢɪɨɜɚɧɢɹ ɧɚɥɚɞɢɬɶ ɤɪɭɩɧɨɬɨɧɧɚɠɧɵɟ ɩɪɨɢɡɜɨɞɫɬɜɚ ɧɟɨɛɯɨɞɢɦɵɯ ɦɚɬɟɪɢɚɥɨɜ.
Ɍɚɤɚɹ ɠɟ ɫɢɬɭɚɰɢɹ ɯɚɪɚɤɬɟɪɧɚ ɢ ɞɥɹ Ʉɚɡɚɯɫɬɚɧɚ. Ɉɫɧɨɜɨɣ ɪɚɡɜɢɬɢɹ ɛɢɨɬɟɯɧɨɥɨɝɢɣ ɹɜɥɹɟɬɫɹ
ɪɚɡɜɢɬɢɟ ɦɢɤɪɨɛɢɨɥɨɝɢɢ. ȼ Ʉɚɡɚɯɫɬɚɧɟ ɢɦɟɟɬɫɹ ɛɨɥɶɲɨɣ ɨɩɵɬ ɩɨɥɭɱɟɧɢɹ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɪɨɦɵɲɥɟɧɧɨ-ɰɟɧɧɵɯ ɲɬɚɦɦɨɜ ɦɨɥɨɱɧɨɤɢɫɥɵɯ ɛɚɤɬɟɪɢɣ, ɨɞɧɚɤɨ ɩɪɨɦɵɲɥɟɧɧɵɯ ɩɪɨɞɭɰɟɧɬɨɜ ɞɥɹ
ɩɪɨɢɡɜɨɞɫɬɜɚ ɛɢɨɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɩɪɚɤɬɢɱɟɫɤɢ ɧɟɬ.
Ⱦɥɹ ɞɨɫɬɢɠɟɧɢɹ ɩɨɫɬɚɜɥɟɧɧɵɯ ɰɟɥɟɣ ɩɨ ɢɦɩɨɪɬɨɡɚɦɟɳɟɧɢɸ ɢ ɩɨɜɵɲɟɧɢɸ ɤɨɧɤɭɪɟɧɬɨɫɩɨɫɨɛɧɨɫɬɢ ɩɪɨɢɡɜɨɞɢɦɵɯ ɩɪɨɞɭɤɬɨɜ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɨɜɨɝɨ ɫɵɪɶɹ ɧɟɨɛɯɨɞɢɦɨ ɡɧɚɱɢɬɟɥɶɧɨɟ ɪɚɡɜɢɬɢɟ
ɛɢɨɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɨɬɪɚɫɥɢ, ɜɤɥɸɱɚɸɳɟɟ ɜ ɬɨɦ ɱɢɫɥɟ ɢ ɪɚɡɜɢɬɢɟ ɦɢɤɪɨɛɢɥɨɝɢɢ,
ɷɧɡɢɦɨɥɨɝɢɢ, ɛɢɨɬɟɯɧɨɥɨɝɢɱɟɫɢɤɯ ɦɟɬɨɞɨɜ ɢ ɬ.ɞ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɚɧɚɥɢɡ ɫɨɜɪɟɦɟɧɧɨɝɨ ɫɨɫɬɨɹɧɢɹ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ ɩɨɤɚɡɚɥ
ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɫɨɡɞɚɧɢɹ ɢ ɜɧɟɞɪɟɧɢɹ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɧɨɜɵɯ, ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɢ ɩɪɨɪɵɜɧɵɯ ɬɟɯɧɨɥɨɝɢɣ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɯ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɢ ɛɟɡɨɬɯɨɞɧɨɫɬɶ ɟɝɨ ɩɟɪɟɪɚɛɨɬɤɢ.
ɍȾɄ 664.78.612.3.599.9
ɄɊɍɉəɇɕȿ ɉɊɈȾɍɄɌɕ
ȼ ɋɂɋɌȿɆȿ ɉɂɌȺɇɂə ɋɈȼɊȿɆȿɇɇɈȽɈ ɑȿɅɈȼȿɄȺ
ɒȺɃɆȿɊȾȿɇɈȼȺ Ⱦ.Ⱥ., ɑȺɄȺɇɈȼȺ ɀ.Ɇ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ», Ⱥɫɬɚɧɚ, Ʉɚɡɚɯɫɬɚɧ, e-mail: niizpp_pprs@mail.ru
Ɉɫɧɨɜɧɵɦ ɧɚɩɪɚɜɥɟɧɢɟɦ ɪɚɡɜɢɬɢɹ ɩɢɳɟɜɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ Ʉɚɡɚɯɫɬɚɧɚ ɹɜɥɹɟɬɫɹ ɫɨɡɞɚɧɢɟ ɫɛɚɥɚɧɫɢɪɨɜɚɧɧɵɯ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ ɢ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɰɟɧɧɨɫɬɢ.
ɉɢɬɚɧɢɟ ɱɟɥɨɜɟɤɚ ɹɜɥɹɟɬɫɹ ɨɞɧɢɦ ɢɡ ɜɚɠɧɟɣɲɢɯ ɮɚɤɬɨɪɨɜ, ɨɩɪɟɞɟɥɹɸɳɢɯ ɡɞɨɪɨɜɶɟ ɧɚɫɟɥɟɧɢɹ.
ɉɪɚɜɢɥɶɧɨɟ ɩɢɬɚɧɢɟ ɨɛɟɫɩɟɱɢɜɚɟɬ ɧɨɪɦɚɥɶɧɵɣ ɪɨɫɬ ɢ ɪɚɡɜɢɬɢɟ, ɫɩɨɫɨɛɫɬɜɭɟɬ ɩɪɨɮɢɥɚɤɬɢɤɟ ɡɚɛɨɥɟɜɚɧɢɣ, ɩɪɨɞɥɟɧɢɸ ɠɢɡɧɢ ɥɸɞɟɣ, ɩɨɜɵɲɟɧɢɸ ɪɚɛɨɬɨɫɩɨɫɨɛɧɨɫɬɢ ɢ ɫɨɡɞɚɟɬ ɭɫɥɨɜɢɹ ɞɥɹ ɚɞɟɤɜɚɬɧɨɣ ɚɞɚɩɬɚɰɢɢ ɤ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɟ.
ɑɬɨ ɤɚɫɚɟɬɫɹ ɩɢɬɚɧɢɹ ɧɚɫɟɥɟɧɢɹ ɧɚɲɟɣ ɫɬɪɚɧɵ, ɬɨ ɭ ɛɨɥɶɲɢɧɫɬɜɚ, ɩɨ ɨɰɟɧɤɟ ɫɩɟɰɢɚɥɢɫɬɨɜ,
ɜɵɹɜɥɟɧɵ ɧɚɪɭɲɟɧɢɹ ɩɨɥɧɨɰɟɧɧɨɝɨ ɩɢɬɚɧɢɹ, ɨɛɭɫɥɨɜɥɟɧɧɵɟ ɤɚɤ ɧɟɞɨɫɬɚɬɨɱɧɵɦ ɩɨɬɪɟɛɥɟɧɢɟɦ
ɩɢɳɟɜɵɯ ɜɟɳɟɫɬɜ, ɬɚɤ ɢ ɧɟɪɚɰɢɨɧɚɥɶɧɵɦ ɢɯ ɫɨɨɬɧɨɲɟɧɢɟɦ. ȼ ɷɬɨɦ ɚɫɩɟɤɬɟ ɧɟ ɜɵɡɵɜɚɟɬ ɫɨɦɧɟɧɢɣ, ɱɬɨ ɧɟɨɬɴɟɦɥɟɦɵɦ ɚɬɪɢɛɭɬɨɦ ɩɨɥɧɨɰɟɧɧɨɝɨ ɩɢɬɚɧɢɹ ɞɨɥɠɧɵ ɛɵɬɶ ɡɥɚɤɨɜɵɟ ɤɭɥɶɬɭɪɵ ɢ
ɩɪɨɞɭɤɬɵ ɢɯ ɩɟɪɟɪɚɛɨɬɤɢ (ɤɪɭɩɵ). Ɉɞɧɚɤɨ, ɚɧɚɥɢɡ ɩɨɤɚɡɵɜɚɟɬ, ɱɬɨ ɜɵɪɚɛɚɬɵɜɚɟɦɵɣ ɜ ɪɟɫɩɭɛɥɢɤɟ
ɨɛɴɟɦ ɤɪɭɩ ɧɟ ɞɨɫɬɚɬɨɱɟɧ.
Ɍɚɤ, ɩɨ ɞɚɧɧɵɦ Ʉɨɦɢɬɟɬɚ ɩɨ ɫɬɚɬɢɫɬɢɤɟ, ɩɪɨɢɡɜɨɞɫɬɜɨ ɤɪɭɩɵ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɡɚ 10 ɥɟɬ ɭɜɟɥɢɱɢɥɨɫɶ ɜ 1,3 ɪɚɡɚ, ɬɨɝɞɚ ɤɚɤ ɡɚ ɩɨɫɥɟɞɧɢɟ 5 ɥɟɬ ɩɪɨɢɡɜɨɞɫɬɜɨ ɤɪɭɩɵ ɩɨɜɵɫɢɥɨɫɶ ɩɨɱɬɢ ɜ 2 ɪɚɡɚ. ɂ ɷɬɨ
ɧɟ ɩɪɟɞɟɥ ɞɥɹ ɤɪɭɩɹɧɵɯ ɩɪɟɞɩɪɢɹɬɢɣ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɜ ɪɟɫɩɭɛɥɢɤɟ ɢɡ ɨɛɳɟɝɨ ɨɛɴɟɦɚ ɩɪɨɢɡɜɨɞɢɬɫɹ: ɪɢɫɨɜɨɣ-54 %, ɩɲɟɧɢɱɧɨɣ-8 %, ɝɪɟɱɧɟɜɨɣ-9 %, ɡɟɪɧɨɛɨɛɨɜɵɯ ɤɪɭɩ-19 %, ɩɲɟɧɧɨɣ-3 %
ɢ ɩɟɪɥɨɜɨɣ-2 % ɤɪɭɩɵ. ȼɦɟɫɬɟ ɫ ɬɟɦ, ɧɟɞɨɫɬɚɬɨɱɧɵ ɨɛɴɟɦɵ ɩɪɨɢɡɜɨɞɫɬɜɚ ɨɜɫɹɧɨɣ-0,7 %, ɤɭɤɭɪɭɡɧɨɣ-1 % ɢ ɹɱɧɟɜɨɣ-1 % ɤɪɭɩ. [1]
ɇɚ 01 ɞɟɤɚɛɪɹ 2014 ɝ. ɜ Ʉɚɡɚɯɫɬɚɧɟ ɫɭɳɟɫɬɜɨɜɚɥɨ ɛɨɥɟɟ 45 ɤɪɭɩɹɧɵɯ ɩɪɟɞɩɪɢɹɬɢɣ ɫ ɝɨɞɨɜɨɣ
ɦɨɳɧɨɫɬɶɸ 341338,5 ɬɨɧɧ.
ȼɵɪɚɛɚɬɵɜɚɟɦɚɹ ɧɚ ɞɚɧɧɵɯ ɩɪɟɞɩɪɢɹɬɢɹɯ ɤɪɭɩɚ ɢɦɟɟɬ ɧɟɡɧɚɱɢɬɟɥɶɧɵɟ ɨɛɴɟɦɵ ɩɪɨɢɡɜɨɞɫɬɜɚ
ɜɵɫɲɢɯ ɫɨɪɬɨɜ, ɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɟ ɤɪɭɩɨɰɟɯɚ ɧɟ ɨɛɟɫɩɟɱɢɜɚɸɬ ɬɪɟɛɨɜɚɧɢɹ ɞɟɣɫɬɜɭɸɳɢɯ
ɫɬɚɧɞɚɪɬɨɜ ɧɚ ɝɨɬɨɜɭɸ ɩɪɨɞɭɤɰɢɸ [2,3].
ȼɦɟɫɬɟ ɫ ɬɟɦ, ɩɨɥɭɱɟɧɧɵɟ ɤɪɭɩɵ, ɡɚ ɫɱɟɬ ɫɥɨɠɧɨɝɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɩɪɨɰɟɫɫɚ ɩɟɪɟɪɚɛɨɬɤɢ,
ɢɦɟɸɬ ɧɟɞɨɫɬɚɬɨɱɧɨ ɜɵɫɨɤɨɟ ɫɨɞɟɪɠɚɧɢɟ ɛɟɥɤɚ, ɧɟɡɚɦɟɧɢɦɵɯ ɚɦɢɧɨɤɢɫɥɨɬ, ɧɢɡɤɨɟ ɫɨɞɟɪɠɚɧɢɟ
ɠɢɪɨɪɚɫɬɜɨɪɢɦɵɯ ɜɢɬɚɦɢɧɨɜ ɢ ɧɟɤɨɬɨɪɵɯ ɦɢɧɟɪɚɥɶɧɵɯ ɜɟɳɟɫɬɜ [2,3].
Ɉɫɨɛɟɧɧɨ ɧɟɞɨɫɬɚɬɨɱɧɨ ɩɪɨɢɡɜɨɞɫɬɜɨ ɩɪɨɞɭɤɬɨɜ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ (ɝɨɬɨɜɵɯ ɤ ɭɩɨɬɪɟɛɥɟɧɢɸ), ɚ ɬɚɤɠɟ ɞɢɟɬɢɱɟɫɤɢɯ, ɥɟɱɟɛɧɨ-ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɯ, ɨɡɞɨɪɚɜɥɢɜɚɸɳɢɯ ɧɚ ɨɫɧɨɜɟ ɡɟɪɧɨɜɵɯ
ɤɭɥɶɬɭɪ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɫɩɪɨɫ ɤɚɡɚɯɫɬɚɧɫɤɨɝɨ ɧɚɫɟɥɟɧɢɹ ɧɚ ɩɪɨɞɭɤɬɵ ɛɟɥɤɨɜɨɝɨ ɩɢɬɚɧɢɹ ɭɞɨɜɥɟɬɜɨɪɹɟɬɫɹ ɡɚ ɫɱɟɬ ɢɦɩɨɪɬɚ, ɬɚɤ ɤɚɤ ɧɚ ɪɨɡɧɢɱɧɨɦ ɪɵɧɤɟ ɝɨɬɨɜɵɯ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɢ ɩɢɳɟ343
ɜɵɯ ɩɪɨɞɭɤɬɨɜ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ, ɩɪɨɢɡɜɟɞɟɧɧɵɯ ɧɚ ɨɫɧɨɜɟ ɡɟɪɧɨɜɨɝɨ ɫɵɪɶɹ, ɩɪɢɫɭɬɫɬɜɭɸɬ
ɬɨɥɶɤɨ ɡɚɪɭɛɟɠɧɵɟ ɩɪɨɢɡɜɨɞɢɬɟɥɢ (ɞɨɥɹ ɧɚ ɪɵɧɤɟ ɫɨɫɬɚɜɥɹɟɬ ɨɤɨɥɨ 96 %). [3]
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɧɟɨɛɯɨɞɢɦɨ ɧɚɫɵɳɟɧɢɟ ɜɧɭɬɪɟɧɧɟɝɨ ɪɵɧɤɚ ɨɬɟɱɟɫɬɜɟɧɧɵɦɢ ɤɪɭɩɹɧɵɦɢ ɩɪɨɞɭɤɬɚɦɢ, ɨɛɨɝɚɳɟɧɧɵɦɢ ɧɚɬɭɪɚɥɶɧɵɦɢ ɤɨɦɩɨɧɟɧɬɚɦɢ. Ɋɟɲɟɧɢɟ ɡɚɞɚɱ ɩɨ ɪɚɫɲɢɪɟɧɢɸ ɚɫɫɨɪɬɢɦɟɧɬɚ
ɢ ɩɨɜɵɲɟɧɢɸ ɩɢɬɚɬɟɥɶɧɨɣ ɰɟɧɧɨɫɬɢ ɤɪɭɩɹɧɵɯ ɩɪɨɞɭɤɬɨɜ ɧɟɜɨɡɦɨɠɧɨ ɛɟɡ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ ɢ
ɬɟɯɧɢɱɟɫɤɨɝɨ ɪɚɡɜɢɬɢɹ, ɨɫɧɨɜɚɧɧɨɝɨ ɧɚ ɧɚɭɱɧɵɯ ɞɨɫɬɢɠɟɧɢɹɯ.
ɇɚ ɫɟɝɨɞɧɹɲɧɢɣ ɞɟɧɶ ɧɚɛɥɸɞɚɟɬɫɹ ɞɟɮɢɰɢɬ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ (ɦɢɧɟɪɚɥɶɧɵɯ ɜɟɳɟɫɬɜ ɢ ɜɢɬɚɦɢɧɨɜ) ɜ ɩɢɬɚɧɢɢ ɧɚɫɟɥɟɧɢɹ, ɱɬɨ ɩɪɢɡɧɚɧɨ ɩɪɨɛɥɟɦɨɣ ɦɢɪɨɜɨɝɨ ɭɪɨɜɧɹ. ɗɬɨ ɹɜɥɟɧɢɟ ɜ ɧɚɫɬɨɹɳɟɟ
ɜɪɟɦɹ ɯɚɪɚɤɬɟɪɧɨ ɞɥɹ ɜɫɟɯ ɫɬɪɚɧ – ɨɬ Ⱥɮɪɢɤɢ ɢ Ⱥɡɢɢ ɞɨ ȿɜɪɨɩɵ ɢ Ⱥɦɟɪɢɤɢ. ȼ ɱɚɫɬɧɨɫɬɢ, ɧɟɞɨɫɬɚɬɨɤ ɠɟɥɟɡɚ ɢɫɩɵɬɵɜɚɸɬ ɛɨɥɶɲɟ 1 ɦɥɪɞ ɧɚɫɟɥɟɧɢɹ Ɂɟɦɥɢ, ɯɪɨɦɚ – ɞɨ 3,0 ɦɥɪɞ, ɦɟɞɢ – ɞɨ 3,8 ɦɥɪɞ,
ɰɢɧɤɚ – 4,5 ɦɥɪɞ ɉɨ ɨɩɪɟɞɟɥɟɧɢɸ ɷɤɫɩɟɪɬɨɜ ȼɈɁ, ɞɟɮɢɰɢɬ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ ɹɜɥɹɟɬɫɹ ɝɥɚɜɧɵɦ
ɤɪɢɡɢɫɨɦ ɜ ɩɢɬɚɧɢɢ ɧɚɫɟɥɟɧɢɹ Ɂɟɦɥɢ ɜ ɏɏȱ ɫɬɨɥɟɬɢɢ [4].
ɋɢɫɬɟɦɚ ɩɢɬɚɧɢɹ ɫɨɜɪɟɦɟɧɧɨɝɨ ɱɟɥɨɜɟɤɚ, ɩɪɨɰɟɫɫɵ ɝɥɨɛɚɥɢɡɚɰɢɢ, ɩɪɨɢɫɯɨɞɹɳɢɟ ɜ ɫɮɟɪɟ ɨɛɟɫɩɟɱɟɧɢɹ ɧɚɫɟɥɟɧɢɹ ɩɪɨɞɭɤɬɚɦɢ ɩɢɬɚɧɢɹ, ɩɪɟɨɛɪɚɡɨɜɚɧɢɟ ɜ ɭɫɥɨɜɢɹɯ ɷɤɨɧɨɦɢɱɟɫɤɨɝɨ ɤɪɢɡɢɫɚ ɤɚɱɟɫɬɜɚ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɜ ɤɚɬɟɝɨɪɢɸ ɫɭɝɭɛɨ ɷɤɨɧɨɦɢɱɟɫɤɭɸ ɫɨɡɞɚɸɬ ɫɟɪɶɟɡɧɵɟ ɩɪɨɛɥɟɦɵ ɜ ɩɢɬɚɧɢɢ ɧɚɫɟɥɟɧɢɹ. ɗɬɨ ɩɪɢɜɨɞɢɬ, ɜ ɩɟɪɜɭɸ ɨɱɟɪɟɞɶ, ɤ ɪɚɡɜɢɬɢɸ ɬɚɤ ɧɚɡɵɜɚɟɦɨɝɨ «ɫɤɪɵɬɨɝɨ ɝɨɥɨɞɚ»,
ɚ ɢɦɟɧɧɨ, ɞɟɮɢɰɢɬɚ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ: ɦɢɧɟɪɚɥɶɧɵɯ ɜɟɳɟɫɬɜ ɢ ɜɢɬɚɦɢɧɨɜ [5,6].
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ, ɜɨɡɧɢɤɚɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɫɨɯɪɚɧɟɧɢɹ ɭɪɨɜɧɹ ɩɨɬɪɟɛɥɟɧɢɹ ɧɟɡɚɦɟɧɢɦɵɯ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ, ɤɨɬɨɪɚɹ ɮɨɪɦɢɪɭɟɬ ɡɚɞɚɱɭ ɩɨɜɵɲɟɧɢɹ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ ɪɚɰɢɨɧɚ (food density).
Ɋɟɲɟɧɢɟ ɷɬɨɣ ɩɪɨɛɥɟɦɵ ɹɜɥɹɟɬɫɹ ɨɱɟɧɶ ɚɤɬɭɚɥɶɧɵɦ. ɇɚɢɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɦ ɫɩɨɫɨɛɨɦ ɭɥɭɱɲɟɧɢɹ ɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɧɚɫɟɥɟɧɢɹ ɦɢɤɪɨɧɭɬɪɢɟɧɬɚɦɢ ɜ ɨɛɳɟɝɨɫɭɞɚɪɫɬɜɟɧɧɨɦ ɦɚɫɲɬɚɛɟ ɹɜɥɹɟɬɫɹ
ɞɨɩɨɥɧɢɬɟɥɶɧɨɟ ɨɛɨɝɚɳɟɧɢɟ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɦɢɤɪɨɧɭɬɪɢɟɧɬɚɦɢ – ɩɭɬɶ, ɤɨɬɨɪɵɦ ɢɞɟɬ ɛɨɥɶɲɢɧɫɬɜɨ ɫɬɪɚɧ ɦɢɪɚ [7].
Ⱦɥɹ ɪɟɲɟɧɢɹ ɩɪɨɛɥɟɦ ɪɚɫɲɢɪɟɧɢɹ ɚɫɫɨɪɬɢɦɟɧɬɚ ɤɪɭɩɹɧɵɯ ɩɪɨɞɭɤɬɨɜ ɢ ɩɨɜɵɲɟɧɢɸ ɢɯ ɩɢɬɚɬɟɥɶɧɨɣ ɰɟɧɧɨɫɬɢ, ɚ ɬɚɤɠɟ ɞɥɹ ɫɧɢɠɟɧɢɹ ɢɦɩɨɪɬɚ ɢ ɧɚɫɵɳɟɧɢɹ ɨɬɟɱɟɫɬɜɟɧɧɨɝɨ ɪɵɧɤɚ ɤɪɭɩɹɧɵɦɢ
ɩɪɨɞɭɤɬɚɦɢ ɩɨɜɵɲɟɧɧɨɣ ɩɢɬɚɬɟɥɶɧɨɣ ɰɟɧɧɨɫɬɢ ɜ ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɟɪɟɪɚɛɨɬɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ» ɧɚɱɚɥɢɫɶ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɟ ɢɡɵɫɤɚɧɢɹ ɩɨ ɪɚɡɪɚɛɨɬɤɟ ɬɟɯɧɨɥɨɝɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɤɪɭɩ ɛɵɫɬɪɨɝɨ ɩɪɢɝɨɬɨɜɥɟɧɢɹ ɩɨɜɵɲɟɧɧɨɣ ɩɢɳɟɜɨɣ ɰɟɧɧɨɫɬɢ ɫ ɩɪɢɦɟɧɟɧɢɟɦ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ.
Ɋɟɡɭɥɶɬɚɬɵ ɞɚɧɧɨɣ ɪɚɛɨɬɵ ɩɨɡɜɨɥɹɬ ɩɨɜɵɫɢɬɶ ɫɬɟɩɟɧɶ ɢ ɝɥɭɛɢɧɭ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɨɜɨɝɨ ɫɵɪɶɹ,
ɤɨɦɩɥɟɤɫɧɨɟ ɟɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ, ɛɨɥɟɟ ɩɨɥɧɨɟ ɢɡɜɥɟɱɟɧɢɟ ɢɡ ɧɟɝɨ ɰɟɧɧɵɯ ɤɨɦɩɨɧɟɧɬɨɜ, ɪɚɫɲɢɪɢɬɶ ɧɨɦɟɧɤɥɚɬɭɪɭ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɧɚ ɨɫɧɨɜɟ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ, ɚ ɬɚɤɠɟ ɪɟɲɢɬɶ ɩɪɨɛɥɟɦɭ
ɞɟɮɢɰɢɬɚ ɦɢɤɪɨɧɭɬɪɢɟɧɬɨɜ ɜ ɩɢɬɚɧɢɢ ɧɚɫɟɥɟɧɢɹ Ʉɚɡɚɯɫɬɚɧɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
6.
7.
344
Ⱦɚɧɧɵɟ Ʉɨɦɢɬɟɬɚ ɩɨ ɫɬɚɬɢɫɬɢɤɟ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ http://www.stat.gov.kz
Ȼɟɡɨɬɯɨɞɧɵɟ ɬɟɯɧɨɥɨɝɢɢ ɩɟɪɟɪɚɛɨɬɤɢ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ// Ɋɟɫɩɭɛɥɢɤɚɧɫɤɨɟ ɢɧɮɨɪɦɚɰɢɨɧɧɨ-ɚɧɚɥɢɬɢɱɟɫɤɨɟ ɢɡɞɚɧɢɟ «ɄɚɡɚɯɁɟɪɧɨ.kz», ʋ 7 (81), 16 ɦɚɹ 2011 ɝ., ɫɬɪ. 4.;
ɉɪɨɛɥɟɦɵ ɤɪɭɩɹɧɨɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ Ʉɚɡɚɯɫɬɚɧɚ ɢ ɩɭɬɢ ɢɯ ɪɟɲɟɧɢɹ.// Ɇɚɬɟɪɢɚɥɵ ɪɟɫɩɭɛɥɢɤɚɧɫɤɨɣ
ɧɚɭɱɧɨ-ɩɪɚɤɬɢɱɟɫɤɨɣ ɤɨɧɮɟɪɟɧɰɢɢ «ȿɥ ɞɚɦɭɵɧɵԙ ɤɟɩɿɥɿ» 16–17 ɢɸɧɹ 2012 (368ɫɬɪ.)
Diet, nutrition and the prevention of chronic diseases. Report of a Joint WHO/FAO Expert Consultation. –
Geneva: WHO, 2003. – 149 ɪ. http: //whglibdoc. who.int/ trs/ WHO TRS 916. ɪdf.
ɋɩɢɪɢɱɟɜ ȼ.Ȼ., ɒɚɬɧɸɤ Ʌ.ɇ., ɉɨɡɧɹɤɨɜɫɤɢɣ ȼ. Ɇ. Ɉɛɨɝɚɳɟɧɢɟ ɩɢɳɟɜɵɯ ɩɪɨɞɭɤɬɨɜ ɦɢɤɪɨɧɭɬɪɢɟɧɬɚɦɢ
: ɧɚɭɱɧɵɟ ɩɨɞɯɨɞɵ ɢ ɩɪɚɤɬɢɱɟɫɤɢɟ ɪɟɲɟɧɢɹ // ɉɢɳɟɜɚɹ ɩɪɨɦɵɲɥɟɧɧɨɫɬɶ. – 2000. – ʋ 3. – ɋ. 10–16.
Ȼɚɰɭɤɨɜɚ ɇ.Ʌ., Ɏɢɥɨɧɨɜ ȼ.ɉ., Ⱥɜɟɬɢɫɨɜɚ Ⱥ.Ɋ. ɋɨɜɪɟɦɟɧɧɵɟ ɩɪɨɛɥɟɦɵ ɩɢɬɚɧɢɹ ɱɟɥɨɜɟɤɚ // Ɂɞɨɪɨɜɶɟ ɢ
ɨɤɪɭɠɚɸɳɚɹ ɫɪɟɞɚ. ȼɵɩ. 12. – Ɇɢɧɫɤ, 2008. – 8 ɫ.
ɇɨɜɢɧɸɤ Ʌ.ȼ. ɀɟɥɟɡɨɫɨɞɟɪɠɚɳɢɟ ɫɨɥɢ ɥɢɦɨɧɧɨɣ ɤɢɫɥɨɬɵ ɞɥɹ ɨɛɨɝɚɳɟɧɢɹ ɩɪɨɞɭɤɬɨɜ ɰɟɧɧɵɦɢ ɧɭɬɪɢɟɧɬɚɦɢ // ɉɢɳɟɜɵɟ ɢɧɝɪɟɞɢɟɧɬɵ: ɫɵɪɶɟ ɢ ɞɨɛɚɜɤɢ. – 2008. – ʋ 2. – ɋ.64-66.
ɂɇɎɈɊɆȺɐɂɈɇɇɕȿ ɌȿɏɇɈɅɈȽɂɂ
ȼ ȺȽɊɈɂɇȾɍɋɌɊɂɂ
ɍȾɄ 681.3 : 631.171 : 631.471
ɂɇɎɈɊɆȺɐɂɈɇɇɕȿ ɌȿɏɇɈɅɈȽɂɂ
ȼ ɂɇɇɈȼȺɐɂɈɇɇɈɆ ɊȺɁȼɂɌɂɂ ȺɉɄ
ȺɅɖɌ ȼ.ȼ.,
ɎȻȽɇɍ ɋɢɛɎɌɂ
Ɏɪɢɞɪɢɯ ɮɨɧ ɏɚɣɟɤ, ɨɞɢɧ ɢɡ ɜɵɞɚɸɳɢɯɫɹ ɷɤɨɧɨɦɢɫɬɨɜ ɢ ɮɢɥɨɫɨɮɨɜ ɏɏ ɜɟɤɚ, ɥɚɭɪɟɚɬ
ɇɨɛɟɥɟɜɫɤɨɣ ɩɪɟɦɢɢ 1974 ɝ. Ɉɧ ɭɬɜɟɪɠɞɚɥ, ɱɬɨ ɨɫɧɨɜɧɨɟ ɡɧɚɧɢɟ «ɪɚɫɫɟɹɧɨ» ɫɪɟɞɢ ɥɸɞɟɣ, ɤɚɠɞɵɣ
ɢɡ ɤɨɬɨɪɵɯ ɨɛɥɚɞɚɟɬ ɱɚɫɬɢɰɟɣ ɷɬɨɝɨ ɡɧɚɧɢɹ. ɏɚɣɟɤ ɨɬɜɟɪɝɚɟɬ ɜɨɡɦɨɠɧɨɫɬɶ ɧɚɥɢɱɢɹ ɭ ɤɚɠɞɨɝɨ ɢɧɞɢɜɢɞɭɭɦɚ ɩɨɥɧɨɣ ɢɧɮɨɪɦɚɰɢɢ – ɡɧɚɧɢɟ ɧɟɢɡɛɟɠɧɨ ɱɚɫɬɢɱɧɨ. ɉɨɷɬɨɦɭ ɜ ɩɨɜɟɞɟɧɱɟɫɤɨɦ ɚɫɩɟɤɬɟ
ɜ ɩɪɨɰɟɫɫɟ ɩɪɟɞɩɪɢɧɢɦɚɬɟɥɶɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɨɛɴɟɤɬɢɜɧɨ ɧɟɢɡɛɟɠɧɵ ɨɲɢɛɤɢ ɞɟɣɫɬɜɢɣ ɢɥɢ ɪɟɲɟɧɢɣ.
ɇɟɢɡɛɟɠɧɨɫɬɶ ɧɟ ɩɨɥɧɨɣ ɢɧɮɨɪɦɚɰɢɢ ɜ ɚɝɪɚɪɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ, ɧɚɭɤɟ ɢ ɨɛɪɚɡɨɜɚɧɢɢ ɭ ɤɚɠɞɨɝɨ
ɢɡ ɫɭɛɴɟɤɬɨɜ, ɩɪɢɧɢɦɚɸɳɢɯ ɭɩɪɚɜɥɟɧɱɟɫɤɢɟ ɪɟɲɟɧɢɹ ɨɛɴɟɤɬɢɜɧɨ ɫɜɹɡɚɧɚ ɫ ɩɨɥɢɮɭɧɤɰɢɨɧɚɥɶɧɵɦ ɯɚɪɚɤɬɟɪɨɦ ɨɛɴɟɤɬɨɜ ɭɩɪɚɜɥɟɧɢɹ: ɨɤɪɭɠɚɸɳɚɹ ɫɪɟɞɚ, ɡɟɦɥɹ, ɪɚɫɬɟɧɢɹ, ɠɢɜɨɬɧɵɟ ɢ ɦɚɲɢɧɵ.
ɗɬɢ ɨɛɴɟɤɬɵ ɦɨɠɧɨ ɩɪɟɞɫɬɚɜɢɬɶ ɤɚɤ ɩɹɬɶ ɪɚɡɧɨɜɢɞɧɨɫɬɟɣ ɪɟɫɭɪɫɨɜ, ɤɨɬɨɪɵɟ ɜɡɚɢɦɨɞɟɣɫɬɜɭɸɬ
ɩɨɞ ɜɨɡɞɟɣɫɬɜɢɟɦ ɟɳɺ ɞɜɭɯ ɪɟɫɭɪɫɨɜ – ɱɟɥɨɜɟɱɟɫɤɨɝɨ ɢ ɮɢɧɚɧɫɨɜɨɝɨ. ȼɫɺ ɷɬɨ ɦɨɠɧɨ ɩɪɟɞɫɬɚɜɢɬɶ
ɤɚɤ ɫɟɦɢɦɟɪɧɨɟ ɩɪɨɫɬɪɚɧɫɬɜɨ. ɉɪɢ ɷɬɨɦ ɱɟɥɨɜɟɤ, ɤɚɤ ɫɭɛɴɟɤɬ ɩɪɢɧɢɦɚɸɳɢɣ ɭɩɪɚɜɥɟɧɱɟɫɤɢɟ ɪɟɲɟɧɢɹ, ɨɳɭɳɚɸɳɢɣ ɱɟɬɵɪɺɯɦɟɪɧɨɟ ɩɪɨɫɬɪɚɧɫɬɜɨ (ɲɢɪɢɧɚ, ɞɥɢɧɧɚ, ɜɵɫɨɬɚ ɢ ɜɪɟɦɹ), ɧɚɯɨɞɹɫɶ ɜ
ɫɟɦɢɦɟɪɧɨɦ ɩɪɨɫɬɪɚɧɫɬɜɟ ɱɭɜɫɬɜɭɟɬ ɨɩɪɟɞɟɥɺɧɧɵɣ ɞɢɫɤɨɦɮɨɪɬ. ȼ ɬɚɤɨɣ ɫɢɬɭɚɰɢɢ ɫɭɛɴɟɤɬ ɩɪɢɧɢɦɚɸɳɢɣ ɭɩɪɚɜɥɟɧɱɟɫɤɢɟ ɪɟɲɟɧɢɹ ɜɵɧɭɠɞɟɧ ɩɪɢɧɢɦɚɬɶ ɱɚɫɬɧɵɟ ɪɟɲɟɧɢɹ, ɫɭɠɚɹ ɦɟɪɧɨɫɬɶ ɩɪɨɫɬɪɚɧɫɬɜɚ ɩɨɥɚɝɚɹ, ɱɬɨ ɧɟɤɨɬɨɪɵɟ ɢɡ ɪɟɫɭɪɫɨɜ ɧɟ ɫɭɳɟɫɬɜɟɧɧɵ ɢɥɢ ɛɟɡɝɪɚɧɢɱɧɵ. ɗɬɨ ɩɪɢɜɨɞɢɬ ɤ
ɩɪɢɧɹɬɢɸ ɱɟɥɨɜɟɤɨɦ ɧɟ ɩɨɥɢɨɩɬɢɦɚɥɶɧɨɦɭ ɪɟɲɟɧɢɸ ɜ ɫɥɟɞɫɬɜɢɢ ɧɟ ɩɨɥɧɨɝɨ ɡɧɚɧɢɹ. ɋɨɜɪɟɦɟɧɧɨɟ
ɪɚɡɜɢɬɢɟ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ ɯɚɪɚɤɬɟɪɢɡɭɟɬɫɹ ɮɨɪɦɢɪɨɜɚɧɢɟɦ ɢ
ɪɚɡɜɢɬɢɟɦ ɚɝɪɨɢɧɮɨɪɦɚɬɢɤɢ, ɤɚɤ ɫɢɫɬɟɦɨɨɛɪɚɡɭɸɳɟɣ ɨɬɪɚɫɥɢ ɡɧɚɧɢɣ ɜ ɫɢɦɛɢɨɡɟ ɫ ɬɚɤɢɦɢ ɬɪɚɞɢɰɢɨɧɧɵɦɢ ɞɥɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɧɚɭɤɢ ɩɪɟɞɦɟɬɧɵɦɢ ɨɬɪɚɫɥɹɦɢ ɤɚɤ: ɚɝɪɨɯɢɦɢɹ, ɩɨɱɜɨɜɟɞɟɧɢɟ, ɡɟɦɥɟɞɟɥɢɟ, ɫɟɥɟɤɰɢɹ, ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɨ, ɤɨɪɦɨɩɪɨɢɡɜɨɞɫɬɜɨ, ɠɢɜɨɬɧɨɜɨɞɫɬɜɨ, ɡɨɨɬɟɯɧɢɹ,
ɜɟɬɟɪɢɧɚɪɢɹ, ɦɟɯɚɧɢɡɚɰɢɹ, ɷɥɟɤɬɪɢɮɢɤɚɰɢɹ, ɚɜɬɨɦɚɬɢɡɚɰɢɹ ɢ ɷɤɨɧɨɦɢɤɚ [1].
ɋɧɢɠɟɧɢɟ ɭɞɟɥɶɧɵɯ ɦɚɬɟɪɢɚɥɶɧɵɯ ɡɚɬɪɚɬ ɢ ɷɤɨɥɨɝɢɱɟɫɤɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ ɧɚ ɩɪɢɪɨɞɭ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɧɚ ɫɨɜɪɟɦɟɧɧɨɦ ɷɬɚɩɟ ɪɚɡɜɢɬɢɹ ɨɛɳɟɫɬɜɚ ɡɚɞɚɱɚ ɩɟɪɜɨɫɬɟɩɟɧɧɨɣ ɜɚɠɧɨɫɬɢ. ɗɬɢ ɨɛɟ ɡɚɞɚɱɢ ɦɧɨɝɨɩɥɚɧɨɜɵ, ɢ, ɤɚɤ ɩɪɚɜɢɥɨ, ɩɪɨɬɢɜɨɪɟɱɢɜɵ. ɉɪɢɦɟɧɟɧɢɟ
ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɩɪɢ ɪɟɲɟɧɢɢ ɦɧɨɝɨɤɪɢɬɟɪɢɚɥɶɧɵɯ ɡɚɞɚɱ ɩɨɡɜɨɥɹɟɬ ɧɚɣɬɢ ɩɨɥɢɨɩɬɢɦɚɥɶɧɵɟ ɪɟɲɟɧɢɹ ɜ ɦɧɨɝɨɦɟɪɧɨɦ ɩɪɨɫɬɪɚɧɫɬɜɟ ɚɪɝɭɦɟɧɬɨɜ, ɮɭɧɤɰɢɣ ɢ ɮɭɧɤɰɢɨɧɚɥɨɜ, ɢɦɟɸɳɢɯ ɦɟɫɬɨ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ.
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɫɥɨɠɢɥɚɫɶ ɞɨɜɨɥɶɧɨ ɱɟɬɤɨɟ ɩɨɧɢɦɚɧɢɟ ɩɪɟɞɦɟɬɧɨɣ ɢ ɫɢɫɬɟɦɨɨɛɪɚɡɭɸɳɟɣ
ɨɬɪɚɫɥɢ ɡɧɚɧɢɣ ɢ ɢɯ ɪɨɥɢ ɜ ɮɨɪɦɢɪɨɜɚɧɢɢ ɜɚɥɨɜɨɝɨ ɜɧɭɬɪɟɧɧɟɝɨ ɩɪɨɞɭɤɬɚ (ȼȼɉ). ɉɪɟɞɦɟɬɧɵɟ
ɧɚɭɤɢ ɨɩɪɟɞɟɥɹɸɬ ɩɟɪɫɩɟɤɬɢɜɵ ɪɚɡɜɢɬɢɹ ɤɨɧɤɪɟɬɧɵɯ ɨɬɪɚɫɥɟɣ ɢ ɹɜɥɹɸɬɫɹ ɨɫɧɨɜɧɵɦɢ ɝɟɧɟɪɚɬɨɪɚɦɢ ɢɯ ɪɚɡɜɢɬɢɹ ɢ ɤɚɱɟɫɬɜɟɧɧɨɝɨ ɪɨɫɬɚ. ɂɧɮɨɪɦɚɰɢɨɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ – ɷɬɨ ɜ ɨɩɪɟɞɟɥɺɧɧɨɦ
ɩɨɧɢɦɚɧɢɢ ɫɢɫɬɟɦɧɵɟ ɡɧɚɧɢɹ ɦɟɠɨɬɪɚɫɥɟɜɨɝɨ ɯɚɪɚɤɬɟɪɚ, ɧɚɩɪɚɜɥɟɧɧɵɟ ɧɚ ɫɨɡɞɚɧɢɟ ɞɨɛɚɜɨɱɧɨɣ
ɫɬɨɢɦɨɫɬɢ ɜ ɨɬɪɚɫɥɹɯ, ɤɚɤ ɧɚ ɨɬɪɚɫɥɟɜɨɦ, ɬɚɤ ɢ ɧɚ ɦɟɠɨɬɪɚɫɥɟɜɨɦ ɭɪɨɜɧɹɯ.
ɇɟ ɫɥɟɞɭɟɬ ɨɬɨɠɟɫɬɜɥɹɬɶ ɢɧɮɨɪɦɚɰɢɨɧɧɭɸ ɬɟɯɧɨɥɨɝɢɸ ɫ ɬɟɯɧɨɥɨɝɢɟɣ (ɹɦɢ) ɢɧɮɨɪɦɚɬɢɤɢ.
Ɍɟɯɧɨɥɨɝɢɹ ɢɧɮɨɪɦɚɬɢɤɢ ɹɜɥɹɟɬɫɹ ɥɢɲɶ ɱɚɫɬɶɸ ɢɧɮɨɪɦɚɰɢɨɧɧɨɣ ɬɟɯɧɨɥɨɝɢ [2], ɬɚɤ ɤɚɤ ɩɨɫɥɟɞɧɹɹ – ɷɬɨ ɨɬɪɚɫɥɶ ɡɧɚɧɢɣ, ɚ ɩɟɪɜɚɹ – ɫɨɜɨɤɭɩɧɨɫɬɶ ɩɪɢɟɦɨɜ (ɜ ɬ. ɱ. ɤɨɦɩɶɸɬɟɪɧɵɟ ɩɪɨɝɪɚɦɦɵ) ɢ
ɫɪɟɞɫɬɜ (ɩɪɢɛɨɪɨɜ, ɢɧɮɨɪɦɚɰɢɨɧɧɨ-ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɫɢɫɬɟɦ, ɤɨɦɩɶɸɬɟɪɨɜ ɢ ɬ.ɞ.).
Ɇɵ ɪɚɡɞɟɥɹɟɦ ɩɨ ɚɧɚɥɨɝɢɢ ɩɨɞɯɨɞɵ ɤ ɚɝɪɨɢɧɮɨɪɦɚɬɢɤɟ ɢ ɤ ɚɝɪɨɢɧɮɨɪɦɚɰɢɨɧɧɵɦ ɬɟɯɧɨɥɨɝɢɹɦ. ɗɬɢɦ ɩɨɞɱɺɪɤɢɜɚɟɬɫɹ ɨɬɪɚɫɥɟɜɨɣ ɯɚɪɚɤɬɟɪ ɚɝɪɨɢɧɮɨɪɦɚɬɢɤɢ ɜ ɨɛɳɟɣ ɫɢɫɬɟɦɟ ɢɧɮɨɪɦɚɬɢɤɢ,
ɫɜɹɡɚɧɧɵɣ ɫ ɟɞɢɧɫɬɜɨɦ ɨɛɴɟɤɬɨɜ ɪɚɫɫɦɨɬɪɟɧɢɹ ɜ ɚɝɪɚɪɧɨɣ ɫɮɟɪɟ. ȼ ɨɛɨɛɳɟɧɧɨɦ ɜɢɞɟ ɜ ɚɝɪɚɪɧɨɣ
ɫɮɟɪɟ ɜ ɤɚɱɟɫɬɜɟ ɨɛɴɟɤɬɨɜ ɜɵɫɬɭɩɚɸɬ: ɡɟɦɥɹ, ɪɚɫɬɟɧɢɹ, ɠɢɜɨɬɧɵɟ, ɦɚɲɢɧɵ ɢ ɨɤɪɭɠɚɸɳɚɹ ɫɪɟɞɚ.
ɉɪɟɞɦɟɬɧɵɟ ɨɬɪɚɫɥɢ ɡɧɚɧɢɣ ɚɝɪɚɪɧɵɯ (ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ) ɧɚɭɤ ɢɡɭɱɚɸɬ ɩɪɨɰɟɫɫɵ, ɩɪɨɬɟɤɚɸɳɢɟ ɜ ɨɛɴɟɤɬɚɯ ɚɝɪɚɪɧɨɣ ɫɮɟɪɵ, ɚ ɬɚɤɠɟ ɩɪɨɰɟɫɫɵ ɢɯ ɜɡɚɢɦɨɞɟɣɫɬɜɢɣ.
345
Ɋɟɲɟɧɢɟ ɡɚɞɚɱ ɫɢɫɬɟɦɚɬɢɡɚɰɢɢ ɡɧɚɧɢɣ,
ɞɚɧɧɵɯ ɢ ɜɵɹɜɥɟɧɢɟ ɡɚɤɨɧɨɦɟɪɧɨɫɬɟɣ ɫɭɳɟɫɬɜɨɜɚɧɢɹ ɨɛɴɟɤɬɨɜ ɠɢɜɨɣ ɢ ɧɟɠɢɜɨɣ
ɩɪɢɪɨɞɵ ɯɚɪɚɤɬɟɪɧɨ ɞɥɹ ɛɨɥɶɲɢɧɫɬɜɚ
ɩɪɟɞɦɟɬɧɵɯ ɨɬɪɚɫɥɟɣ, ɧɨ ɬɨɥɶɤɨ ɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɣ ɫɢɫɬɟɦɟ ɨɧɢ ɨɛɴɟɞɢɧɹɸɬɫɹ ɧɚ ɞɢɚɥɟɤɬɢɱɟɫɤɨɣ
ɨɛɳɧɨɫɬɢ ɨɛɴɟɤɬɨɜ – ɡɟɦɥɹ, ɪɚɫɬɟɧɢɹ, ɠɢɜɨɬɧɵɟ, ɦɚɲɢɧɵ ɢ, ɤɨɧɟɱɧɨ ɠɟ, ɫɪɟɞɚ ɢɯ
ɫɭɳɟɫɬɜɨɜɚɧɢɹ. ɂɧɮɨɪɦɚɰɢɨɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ ɜ ɚɝɪɚɪɧɨɣ ɫɮɟɪɟ ɞɨɥɠɧɵ ɫɨɡɞɚɜɚɬɶɫɹ ɧɟ ɬɨɥɶɤɨ ɫ ɭɱɺɬɨɦ ɞɢɚɥɟɤɬɢɱɟɫɤɨɣ ɨɛɊɢɫ. 1. ɋɯɟɦɚɬɢɱɟɫɤɨɟ ɢɡɨɛɪɚɠɟɧɢɟ ɫɜɹɡɟɣ ɨɛɴɟɤɬɨɜ
ɳɧɨɫɬɢ ɨɛɴɟɤɬɨɜ, ɧɨ ɢ ɫ ɨɛɹɡɚɬɟɥɶɧɵɦ
ɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ,
ɭɱɺɬɨɦ ɩɟɪɟɤɪɺɫɬɧɵɯ ɜɡɚɢɦɧɵɯ ɫɜɹɡɟɣ ɢ
ɨɬɪɚɠɚɸɳɢɯ ɢɯ ɞɢɚɥɟɤɬɢɱɟɫɤɭɸ ɨɛɳɧɨɫɬɶ
ɜɡɚɢɦɨɜɥɢɹɧɢɹ ɷɬɢɯ ɨɛɴɟɤɬɨɜ (ɪɢɫ. 1).
Ɉɩɪɟɞɟɥɟɧɢɹ ɢɧɮɨɪɦɚɰɢɨɧɧɨɣ ɬɟɯɧɨɥɨɝɢɢ ɤɚɤ ɛɵ ɩɨɞɫɩɭɞɧɨ ɡɚɪɚɧɟɟ ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬ ɩɪɢɦɟɧɟɧɢɟ ɤɨɦɩɶɸɬɟɪɚ ɤɚɤ ɫɪɟɞɫɬɜɚ ɪɟɚɥɢɡɚɰɢɢ ɷɬɢɯ ɬɟɯɧɨɥɨɝɢɣ ɢ ɢɧɫɬɪɭɦɟɧɬɚɪɢɹ ɞɥɹ ɨɛɪɚɛɨɬɤɢ ɢɧɮɨɪɦɚɰɢɢ. ɋɨɜɪɟɦɟɧɧɵɣ ɤɨɦɩɶɸɬɟɪ
ɜɨ ɜɫɟɣ ɫɨɜɨɤɭɩɧɨɫɬɢ ɩɪɨɝɪɚɦɦɧɵɯ ɢ ɬɟɯɧɢɱɟɫɤɢɯ ɤɨɦɩɨɧɟɧɬɨɜ – ɷɬɨ ɭɧɢɜɟɪɫɚɥɶɧɵɣ ɤɨɦɩɥɟɤɫ
ɩɨ ɪɟɲɟɧɢɸ ɦɚɬɟɦɚɬɢɱɟɫɤɢɯ, ɮɭɧɤɰɢɨɧɚɥɶɧɵɯ, ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɢ ɧɚɬɭɪɚɥɶɧɵɯ (ɜ ɜɢɪɬɭɚɥɶɧɨɦ
ɜɢɞɟ) ɦɨɞɟɥɟɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɢ ɨɛɴɟɤɬɨɜ ɠɢɜɨɣ ɢ ɧɟɠɢɜɨɣ ɩɪɢɪɨɞɵ, ɩɨɡɜɨɥɹɸɳɢɣ
ɨɫɭɳɟɫɬɜɢɬɶ ɢɦɢɬɚɰɢɨɧɧɨɟ ɦɨɞɟɥɢɪɨɜɚɧɢɟ. ȼɨɩɪɨɫɵ ɤɨɦɩɶɸɬɟɪɧɨɝɨ ɦɨɞɟɥɢɪɨɜɚɧɢɹ ɦɵ ɪɚɫɫɦɚɬɪɢɜɚɟɦ ɩɪɢ ɪɟɲɟɧɢɢ ɡɚɞɚɱ ɢɧɠɟɧɟɪɧɨɝɨ ɦɨɞɟɥɢɪɨɜɚɧɢɹ ɢ ɩɪɢ ɫɨɡɞɚɧɢɢ ɛɚɡ ɞɚɧɧɵɯ, ɢ ɷɤɫɩɟɪɬɧɵɯ
ɫɢɫɬɟɦ. ɂɦɢɬɚɰɢɨɧɧɵɟ ɦɨɞɟɥɢ ɫɨɟɞɢɧɢɥɢ ɜ ɫɟɛɟ ɦɚɬɟɦɚɬɢɱɟɫɤɢɟ, ɮɭɧɤɰɢɨɧɚɥɶɧɵɟ ɢ ɢɧɮɨɪɦɚɰɢɨɧɧɵɟ ɦɨɞɟɥɢ ɜ ɟɞɢɧɨɦ ɚɥɝɨɪɢɬɦɢɱɟɫɤɨɦ ɢ ɩɪɨɝɪɚɦɦɧɨɦ ɩɪɨɫɬɪɚɧɫɬɜɟ. Ʉɨɦɩɶɸɬɟɪɧɨɟ ɦɨɞɟɥɢɪɨɜɚɧɢɟ ɫɬɚɥɨ ɟɞɢɧɫɬɜɟɧɧɵɦ ɫɩɨɫɨɛɨɦ ɤɨɦɩɥɟɤɫɧɨɝɨ ɦɨɞɟɥɢɪɨɜɚɧɢɹ, ɫɨɟɞɢɧɢɜɲɟɟ ɜɫɸ ɫɨɜɨɤɭɩɧɨɫɬɶ ɜɨɡɦɨɠɧɵɯ ɦɨɞɟɥɟɣ, ɩɨɡɜɨɥɹɸɳɢɯ ɦɨɞɟɥɢɪɨɜɚɬɶ, ɫɨɡɞɚɜɚɬɶ ɢ ɩɪɨɜɨɞɢɬɶ ɦɨɧɢɬɨɪɢɧɝ
ɨɛɴɟɤɬɨɜ ɩɪɢɪɨɞɵ ɜɨ ɜɫɺɦ ɢɯ ɠɢɡɧɟɧɧɨɦ [1].
Ⱦɨɫɬɢɝɧɭɬɵɣ ɭɪɨɜɟɧɶ ɤɨɦɩɶɸɬɟɪɢɡɚɰɢɢ ɫɬɚɜɢɬ ɩɟɪɟɞ ɧɚɭɤɨɣ ɡɚɞɚɱɭ ɩɨ ɫɨɡɞɚɧɢɸ ɤɨɪɩɨɪɚɬɢɜɧɨɣ ɫɟɬɢ ɢ ɫɨɡɞɚɧɢɸ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɩɪɨɞɭɤɬɨɜ ɞɥɹ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɹ ɤɨɪɩɨɪɚɬɢɜɧɨɣ ɫɪɟɞɵ
ɤɚɤ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɤɨɧɫɭɥɶɬɚɰɢɨɧɧɨɝɨ ɤɨɦɩɶɸɬɟɪɧɨɝɨ ɩɪɨɫɬɪɚɧɫɬɜɚ ɞɥɹ ɫɟɥɶɯɨɡɬɨɜɚɪɨɩɪɨɢɡɜɨɞɢɬɟɥɟɣ ɋɢɛɢɪɫɤɨɝɨ ɮɟɞɟɪɚɥɶɧɨɝɨ ɨɤɪɭɝɚ. Ɋɟɲɟɧɢɟ ɡɚɞɚɱ ɩɨɢɫɤɚ ɢɧɧɨɜɚɰɢɨɧɧɵɯ ɩɪɟɞɥɨɠɟɧɢɣ
ɦɨɠɟɬ ɪɟɲɚɬɶɫɹ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɢɧɬɟɪɧɟɬɨɪɟɧɬɢɪɨɜɚɧɧɵɯ ɛɚɧɤɨɜ ɢ ɛɚɡ ɞɚɧɧɵɯ ɧɨɜɚɰɢɨɧɧɵɯ
ɪɚɡɪɚɛɨɬɨɤ ɢ ɩɟɪɟɞɨɜɨɝɨ ɨɩɵɬɚ (ɬɟɯɧɨɥɨɝɢɢ, ɤɚɞɪɵ ɞɥɹ ɧɨɜɵɯ ɬɟɯɧɨɥɨɝɢɣ ɢ ɦɚɲɢɧ, ɫɨɪɬɚ, ɩɨɪɨɞɵ, ɦɚɲɢɧɵ, ɩɪɢɛɨɪɵ, ɤɨɦɩɶɸɬɟɪɧɵɟ ɩɪɨɝɪɚɦɦɵ ɢ ɬ.ɞ.). ȼ ɪɚɦɤɚɯ ɪɟɲɟɧɢɹ ɷɬɢɯ ɡɚɞɚɱ ɧɟɨɛɯɨɞɢɦɨ ɫɨɡɞɚɬɶ ɦɟɯɚɧɢɡɦɵ ɢɧɧɨɜɚɰɢɨɧɧɨɝɨ ɪɚɡɜɢɬɢɹ (ɮɢɧɚɧɫɨɜɵɟ, ɩɪɚɜɨɜɵɟ ɢ ɞɪɭɝɢɟ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɜɟɧɱɭɪɧɵɯ ɮɨɧɞɨɜ, ɝɪɚɧɬɨɜ, ɤɪɟɞɢɬɧɵɯ ɢɧɫɬɪɭɦɟɧɬɨɜ ɢ ɬ.ɞ.). Ɋɚɡɪɚɛɨɬɤɚ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ
ɫɨɩɪɨɜɨɠɞɟɧɢɹ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɜ ɰɟɥɨɦ ɧɟ ɬɨɥɶɤɨ ɧɟ ɫɭɠɚɟɬ ɡɚɞɚɱɢ ɩɨɢɫɤɚ
ɨɩɬɢɦɚɥɶɧɵɯ ɪɟɲɟɧɢɣ, ɚ ɧɚɨɛɨɪɨɬ ɧɟɫɪɚɜɧɟɧɧɨ ɪɚɫɲɢɪɹɟɬ ɩɨɢɫɤ ɦɧɨɝɨɤɪɢɬɟɪɢɚɥɶɧɨɝɨ ɨɩɬɢɦɭɦɚ. Ɍɚɤɨɣ ɩɨɞɯɨɞ ɩɨɡɜɨɥɢɬ ɦɢɧɢɦɢɡɢɪɨɜɚɬɶ ɷɤɨɥɨɝɢɱɟɫɤɢɟ ɢɡɞɟɪɠɤɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɢ ɫɨɤɪɚɬɢɬɶ ɧɚ 20…30 % ɡɚɬɪɚɬɵ ɧɚ ɟɞɢɧɢɰɭ ɩɪɨɞɭɤɰɢɢ [3].
ɂɧɮɨɪɦɚɰɢɨɧɧɵɟ ɦɟɬɨɞɵ ɢ ɬɟɥɟɤɨɦɦɭɧɢɤɚɰɢɨɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ, ɩɟɪɟɯɨɞ ɤ ɲɢɪɨɤɨɦɚɫɲɬɚɛɧɨɦɭ ɩɪɢɦɟɧɟɧɢɸ ɫɨɜɪɟɦɟɧɧɵɯ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɫɢɫɬɟɦ ɜ ɫɮɟɪɚɯ ɧɚɭɤɢ, ɨɛɪɚɡɨɜɚɧɢɹ, ɩɪɨɢɡɜɨɞɫɬɜɚ ɢ ɛɢɡɧɟɫɚ ɨɛɟɫɩɟɱɢɜɚɸɬ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɧɨɜɵɣ ɭɪɨɜɟɧɶ ɩɨɥɭɱɟɧɢɹ ɢ ɨɛɨɛɳɟɧɢɹ ɡɧɚɧɢɣ, ɢɯ
ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ. ɗɬɢ ɩɪɨɰɟɫɫɵ ɦɨɠɧɨ ɯɚɪɚɤɬɟɪɢɡɨɜɚɬɶ ɤɚɤ ɫɦɟɧɭ ɩɚɪɚɞɢɝɦɵ ɜ
ɩɪɨɮɟɫɫɢɨɧɚɥɶɧɨɦ ɦɢɪɨɜɨɡɪɟɧɢɢ ɫɩɟɰɢɚɥɢɫɬɨɜ, ɫɜɹɡɚɧɧɭɸ ɫ ɧɚɪɚɫɬɚɸɳɢɦɢ ɬɟɧɞɟɧɰɢɹɦɢ ɢɧɬɟɝɪɚɰɢɢ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɨɣ, ɩɟɞɚɝɨɝɢɱɟɫɤɨɣ, ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɨɣ ɢ ɤɨɦɦɟɪɱɟɫɤɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ. ȿɫɥɢ ɜ ɧɟɞɚɥɺɤɨɦ ɩɪɨɲɥɨɦ ɫɱɢɬɚɥɨɫɶ, ɱɬɨ ɢɧɮɨɪɦɚɰɢɨɧɧɵɟ
ɬɟɯɧɨɥɨɝɢɢ ɨɯɜɚɬɵɜɚɸɬ ɬɨɥɶɤɨ ɚɧɚɥɢɡ ɬɚɛɥɢɱɧɨɝɨ ɢɫɯɨɞɧɨɝɨ ɦɚɬɟɪɢɚɥɚ, ɬɨ ɫɟɝɨɞɧɹ ɫɬɚɥɨ ɜɨɡɦɨɠɧɵɦ ɜɟɫɬɢ ɚɧɚɥɢɡ ɢ ɫɢɧɬɟɡ ɥɢɧɝɜɢɫɬɢɱɟɫɤɨɝɨ ɦɚɬɟɪɢɚɥɚ ɢ ɢɡɨɛɪɚɠɟɧɢɣ ɠɢɜɨɣ ɢ ɧɟɠɢɜɨɣ ɦɚɬɟɪɢɢ
[3,4,5,6,7]. ɗɬɢ ɞɨɫɬɢɠɟɧɢɹ ɜ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɹɯ ɫɨɜɟɪɲɟɧɧɨ ɦɟɧɹɸɬ ɦɟɫɬɨ ɢɧɮɨɪɦɚɬɢɤɢ ɤɚɤ ɧɚɭɤɢ ɩɪɢ ɩɪɨɜɟɞɟɧɢɢ ɫɢɫɬɟɦɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɢ ɪɟɲɟɧɢɢ ɤɚɤ ɧɚɭɱɧɵɯ, ɬɚɤ ɢ ɱɢɫɬɨ
ɩɪɚɤɬɢɱɟɫɤɢɯ ɡɚɞɚɱ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ.
Ƚɢɩɨɬɟɬɢɱɟɫɤɚɹ ɜɨɡɦɨɠɧɨɫɬɶ ɬɚɤɨɝɨ ɪɟɲɟɧɢɹ ɡɚɥɨɠɟɧɚ ɫɚɦɨɣ ɨɛɳɧɨɫɬɶɸ ɨɛɴɟɤɬɨɜ ɢɫɫɥɟɞɨɜɚɧɢɣ ɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɧɚɭɤɟ ɢ ɨɛɴɟɤɬɨɜ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɜ ɚɝɪɚɪɧɨɦ ɩɪɨɢɡɜɨɞɫɬɜɟ (ɪɢɫ. 1).
ɇɚɦɢ ɩɪɟɞɥɨɠɟɧɚ ɩɚɪɚɞɢɝɦɚ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ (ɪɢɫɭɧɨɤ 2). ɉɚɪɚɞɢɝɦɚ, ɤɚɤ ɫɨɜɨɤɭɩɧɨɫɬɶ ɜɡɝɥɹɞɨɜ ɧɚ ɪɟɲɟɧɢɟ
ɤɚɤɨɣ–ɥɢɛɨ ɡɚɞɚɱɢ ɧɚ ɫɨɜɪɟɦɟɧɧɨɦ ɷɬɚɩɟ ɪɚɡɜɢɬɢɹ, ɩɨɤɚɡɵɜɚɟɬ ɩɭɬɢ ɢ ɩɨɞɯɨɞɵ ɤ ɫɨɡɞɚɧɢɸ ɢɡɦɟɪɢɬɟɥɶɧɵɯ ɩɪɢɛɨɪɨɜ, ɢɡɦɟɪɢɬɟɥɶɧɨ-ɜɵɱɢɫɥɢɬɟɥɶɧɵɯ ɤɨɦɩɥɟɤɫɨɜ, ɢɧɮɨɪɦɚɰɢɨɧɧɨ-ɢɡɦɟɪɢɬɟɥɶ346
ɧɵɯ ɫɢɫɬɟɦ, ɛɚɡ ɞɚɧɧɵɯ ɢ ɛɚɡ ɡɧɚɧɢɣ, ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ ɢ ɫɢɫɬɟɦ ɢɫɤɭɫɫɬɜɟɧɧɨɝɨ ɢɧɬɟɥɥɟɤɬɚ.
ɉɚɪɚɞɢɝɦɚ ɨɯɜɚɬɵɜɚɟɬ ɜɫɺ ɦɧɨɝɨɨɛɪɚɡɢɟ ɢɧɮɨɪɦɚɰɢɢ, ɯɚɪɚɤɬɟɪɢɡɭɸɳɟɣ ɨɛɴɟɤɬ: ɢɡɦɟɪɢɬɟɥɶɧɚɹ,
ɷɜɪɢɫɬɢɱɟɫɤɚɹ, ɜ ɜɢɞɟ ɧɚɛɥɸɞɚɟɦɵɯ ɩɟɪɟɦɟɧɧɵɯ ɢ ɡɧɚɧɢɣ ɷɤɫɩɟɪɬɨɜ. ɂɡɦɟɪɢɬɟɥɶɧɵɟ ɩɪɢɛɨɪɵ,
ɢɡɦɟɪɢɬɟɥɶɧɨ-ɜɵɱɢɫɥɢɬɟɥɶɧɵɟ ɤɨɦɩɥɟɤɫɵ, ɢɧɮɨɪɦɚɰɢɨɧɧɨ-ɢɡɦɟɪɢɬɟɥɶɧɵɟ ɫɢɫɬɟɦɵ ɹɜɥɹɸɬɫɹ ɫɨɫɬɚɜɧɨɣ ɱɚɫɬɶɸ ɫɪɟɞɫɬɜ, ɢɫɩɨɥɶɡɭɟɦɵɯ ɩɪɢ ɫɨɡɞɚɧɢɢ ɢ ɩɪɢɦɟɧɟɧɢɢ ɬɟɯɧɨɥɨɝɢɣ ɢɧɮɨɪɦɚɬɢɡɚɰɢɢ,
ɧɨ ɜ ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɨɦ ɩɥɚɧɟ ɢɯ ɪɚɫɫɦɨɬɪɟɧɢɟ ɜɵɯɨɞɢɬ ɡɚ ɪɚɦɤɢ ɧɚɫɬɨɹɳɟɣ ɫɬɚɬɶɢ. ɉɚɪɚɞɢɝɦɨɣ
ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬɫɹ ɜɤɥɸɱɟɧɢɟ ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ ɢ ɫɢɫɬɟɦ ɢɫɤɭɫɫɬɜɟɧɧɨɝɨ ɢɧɬɟɥɥɟɤɬɚ ɜ ɫɨɫɬɚɜ
ɭɩɪɚɜɥɹɸɳɟɝɨ ɡɜɟɧɚ ɩɭɬɺɦ ɜɵɪɚɛɨɬɤɢ ɡɚɤɥɸɱɟɧɢɹ ɞɥɹ ɫɢɫɬɟɦ ɩɪɢɧɹɬɢɹ ɭɩɪɚɜɥɟɧɱɟɫɤɢɯ ɪɟɲɟɧɢɣ
(ɋɉɍɊ). Ɍɚɤɨɣ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɣ ɦɟɬɨɞ ɭɩɪɚɜɥɟɧɢɹ ɩɨɡɜɨɥɹɟɬ ɩɟɪɟɣɬɢ ɤ ɭɩɪɚɜɥɟɧɢɸ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦɢ ɩɪɨɰɟɫɫɚɦɢ (ɜ ɩɨɱɜɟ, ɪɚɫɬɟɧɢɹɯ, ɠɢɜɨɬɧɵɯ, ɦɚɲɢɧɚɯ, ɫɨɰɢɚɥɶɧɨ-ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɨɬɧɨɲɟɧɢɹɯ ɢ ɬ.ɞ.) ɧɟ ɩɨ ɨɬɤɥɨɧɟɧɢɸ ɤɚɤɨɝɨ-ɬɨ ɢɡ ɩɚɪɚɦɟɬɪɨɜ ɢɥɢ ɝɪɭɩɩɵ ɩɚɪɚɦɟɬɪɨɜ ɨɬ ɩɪɢɧɹɬɨɣ
ɧɨɪɦɵ, ɚ ɜ ɫɨɨɬɜɟɬɫɬɜɢɢ ɫ ɮɭɧɤɰɢɟɣ ɧɚɡɧɚɱɟɧɢɹ ɨɛɴɟɤɬɚ ɭɩɪɚɜɥɟɧɢɹ. Ɉɞɧɨɜɪɟɦɟɧɧɨ ɤ ɨɛɴɟɤɬɭ ɭɩɪɚɜɥɟɧɢɹ ɛɭɞɭɬ ɩɪɢɦɟɧɟɧɵ ɨɝɪɚɧɢɱɟɧɢɹ, ɧɚɤɥɚɞɵɜɚɟɦɵɟ ɷɤɨɥɨɝɢɱɟɫɤɨɣ ɨɛɫɬɚɧɨɜɤɨɣ, ɫɟɡɨɧɧɵɦ
ɯɚɪɚɤɬɟɪɨɦ ɪɚɛɨɬ, ɜɡɚɢɦɧɵɦ ɜɥɢɹɧɢɟɦ ɫɨɫɬɚɜɥɹɸɳɢɯ ɨɛɴɟɤɬɚ, ɯɚɪɚɤɬɟɪɨɦ ɜɨɡɞɟɣɫɬɜɢɹ ɜɧɟɲɧɢɯ
ɮɚɤɬɨɪɨɜ ɧɚ ɨɛɴɟɤɬ ɭɩɪɚɜɥɟɧɢɹ [5, 6].
ɋɢɧɬɟɡ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɫɢɫɬɟɦ ɜɨ ɦɧɨɝɨɦ ɨɩɪɟɞɟɥɹɟɬɫɹ ɦɨɞɟɥɹɦɢ ɨɛɴɟɤɬɨɜ. ɂɫɯɨɞɹ ɢɡ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɫɨɡɞɚɧɢɹ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɫɢɫɬɟɦ (ɛɚɡɵ ɞɚɧɧɵɯ ɢ ɡɧɚɧɢɣ, ɷɤɫɩɟɪɬɧɵɟ ɫɢɫɬɟɦɵ ɢ
ɫɢɫɬɟɦɵ ɢɫɤɭɫɫɬɜɟɧɧɨɝɨ ɢɧɬɟɥɥɟɤɬɚ, ɫɦ. ɪɢɫɭɧɨɤ 2) ɧɟɨɛɯɨɞɢɦɨ ɫɨɡɞɚɧɢɟ ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɯ ɦɨɞɟɥɟɣ ɜ ɩɪɟɞɦɟɬɧɵɯ ɨɛɥɚɫɬɹɯ ɡɧɚɧɢɣ ɫɨɱɟɬɚɸɳɢɯ ɢɧɮɨɪɦɚɰɢɨɧɧɵɟ ɢ ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɟ ɦɨɞɟɥɢ. ɋɥɟɞɭɟɬ ɨɬɦɟɬɢɬɶ ɨɫɨɛɭɸ ɪɨɥɶ ɪɟɥɹɰɢɨɧɧɵɯ ɦɨɞɟɥɟɣ ɤɚɤ ɤɥɚɫɫɚ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɦɨɞɟɥɟɣ.
Ɋɟɥɹɰɢɨɧɧɚɹ ɦɨɞɟɥɶ ɜɩɟɪɜɵɟ ɩɪɟɞɥɨɠɟɧɚ ɗ.Ɏ. Ʉɨɞɞɨɦ (E. F. Codd) ɜ 1970 ɝɨɞɭ [9]. Ⱦɪɭɝɨɣ ɤɥɚɫɫ
ɦɨɞɟɥɟɣ ɨɫɧɨɜɵɜɚɟɬɫɹ ɧɚ ɤɨɦɩɢɥɹɰɢɢ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɢ ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɯ ɦɨɞɟɥɟɣ. Ȼɨɥɟɟ ɜɵɫɨɤɢɣ ɭɪɨɜɟɧɶ – ɷɬɨ ɢɦɢɬɚɰɢɨɧɧɵɟ ɦɨɞɟɥɢ, ɨɛɴɟɞɢɧɹɸɳɢɟ ɦɚɬɟɦɚɬɢɱɟɫɤɢɟ, ɢɧɮɨɪɦɚɰɢɨɧɧɵɟ ɢ
ɦɨɪɮɨɥɨɝɢɱɟɫɤɢɟ ɦɨɞɟɥɢ.
ȼ Ƚɇɍ ɋɢɛɎɌɂ ɪɚɡɪɚɛɨɬɚɧ ɪɹɞ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɦɨɞɟɥɟɣ [5,10] ɗɬɢ ɦɨɞɟɥɢ ɢɫɩɨɥɶɡɨɜɚɧɵ
ɩɪɢ ɫɨɡɞɚɧɢɢ ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ ɞɢɚɝɧɨɫɬɢɤɢ ɫɨɫɬɨɹɧɢɹ ɩɨɫɟɜɨɜ ɩɲɟɧɢɰɵ, ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɬɪɚɤɬɨɪɧɨɝɨ ɞɜɢɝɚɬɟɥɹ ɢ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɣ ɫɢɫɬɟɦɵ ɨɩɪɟɞɟɥɟɧɢɹ ɛɨɥɟɡɧɟɣ, ɜɪɟɞɢɬɟɥɟɣ ɢ
ɫɨɪɧɹɤɨɜ ɡɥɚɤɨɜɵɯ ɤɨɥɨɫɨɜɵɯ ɋɢɛɢɪɢ, ɚ ɬɚɤ ɠɟ ɨɧɢ ɢɫɩɨɥɶɡɭɸɬɫɹ ɩɪɢ ɫɨɡɞɚɧɢɢ ɛɚɡ ɞɚɧɧɵɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ.
Ɋɢɫ. 2. ɉɚɪɚɞɢɝɦɚ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ
347
ɗɦɩɢɪɢɱɟɫɤɚɹ ɝɢɩɨɬɟɡɚ ɨ ɜɨɡɦɨɠɧɨɫɬɢ ɟɞɢɧɨɝɨ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɨɩɢɫɚɧɢɹ ɩɨɞɬɜɟɪɠɞɟɧɚ ɜ
ɧɚɲɟɦ ɢɧɫɬɢɬɭɬɟ ɩɪɢ ɫɨɡɞɚɧɢɢ ɛɨɥɟɟ ɱɟɦ 20 ɛɚɡ ɞɚɧɧɵɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ.
Ɍɚɤɨɣ ɩɨɞɯɨɞ ɤ ɫɢɧɬɟɡɭ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɫɢɫɬɟɦ ɜɨ ɦɧɨɝɨɦ ɨɩɪɟɞɟɥɢɥ ɜɨɡɦɨɠɧɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ɟɞɢɧɵɯ ɢɧɫɬɪɭɦɟɧɬɚɥɶɧɵɯ ɩɪɨɝɪɚɦɦɧɵɯ ɨɛɨɥɨɱɟɤ ɞɥɹ ɫɨɡɞɚɧɢɹ ɷɤɫɩɟɪɬɧɵɯ ɫɢɫɬɟɦ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɨɛɴɟɤɬɨɜ ɢ ɛɚɡ ɞɚɧɧɵɯ ɞɥɹ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ.
ȼ ɋɢɛɎɌɂ ɫɨɡɞɚɧɚ ɝɚɦɦɚ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɩɪɨɞɭɤɬɨɜ, ɨɪɢɟɧɬɢɪɨɜɚɧɧɵɯ ɧɚ ɪɟɲɟɧɢɟ ɡɚɞɚɱ ɤɚɤ
ɞɥɹ ɧɚɭɱɧɨ-ɨɛɪɚɡɨɜɚɬɟɥɶɧɵɯ ɭɱɪɟɠɞɟɧɢɣ, ɬɚɤ ɢ ɞɥɹ ɫɟɥɶɯɨɡɬɨɜɚɪɨɩɪɨɢɡɜɨɞɢɬɟɥɟɣ. ɍɧɢɤɚɥɶɧɨɫɬɶ
ɫɨɡɞɚɧɧɵɯ ɩɪɨɝɪɚɦɦɧɵɯ ɩɪɨɞɭɤɬɨɜ ɫɨɫɬɨɢɬ ɜ ɩɪɢɦɟɧɟɧɢɢ ɦɧɨɝɨɭɪɨɜɧɟɜɵɯ ɦɨɞɟɥɟɣ ɩɪɟɞɫɬɚɜɥɟɧɢɹ ɡɧɚɧɢɣ ɫ ɫɢɫɬɟɦɨɣ ɝɥɚɜɧɨɝɨ ɢ ɩɨɞɱɢɧɟɧɧɨɝɨ ɦɟɧɸ; ɧɚɥɢɱɢɢ ɜɡɚɢɦɨɞɟɣɫɬɜɢɹ ɫ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɦɢ ɫɢɫɬɟɦɚɦɢ ɪɚɡɥɢɱɧɵɯ ɭɪɨɜɧɟɣ ɢ ɮɭɧɤɰɢɨɧɚɥɶɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ; ɜɨɡɦɨɠɧɨɫɬɢ ɩɨɩɨɥɧɟɧɢɹ, ɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɢ ɨɛɧɨɜɥɟɧɢɹ ɫɨɫɬɚɜɧɵɯ ɱɚɫɬɟɣ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɮɨɧɞɚ; ɜɨɡɦɨɠɧɨɫɬɢ
ɪɟɚɥɢɡɚɰɢɢ ɨɬɞɟɥɶɧɵɯ ɛɥɨɤɨɜ ɜ ɜɢɞɟ ɚɜɬɨɧɨɦɧɵɯ ɦɨɞɭɥɟɣ. ɉɪɟɞɭɫɦɨɬɪɟɧɚ ɜɨɡɦɨɠɧɨɫɬɶ ɛɵɫɬɪɨɝɨ
ɩɨɢɫɤɚ ɢɧɮɨɪɦɚɰɢɢ (ɪɟɠɢɦ ɨɞɧɨɝɨ «ɤɥɢɤɚ»).
Ⱦɥɹ ɫɨɩɪɨɜɨɠɞɟɧɢɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɪɨɞɭɤɰɢɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ ɫɨɜɦɟɫɬɧɨ ɫ ɋɢɛɇɂɂɊɋ,
ɋɢɛɇɂɂɁɢɏ, Ʉɪɚɫɧɨɹɪɫɤɢɦ ɇɂɂɋɏ ɪɚɡɪɚɛɨɬɚɧɵ ɩɪɨɝɪɚɦɦɵ: «Ⱥɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɟ ɪɚɛɨɱɟɟ
ɦɟɫɬɨ ɚɝɪɨɧɨɦɚ-ɡɟɦɥɟɭɫɬɪɨɢɬɟɥɹ», «Ⱥɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɟ ɪɚɛɨɱɟɟ ɦɟɫɬɨ ɚɝɪɨɧɨɦɚ-ɬɟɯɧɨɥɨɝɚ»,
ɛɚɡɚ ɞɚɧɧɵɯ «Ɋɟɫɭɪɫɨɫɛɟɪɟɝɚɸɳɢɟ ɬɟɯɧɨɥɨɝɢɢ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ», ɩɪɟɞɭɫɦɚɬɪɢɜɚɸɳɢɟ ɪɚɡɪɚɛɨɬɤɭ ɚɞɚɩɬɢɜɧɨ-ɥɚɧɞɲɚɮɬɧɨɣ ɫɢɫɬɟɦɵ ɡɟɦɥɟɞɟɥɢɹ ɞɥɹ ɤɨɧɤɪɟɬɧɨɝɨ ɯɨɡɹɣɫɬɜɚ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ
Ƚɂɋ-ɬɟɯɧɨɥɨɝɢɣ, ɮɨɪɦɢɪɨɜɚɧɢɟ ɢ ɷɤɨɧɨɦɢɤɭ ɫɟɜɨɨɛɨɪɨɬɨɜ, ɮɨɪɦɢɪɨɜɚɧɢɟ ɤɨɪɦɨɜɨɣ ɛɚɡɵ, ɭɱɟɬ
ɨɛɨɪɨɬɚ ɫɬɚɞɚ ɄɊɋ, ɜɵɛɨɪ ɬɟɯɧɨɥɨɝɢɣ ɢ ɩɨɞɛɨɪ ɬɟɯɧɢɤɢ ɩɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɨɩɟɪɚɰɢɹɦ ɜ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɟ ɫ ɭɱɟɬɨɦ ɫɪɨɤɚ ɜɵɩɨɥɧɟɧɢɹ ɪɚɛɨɬ, ɪɚɫɯɨɞɭ ȽɋɆ ɢ ɷɤɨɧɨɦɢɱɟɫɤɢɦ ɡɚɬɪɚɬɚɦ. Ⱦɥɹ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɝɨ ɜɵɛɨɪɚ ɜ ɫɟɥɟɤɰɢɢ ɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɡɟɪɧɚ ɧɚɢɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɯ ɫɨɪɬɨɜ ɩɲɟɧɢɰɵ (50 ɫɨɪɬɨɜ) ɢ ɹɱɦɟɧɹ (25 ɫɨɪɬɨɜ) ɩɨ 62 ɩɪɢɡɧɚɤɚɦ: ɭɪɨɠɚɣɧɨɫɬɢ, ɭɫɬɨɣɱɢɜɨɫɬɢ ɤ ɫɬɪɟɫɫɨɜɵɦ
ɮɚɤɬɨɪɚɦ, ɤɚɱɟɫɬɜɭ ɡɟɪɧɚ, ɩɨɱɜɟɧɧɵɦ ɨɫɨɛɟɧɧɨɫɬɹɦ ɜɨɡɞɟɥɵɜɚɧɢɹ, ɡɨɧɚɦ ɪɚɣɨɧɢɪɨɜɚɧɢɹ ɢ ɞɪɭɝɢɦ ɩɪɟɞɥɨɠɟɧɵ ɛɚɡɵ ɞɚɧɧɵɯ «ɋɨɪɬɚ ɩɲɟɧɢɰɵ» ɢ «ɋɨɪɬɚ ɹɱɦɟɧɹ».
Ɋɚɡɪɚɛɨɬɚɧ ɤɨɦɩɥɟɤɬ ɩɨɢɫɤɨɜɵɯ ɫɢɫɬɟɦ ɛɚɡ ɞɚɧɧɵɯ ɩɨ ɭɯɨɞɭ ɡɚ ɩɨɫɟɜɚɦɢ: «ɋɨɪɧɹɤɢ ɜ ɩɨɫɟɜɚɯ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ», «ȼɪɟɞɢɬɟɥɢ ɩɨɫɟɜɨɜ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ», «Ȼɨɥɟɡɧɢ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ»,
«Ƚɟɪɛɢɰɢɞɵ. Ɂɟɪɧɨɜɵɟ ɤɭɥɶɬɭɪɵ» ɞɥɹ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɣ ɞɢɚɝɧɨɫɬɢɤɢ ɢ ɷɤɨɥɨɝɢɱɟɫɤɨɝɨ ɦɨɧɢɬɨɪɢɧɝɚ ɧɚɢɛɨɥɟɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɧɵɯ ɢ ɜɪɟɞɨɧɨɫɧɵɯ ɫɨɪɧɵɯ ɪɚɫɬɟɧɢɣ, ɜɪɟɞɢɬɟɥɟɣ, ɛɨɥɟɡɧɟɣ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ ɜ ɋɢɛɢɪɫɤɨɦ ɪɟɝɢɨɧɟ ɢ ɜɵɛɨɪɚ ɫ ɭɱɟɬɨɦ ɤɨɧɤɪɟɬɧɨɣ ɫɢɬɭɚɰɢɢ ɦɟɪ ɡɚɳɢɬɵ ɩɨɫɟɜɨɜ
ɢ ɛɚɡɵ ɞɚɧɧɵɯ ɩɨ ɤɚɪɬɨɮɟɥɸ (ɫɨɪɬɚ, ɛɨɥɟɡɧɢ ɢ ɜɪɟɞɢɬɟɥɢ).
Ⱦɥɹ ɢɧɠɟɧɟɪɧɵɯ ɪɚɛɨɬ, ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɟɪɜɢɫɚ ɫɨɜɦɟɫɬɧɨ ɫ ɋɢɛɂɆɗ ɢ ɇȽȺɍ ɪɚɡɪɚɛɨɬɚɧ
«ɉɪɨɝɪɚɦɦɧɵɣ ɤɨɦɩɥɟɤɫ ɢɧɠɟɧɟɪɚ-ɦɟɯɚɧɢɤɚ» ɫ ɷɤɫɩɟɪɬɧɵɦɢ ɫɢɫɬɟɦɚɦɢ ɩɨ ɬɟɯɧɢɱɟɫɤɨɦɭ ɨɛɫɥɭɠɢɜɚɧɢɸ, ɞɢɚɝɧɨɫɬɢɪɨɜɚɧɢɸ ɢ ɢɫɩɵɬɚɧɢɸ ɞɢɡɟɥɶɧɵɯ ɞɜɢɝɚɬɟɥɟɣ ɜɧɭɬɪɟɧɧɟɝɨ ɫɝɨɪɚɧɢɹ, ɩɨɢɫɤɨɜɵɟ ɛɚɡɵ ɞɚɧɧɵɯ «Ɍɪɚɤɬɨɪɵ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ», «Ɂɟɪɧɨɭɛɨɪɨɱɧɵɟ ɤɨɦɛɚɣɧɵ»,
«ɋɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɚɹ ɬɟɯɧɢɤɚ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ» ɞɥɹ ɪɚɰɢɨɧɚɥɶɧɨɝɨ ɩɨɞɛɨɪɚ ɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɢɦɩɨɪɬɧɨɣ ɢ ɨɬɟɱɟɫɬɜɟɧɧɨɣ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɬɟɯɧɢɤɢ ɧɨɜɨɝɨ ɩɨɤɨɥɟɧɢɹ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɟɪɧɚ.
Ⱦɥɹ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ, ɜɟɬɟɪɢɧɚɪɧɵɯ ɦɟɪɨɩɪɢɹɬɢɣ ɫɨɜɦɟɫɬɧɨ ɫ ɂɗȼɋɢȾȼ ɪɚɡɪɚɛɨɬɚɧɵ ɷɤɫɩɟɪɬɧɵɟ ɫɢɫɬɟɦɵ «Ȼɢɨɯɢɦɢɹ ɜɨɡɛɭɞɢɬɟɥɟɣ ɢɧɮɟɤɰɢɨɧɧɵɯ ɛɨɥɟɡɧɟɣ ɦɨɥɨɞɧɹɤɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ
ɠɢɜɨɬɧɵɯ, «Ⱦɢɚɝɧɨɫɬɢɤɚ ɛɨɥɟɡɧɟɣ ɄɊɋ», «Ƚɟɥɶɦɢɧɬɨɡɵ ɠɜɚɱɧɵɯ ɠɢɜɨɬɧɵɯ», ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɚɹ ɫɢɫɬɟɦɚ «Ʌɟɣɤɨɡ», ɛɚɡɚ ɞɚɧɧɵɯ «Ɉɫɨɛɨ ɨɩɚɫɧɵɟ ɛɨɥɟɡɧɢ ɠɢɜɨɬɧɵɯ», ɩɪɟɞɧɚɡɧɚɱɟɧɧɵɟ ɞɥɹ
ɨɩɟɪɚɬɢɜɧɨɣ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɜɨɡɛɭɞɢɬɟɥɟɣ ɢɧɮɟɤɰɢɨɧɧɵɯ ɛɨɥɟɡɧɟɣ ɦɨɥɨɞɧɹɤɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɦɨɧɢɬɨɪɢɧɝɚ ɷɩɢɡɨɨɬɢɱɟɫɤɨɣ ɫɢɬɭɚɰɢɢ, ɞɢɚɝɧɨɫɬɢɤɢ, ɩɪɨɮɢɥɚɤɬɢɤɢ ɛɨɥɟɡɧɟɣ
ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɠɢɜɨɬɧɵɯ.
ȼɫɟ ɧɚɡɜɚɧɧɵɟ ɪɚɡɪɚɛɨɬɤɢ ɲɢɪɨɤɨ ɢɫɩɨɥɶɡɭɸɬɫɹ ɜ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɯ ɭɱɪɟɠɞɟɧɢɹɯ, ɚɝɪɚɪɧɵɯ ɜɭɡɚɯ ɢ ɫɟɥɶɯɨɡɩɪɟɞɩɪɢɹɬɢɹɯ ɋɢɛɢɪɫɤɨɝɨ ɮɟɞɟɪɚɥɶɧɨɝɨ ɨɤɪɭɝɚ, Ɋɟɫɩɭɛɥɢɤɢ ɋɚɯɚ (əɤɭɬɢɹ),
Ɍɸɦɟɧɫɤɨɣ ɨɛɥɚɫɬɢ ɢ ɏɚɧɬɵ-Ɇɚɧɫɢɣɫɤɨɝɨ ɚɜɬɨɧɨɦɧɨɝɨ ɨɤɪɭɝɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3
4.
348
Ʉɫɟɧɟɜɢɱ ɂ.ɉ. Ʉɨɧɰɟɩɰɢɹ ɧɟɩɪɟɪɵɜɧɨɣ ɢɧɮɨɪɦɚɰɢɨɧɧɨɣ ɩɨɞɞɟɪɠɤɢ ɠɢɡɧɟɧɧɨɝɨ ɰɢɤɥɚ (CALS-ɬɟɯɧɨɥɨɝɢɢ) ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɦɨɛɢɥɶɧɵɯ ɷɧɟɪɝɟɬɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ / Ʉɫɟɧɟɜɢɱ ɂ.ɉ., Ɉɪɫɢɤ Ʌ.ɋ., ɒɟɜɰɨɜ ȼ.Ƚ.// – Ɇ.: ɎȽɇɍ «Ɋɨɫɢɧɮɨɪɦɚɝɪɨɬɟɯ», 2004. – 144 ɫ.
Ƚɭɛɚɪɟɜ ȼ.ȼ. Ʉɨɧɰɟɩɬɭɚɥɶɧɵɟ ɨɫɧɨɜɵ ɢɧɮɨɪɦɚɬɢɤɢ : ɭɱɟɛ. ɩɨɫɨɛɢɟ: ɜ 3-ɯ ɑ. / ȼ.ȼ. Ƚɭɛɚɪɟɜ // ɋɭɳɧɨɫɬɧɵɟ ɨɫɧɨɜɵ ɢɧɮɨɪɦɚɬɢɤɢ / – ɇɨɜɨɫɢɛɢɪɫɤ: ɂɡɞ-ɜɨ ɇȽɌɍ, 2001. – ɑ.1. – 149 ɫ.
Ʉɫɟɧɟɜɢɱ ɂ.ɉ. ɗɤɨɥɨɝɢɱɟɫɤɚɹ ɛɟɡɨɩɚɫɧɨɫɬɶ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɬɟɯɧɢɤɢ ɜ ɩɨɥɧɨɦ ɠɢɡɧɟɧɧɨɦ ɰɢɤɥɟ
/ ɂ.ɉ. Ʉɫɟɧɟɜɢɱ // ɉɪɢɜɨɞɧɚɹ ɬɟɯɧɢɤɚ. – 2000 – ʋ 2.
Ɋɚɤɨɜɢɱ Ⱥ.Ƚ. ɂɧɮɨɪɦɚɰɢɨɧɧɵɟ ɩɪɨɰɟɫɫɵ ɢ ɬɟɯɧɨɥɨɝɢɢ ɜ ɩɪɨɟɤɬɢɪɨɜɚɧɢɢ ɫɪɟɞɫɬɜ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɝɨ
ɨɫɧɚɳɟɧɢɹ / Ⱥ.Ƚ. Ɋɚɤɨɜɢɱ // ɇɚɭɱ.-ɬɟɯɧ. ɫɛ. Ⱥɇ Ȼɟɥɨɪɭɫɫɢ/ ɂɧɫɬɢɬɭɬ. ɬɟɯɧ. ɤɢɛɟɪɧɟɬɢɤɢ, ɩɨɞ ɪɟɞ. Ɍɚɧɚɟɜɚ ȼ.ɋ. ɢ ɞɪ.– Ɇɢɧɫɤ, 1995. – ɋ. 18–42.
5.
6.
7.
8.
9.
10.
Ⱥɥɶɬ ȼ.ȼ. Ʉɨɧɬɪɨɥɶ ɢ ɭɩɪɚɜɥɟɧɢɟ ɩɚɪɚɦɟɬɪɚɦɢ ɬɪɚɤɬɨɪɧɵɯ ɞɜɢɝɚɬɟɥɟɣ ɜ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɵɯ ɭɫɥɨɜɢɹɯ
: ɚɜɬɨɪɟɮ. ɞɢɫ. ɞ-ɪɚ ɬɟɯɧ. ɧɚɭɤ / Ⱥɥɶɬ ȼ.ȼ. – ɇɨɜɨɫɢɛɢɪɫɤ, 1995. – 27 ɫ.
Ȼɟɪɟɡɢɧɚ ȼ.ɘ. ɂɧɮɨɪɦɚɰɢɨɧɧɚɹ ɛɚɡɚ ”ɋɨɪɧɹɤɢ ɜ ɩɨɫɟɜɚɯ ɡɟɪɧɨɜɵɯ”/ Ȼɟɪɟɡɢɧɚ ȼ.ɘ., Ƚɭɪɨɜɚ Ɍ.Ⱥ.,
Ʉɨɥɩɚɤɨɜɚ Ʌ.Ⱥ. ɢ ɞɪ. // ɂɧɮɨɪɦɚɰɢɨɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ, ɢɧɮɨɪɦɚɰɢɨɧɧɵɟ ɢɡɦɟɪɢɬɟɥɶɧɵɟ ɫɢɫɬɟɦɵ ɢ
ɩɪɢɛɨɪɵ ɜ ɢɫɫɥɟɞɨɜɚɧɢɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɩɪɨɰɟɫɫɨɜ./ Ɇɚɬɟɪɢɚɥɵ ɪɟɝɢɨɧ. ɧɚɭɱ.-ɩɪɚɤɬ. ɤɨɧɮ.
«ȺȽɊɈɂɇɎɈ – 2000» (ɇɨɜɨɫɢɛɢɪɫɤ, 26–27 ɨɤɬɹɛɪɹ 2000ɝ.) / ɊȺɋɏɇ. ɋɢɛ. ɨɬɞ-ɧɢɟ. – ɇɨɜɨɫɢɛɢɪɫɤ,
2000. – ɋ.171–175.,ɑ1.
Ⱦɟɧɢɫɸɤ ɋ.Ƚ. Ɉɫɨɛɟɧɧɨɫɬɢ ɩɨɫɬɪɨɟɧɢɹ ɛɚɡ ɞɚɧɧɵɯ ɩɨ ɩɥɨɞɨɜɨ – ɹɝɨɞɧɵɦ ɤɭɥɶɬɭɪɚɦ / Ⱦɟɧɢɫɸɤ ɋ.Ƚ. //
Ɇɟɬɨɞɵ ɢ ɬɟɯɧɢɱɟɫɤɢɟ ɫɪɟɞɫɬɜɚ ɢɫɫɥɟɞɨɜɚɧɢɣ ɮɢɡɢɱɟɫɤɢɯ ɩɪɨɰɟɫɫɨɜ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ: ɫɛ. ɧɚɭɱ.
ɬɪ./ ɊȺɋɏɇ. ɋɢɛ. ɨɬɞ-ɧɢɟ. – ɋɢɛɎɌɂ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2001.- ɋ.130–135.
Ɂɚɝɨɪɭɣɤɨ ɇ.Ƚ. ɉɪɢɤɥɚɞɧɵɟ ɦɟɬɨɞɵ ɚɧɚɥɢɡɚ ɞɚɧɧɵɯ ɢ ɡɧɚɧɢɣ / ɇ.Ƚ Ɂɚɝɨɪɭɣɤɨ – ɇɨɜɨɫɢɛɢɪɫɤ: ɂɡɞ-ɜɨ
ɦɚɬɟɦɚɬɢɤɢ, 1999. – 270 ɫ.
Ʉɨɧɧɨɥɢ Ɍɨɦɚɫ Ȼɚɡɵ ɞɚɧɧɵɯ . ɉɪɨɟɤɬɢɪɨɜɚɧɢɟ, ɪɟɚɥɢɡɚɰɢɹ ɢ ɫɨɩɪɨɜɨɠɞɟɧɢɟ. Ɍɟɨɪɢɹ ɢ ɩɪɚɤɬɢɤɚ: ɭɱɟɛ.
ɩɨɫɨɛɢɟ 2-ɟ ɢɡɞ. ɉɟɪ. ɫ ɚɧɝɥ / Ʉɨɧɧɨɥɢ Ɍ., Ȼɟɝɝ Ʉ., ɋɬɪɚɱɚɧ Ⱥ. – Ɇ.: ɂɡɞɚɬɟɥɶɫɤɢɣ ɞɨɦ ”ȼɢɥɶɹɦɫ”,
2000 – 1120ɫ.
Ⱥɥɶɬ ȼ.ȼ. ɂɧɮɨɪɦɚɰɢɨɧɧɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢ ɤɨɦɩɶɸɬɟɪɢɡɚɰɢɹ ɫɟɥɟɤɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ / Ⱥɥɶɬ ȼ.ȼ. //
Ɂɚɞɚɱɢ ɫɟɥɟɤɰɢɢ ɢ ɩɭɬɢ ɢɯ ɪɟɲɟɧɢɹ ɜ ɋɢɛɢɪɢ: Ⱦɨɤɥ. ɢ ɫɨɨɛɳ. ɝɟɧɟɬ. ɫɟɥɟɤɰ. ɲɤɨɥɵ / ɊȺɋɏɇ. ɋɢɛ. ɨɬɞɧɢɟ – ɇɨɜɨɫɢɛɢɪɫɤ, 2000. ɋ. 24 – 28.
ɍȾɄ 631.587:627.83
ɆɈɇɂɌɈɊɂɇȽ ɌɊȺɇɋȽɊȺɇɂɑɇɕɏ ȼɈȾɇɕɏ ɈȻɔȿɄɌɈȼ
ɆȿɌɈȾɈɆ ȾɁɁ
*
ȻȺȾɀȺɇɈȼ Ȼ.Ɇ*. , ɄȿɊɆȺɅɂȿȼ ɍ.Ɍ.*, ȻɊȿɍɋɈȼ ɇ.Ƚ.**,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɜɨɞɧɨɝɨ ɯɨɡɹɣɫɬɜɚ»,
Ʉɚɡɚɯɫɬɚɧ, ɝ.Ɍɚɪɚɡ,
**
ȺɈ «ɇɚɰɢɨɧɚɥɶɧɵɣ ɰɟɧɬɪ ɤɨɫɦɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢ ɬɟɯɧɨɥɨɝɢɣ»,
Ʉɚɡɚɯɫɬɚɧ, ɝ.Ⱥɥɦɚɬɵ, badg_4@mail.ru
ɇɚ ɫɨɜɪɟɦɟɧɧɨɦ ɷɬɚɩɟ ɢɡɭɱɟɧɢɟ ɬɟɦɩɨɜ ɢ ɦɚɫɲɬɚɛɨɜ ɞɨɥɝɨɜɪɟɦɟɧɧɵɯ ɢɡɦɟɧɟɧɢɣ ɩɪɢɪɨɞɧɨɣ
ɫɪɟɞɵ, ɜɨɡɦɨɠɧɨɫɬɶ ɨɰɟɧɤɢ ɬɟɤɭɳɟɝɨ ɫɨɫɬɨɹɧɢɹ ɢ ɞɨɥɝɨɫɪɨɱɧɨɝɨ ɩɪɨɝɧɨɡɚ ɪɚɡɜɢɬɢɹ ɷɤɨɫɢɫɬɟɦ
ɹɜɥɹɟɬɫɹ ɜɚɠɧɨɣ ɡɚɞɚɱɟɣ ɞɥɹ Ɋɟɫɩɭɛɥɢɤɢ. Ɇɧɨɝɢɟ ɫɟɤɬɨɪɵ ɷɤɨɧɨɦɢɤɢ Ʉɚɡɚɯɫɬɚɧɚ, ɨɫɨɛɟɧɧɨ ɫɟɥɶɫɤɨɟ ɯɨɡɹɣɫɬɜɨ, ɢ ɜɨɞɧɵɟ ɪɟɫɭɪɫɵ, ɹɜɥɹɸɬɫɹ ɡɚɜɢɫɢɦɵɦɢ ɧɟ ɬɨɥɶɤɨ ɨɬ ɧɚɛɥɸɞɚɟɦɵɯ ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɢɡɦɟɧɟɧɢɣ, ɧɨ ɢ ɨɬ ɯɨɡɹɣɫɬɜɟɧɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɤɚɤ ɧɚ ɫɨɛɫɬɜɟɧɧɨɣ ɬɟɪɪɢɬɨɪɢɢ, ɬɚɤ ɢ ɜ ɫɨɩɪɟɞɟɥɶɧɵɯ ɝɨɫɭɞɚɪɫɬɜɚɯ. Ɋɟɲɟɧɢɟ ɷɬɢɯ ɩɪɨɛɥɟɦ ɬɪɟɛɭɟɬ ɪɚɡɜɢɬɢɹ ɬɟɨɪɟɬɢɱɟɫɤɢɯ, ɦɟɬɨɞɨɥɨɝɢɱɟɫɤɢɯ
ɢ ɬɟɯɧɢɱɟɫɤɢɯ ɩɪɢɟɦɨɜ, ɚɥɝɨɪɢɬɦɨɜ, ɦɟɬɨɞɨɜ.
ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɤɨɫɦɢɱɟɫɤɨɣ ɢɧɮɨɪɦɚɰɢɢ ɩɪɢ ɢɫɫɥɟɞɨɜɚɧɢɢ ɢ ɢɡɭɱɟɧɢɢ ɪɚɡɥɢɱɧɵɯ ɩɪɨɰɟɫɫɨɜ
ɧɚ ɡɟɦɧɨɣ ɩɨɜɟɪɯɧɨɫɬɢ ɹɜɥɹɟɬɫɹ ɨɛɳɟɩɪɢɧɹɬɵɦ ɜ ɫɨɜɪɟɦɟɧɧɨɦ ɦɢɪɟ. ɇɚɤɨɩɥɟɧɵ ɢɫɬɨɪɢɱɟɫɤɢɟ
ɦɧɨɝɨɥɟɬɧɢɟ ɫɩɭɬɧɢɤɨɜɵɟ ɞɚɧɧɵɟ, ɩɪɚɤɬɢɱɟɫɤɢ ɞɨɫɬɭɩɧɵɟ ɫ 1972 ɝɨɞɚ, ɨɛɟɫɩɟɱɢɜɚɸɬ ɤɚɤ ɨɩɟɪɚɬɢɜɧɵɣ ɤɨɧɬɪɨɥɶ ɬɟɤɭɳɢɯ ɢɡɦɟɧɟɧɢɣ ɜ ɫɨɫɬɨɹɧɢɢ ɨɛɴɟɤɬɨɜ, ɬɚɤ ɢ ɜɨɡɦɨɠɧɨɫɬɶ ɢɫɫɥɟɞɨɜɚɧɢɣ ɩɪɨɢɫɯɨɞɹɳɢɯ ɞɨɥɝɨɜɪɟɦɟɧɧɵɯ ɩɪɨɰɟɫɫɨɜ, ɱɬɨ ɩɨɡɜɨɥɹɟɬ ɨɰɟɧɢɬɶ ɦɚɫɲɬɚɛɵ ɢ ɬɟɧɞɟɧɰɢɢ ɢɡɦɟɧɟɧɢɣ
ɩɨɞɫɬɢɥɚɸɳɟɣ ɩɨɜɟɪɯɧɨɫɬɢ ɧɚ ɩɪɨɬɹɠɟɧɢɢ ɛɨɥɟɟ ɱɟɦ 40-ɥɟɬɧɟɝɨ ɩɟɪɢɨɞɚ. ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ, ɨɧɢ
ɲɢɪɨɤɨ ɢɫɩɨɥɶɡɭɸɬɫɹ ɞɥɹ ɩɪɢɧɹɬɢɹ ɤɥɸɱɟɜɵɯ ɪɟɲɟɧɢɣ ɭɩɪɚɜɥɟɧɢɹ ɬɟɪɪɢɬɨɪɢɹɦɢ, ɩɨɞɞɟɪɠɚɧɢɹ
ɷɤɨɥɨɝɢɱɟɫɤɨɝɨ ɪɚɜɧɨɜɟɫɢɹ, ɷɮɮɟɤɬɢɜɧɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɡɟɦɟɥɶɧɵɯ ɢ ɜɨɞɧɵɯ ɪɟɫɭɪɫɨɜ, ɚ ɬɚɤ ɠɟ
ɜɨ ɦɧɨɝɢɯ ɞɪɭɝɢɯ ɡɚɞɚɱɚɯ. ɂɡɭɱɟɧɢɟ ɞɨɥɝɨɜɪɟɦɟɧɧɵɯ ɢɡɦɟɧɟɧɢɣ ɩɪɢɪɨɞɧɨɣ ɫɪɟɞɵ ɫɪɟɞɫɬɜɚɦɢ ɢ
ɦɟɬɨɞɚɦɢ ȾɁɁ ɹɜɥɹɸɬɫɹ ɫɟɝɨɞɧɹ ɨɞɧɢɦ ɢɡ ɧɚɢɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɯ ɧɚɭɱɧɵɯ ɧɚɩɪɚɜɥɟɧɢɣ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɰɟɫɫɨɜ, ɩɪɨɢɫɯɨɞɹɳɢɯ ɧɚ ɡɟɦɧɨɣ ɩɨɜɟɪɯɧɨɫɬɢ [1].
ɋɩɭɬɧɢɤɨɜɵɟ ɫɧɢɦɤɢ ɨɬɧɨɫɹɬɫɹ ɤ ɨɞɧɢɦ ɢɡ ɧɚɢɛɨɥɟɟ ɰɟɧɧɵɯ ɧɨɫɢɬɟɥɟɣ ɪɚɡɧɨɩɥɚɧɨɜɨɣ ɢɧɮɨɪɦɚɰɢɢ, ɚɧɚɥɢɡ ɤɨɬɨɪɨɣ ɫɩɨɫɨɛɫɬɜɭɟɬ ɜɵɹɜɥɟɧɢɸ ɩɪɨɫɬɪɚɧɫɬɜɟɧɧɨ-ɜɪɟɦɟɧɧɵɯ ɜɡɚɢɦɨɡɚɜɢɫɢɦɨɫɬɟɣ ɤɨɦɩɨɧɟɧɬɨɜ ɫɢɫɬɟɦɵ «ɜɨɞɨɫɛɨɪ-ɜɨɞɨɬɨɤ-ɜɨɞɨɟɦ». Ⱦɚɧɧɵɟ ɞɢɫɬɚɧɰɢɨɧɧɨɝɨ ɡɨɧɞɢɪɨɜɚɧɢɹ ɜ
ɭɫɥɨɜɢɹɯ ɞɟɮɢɰɢɬɚ ɧɚɡɟɦɧɵɯ ɧɚɛɥɸɞɟɧɢɣ ɹɜɥɹɸɬɫɹ ɨɫɧɨɜɧɵɦɢ, ɚ ɱɚɫɬɨ ɢ ɟɞɢɧɫɬɜɟɧɧɵɦɢ ɞɨɫɬɭɩɧɵɦɢ ɢɫɬɨɱɧɢɤɚɦɢ ɢɧɮɨɪɦɚɰɢɢ ɨ ɫɨɫɬɨɹɧɢɢ ɜɨɞɧɵɯ ɨɛɴɟɤɬɨɜ ɢ ɢɯ ɜɨɞɨɫɛɨɪɨɜ.
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɞɥɹ ɦɨɧɢɬɨɪɢɧɝɚ ɜɨɞɧɵɯ ɨɛɴɟɤɬɨɜ ɦɨɝɭɬ ɛɵɬɶ ɢɫɩɨɥɶɡɨɜɚɧɵ ɫɥɟɞɭɸɳɢɟ
Ʉɋ ȾɁɁ: NOAA, MODIS, IRS, RADARSAT ɢ LANDSAT (ɬɚɛɥ. 1).
349
Ɍɚɛɥɢɰɚ 1
Ⱦɚɧɧɵɟ ȾȾɁ, ɩɪɢɟɦ ɤɨɬɨɪɵɯ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɜ ȾɌɈɈ «ɂɄɂ»
ɏɚɪɚɤɬɟɪɢɫɬɢɤɢ ɫɴɟɦɨɱɧɨɝɨ ɩɪɢɛɨɪɚ
Ʉɨɫɦɢɱɟɫɤɢɣ ɚɩɩɚɪɚɬ
(ɫɬɪɚɧɚ)
NOAA (ɋɒȺ)
TERRA, AQUA (ɋɒȺ)
IRS P6
(ɂɧɞɢɹ)
RADARSAT-1
(Ʉɚɧɚɞɚ)
Ɋɚɞɢɨɦɟɬɪ
ɉɪɨɫɬɪɚɧɫɬ-ɜɟɧɧɨɟ
ɪɚɡɪɟɲɟɧɢɟ, ɦ
Ʉɨɥ-ɜɨ ɤɚɧɚɥɨɜ
(ɫɩɟɤɬɪ. ɞɢɚɩɚɡɨɧ,
ɦɤɦ)
ɉɨɥɨɫɚ ɡɚɯɜɚɬɚ, ɤɦ
AVHRR
1100
5 (0,58 – 12,5)
3000
LISS-4
250
500
1000
5.8
2 (0,6 – 0,8)
5 (0,4 – 2,0)
29 (0,4 – 14)
3 (0,52-0,86)
LISS-3
23
4 (0,52–1,7)
140
AWIFS
56–70
4 (0,52- 1,7)
740
SAR
ɨɬ 8 ɞɨ100
C-ɞɢɚɩɚɡɨɧ 5,6 ɫɦ
ɨɬ 50 ɞɨ 500
MODIS
2300
23
ȼ ȺɈ «ɇɚɰɢɨɧɚɥɶɧɵɣ ɰɟɧɬɪ ɤɨɫɦɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɢ ɬɟɯɧɨɥɨɝɢɣ» ɜɟɞɟɬɫɹ ɩɪɢɟɦ ɢ ɚɪɯɢɜɚɰɢɹ ɫɩɭɬɧɢɤɨɜɵɯ ɞɚɧɧɵɯ. ȼ ɬɚɛɥɢɰɟ 2 ɩɪɢɜɟɞɟɧɵ ɧɟɤɨɬɨɪɵɟ ɬɟɯɧɢɱɟɫɤɢɟ ɯɚɪɚɤɬɟɪɢɫɬɢɤɢ ɩɪɢɧɢɦɚɟɦɨɣ ɤɨɫɦɢɱɟɫɤɨɣ ɢɧɮɨɪɦɚɰɢɢ[2].
Ɍɚɛɥɢɰɚ 2
ɉɪɨɫɬɪɚɧɫɬɜɟɧɧɨ-ɜɪɟɦɟɧɧɵɟ ɯɚɪɚɤɬɟɪɢɫɬɢɤɢ ɫɩɭɬɧɢɤɨɜɨɣ ɢɧɮɨɪɦɚɰɢɢ
ɋɩɭɬɧɢɤ
NOAA (ɂɄɂ)
MODIS (ɂɄɂ)
MOD09 (USA)
IRS LISS
IRS PAN
Landsat
(USA)
ɉɪɨɫɬɪɚɧɫɬɜɟɧɧɨɟ ɪɚɡɪɟɲɟɧɢɟ
1000 ɦ
1000–250ɦ
250 ɦ
23 ɦ
5,8 ɦ
ɇɚɱɚɥɨ ɩɟɪɢɨɞɚ ɧɚɛɥɸɞɟɧɢɹ
2000
2001
2000
2003–2009
2004–2009
30 ɦ
ɇɚɱɚɥɨ 1980-ɯ ɝɨɞɨɜ
ɑɚɫɬɨɬɚ ɩɪɢɟɦɚ
ɟɠɟɞɧɟɜɧɨ
ɟɠɟɞɧɟɜɧɨ
8 ɞɧɟɣ
ɡɚɤɚɡɧɨɣ
ɡɚɤɚɡɧɨɣ
16 ɞɧɟɣ
ɋɩɭɬɧɢɤɨɜɵɟ ɞɚɧɧɵɟ ɧɢɡɤɨɝɨ ɪɚɡɪɟɲɟɧɢɹ – NOAA, MODIS – ɦɨɝɭɬ ɛɵɬɶ ɢɫɩɨɥɶɡɨɜɚɧɵ ɞɥɹ
ɫɨɡɞɚɧɢɹ ɨɛɡɨɪɧɵɯ ɤɚɪɬ ɢɫɫɥɟɞɭɟɦɵɯ ɬɟɪɪɢɬɨɪɢɣ. ȼ ɡɚɞɚɱɟ ɦɨɧɢɬɨɪɢɧɝɚ ɜɨɞɧɵɯ ɨɛɴɟɤɬɨɜ ɢɡɨɛɪɚɠɟɧɢɹ ɫɪɟɞɧɟɝɨ ɪɚɡɪɟɲɟɧɢɹ – LANDSAT – ɩɨɡɜɨɥɹɸɬ ɩɪɨɫɥɟɞɢɬɶ ɡɚ ɪɚɡɦɟɪɚɦɢ ɜɨɞɧɨɝɨ ɡɟɪɤɚɥɚ
ɜɨɞɨɟɦɨɜ, ɫɬɪɭɤɬɭɪɨɣ ɢ ɦɟɚɧɞɪɢɪɨɜɚɧɢɟɦ ɪɟɱɧɵɯ ɪɭɫɟɥ, ɫɨɫɬɨɹɧɢɟɦ ɨɪɨɲɚɟɦɵɯ ɡɟɦɟɥɶ. Ⱦɚɧɧɵɟ
ɜɵɫɨɤɨɝɨ ɪɚɡɪɟɲɟɧɢɹ (ɦɟɧɟɟ 6 ɦ) ɩɨɡɜɨɥɹɸɬ ɨɰɟɧɢɬɶ ɢɡɪɟɡɚɧɧɨɫɬɶ ɛɟɪɟɝɨɜɵɯ ɥɢɧɢɣ, ɫɬɟɩɟɧɶ ɡɚɢɥɟɧɧɨɫɬɢ ɪɟɱɧɵɯ ɪɭɫɟɥ ɢ ɬ.ɩ.[3]
Ɋɢɫ. 1. ɋɯɟɦɚ ɩɨɤɪɵɬɢɹ ɫɰɟɧɚɦɢ LANDSAT(144/26, 144/27, 143/27, 142/27)
ɞɥɹ ɛɚɫɫɟɣɧɚ ɪɟɤɢ ȿɪɬɢɫ ɧɚ ɫɨɩɪɟɞɟɥɶɧɨɣ ɬɟɪɪɢɬɨɪɢɢ ɡɚ ɩɟɪɢɨɞ 1989–1992 ɝɝ.
350
ɍɜɟɥɢɱɟɧɢɟ ɤɚɱɟɫɬɜɚ ɢɡɨɛɪɚɠɟɧɢɹ ɡɚ ɫɱɟɬ ɩɟɪɟɯɨɞɚ ɤ ɫɧɢɦɤɚɦ ɛɨɥɟɟ ɜɵɫɨɤɨɝɨ ɪɚɡɪɟɲɟɧɢɹ ɩɪɢɜɨɞɢɬ ɤ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɩɪɢɦɟɧɟɧɢɹ ɛɨɥɶɲɟɝɨ ɤɨɥɢɱɟɫɬɜɚ ɫɰɟɧ, ɩɨɤɪɵɜɚɸɳɢɯ ɞɚɧɧɭɸ ɬɟɪɪɢɬɨɪɢɸ. Ɍɚɤ, ɞɥɹ ɩɨɤɪɵɬɢɹ ɫɰɟɧɚɦɢ LANDSAT ɩɨɥɢɝɨɧɚ 1 (ȿɪɬɢɫ) ɬɪɟɛɭɟɬɫɹ 4 ɫɰɟɧɵ – 144/26, 144/27,
143/27, 142/27; ɞɥɹ ɩɨɥɢɝɨɧɚ 2 (ɂɥɢ) ɬɪɟɛɭɟɬɫɹ 6 ɫɰɟɧ – 145/30, 146/29, 146/30, 147/29, 147/30,
147/31; ɞɥɹ ɩɨɥɢɝɨɧɚ 3 (ɋɵɪ-Ⱦɚɪɶɹ) – 16 ɫɰɟɧ – 148/31, 143/31, 150/31, 151/32, 151/31, 151/32,
152/31, 152/32, 153/31, 153/32, 154/31, 154/32, 155/31, 155/32, 156/31, 156/32. ɉɪɢɦɟɪ ɫɯɟɦɵ ɩɨɤɪɵɬɢɹ ɨɛɴɟɤɬɚ ɫɰɟɧɚɦɢ LANDSAT ɩɪɢɜɟɞɟɧɚ ɧɚ ɪɢɫ. 1.
Ɇɨɡɚɢɤɚ ɞɥɹ ɢɫɫɥɟɞɭɟɦɵɯ ɛɚɫɫɟɣɧɨɜ ɫɨɡɞɚɧɵ ɞɥɹ ɬɪɟɯ ɜɪɟɦɟɧɧɵɯ ɩɟɪɢɨɞɨɜ: ɤɨɧɟɰ 80-ɯ ɝɨɞɨɜ
ɏɏ ɜɟɤɚ, ɤɨɧɟɰ 900-ɯ ɝɨɞɨɜ ɏɏ ɜɟɤɚ, ɫɨɜɪɟɦɟɧɧɨɟ ɫɨɫɬɨɹɧɢɟ 2008–2011 ɝɝ. ɉɪɢ ɷɬɨɦ ɛɚɡɨɜɵɦ
ɹɜɥɹɟɬɫɹ ɦɚɫɲɬɚɛ 1: 200 000. ɇɚ ɪɢɫɭɧɤɟ 2 ɢɥɥɸɫɬɪɢɪɭɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ ɨɰɟɧɤɢ ɦɧɨɝɨɥɟɬɧɢɯ
ɢɡɦɟɧɟɧɢɣ ɜɨɞɧɵɯ ɨɛɴɟɤɬɨɜ ɢ ɡɟɦɥɟɩɨɥɶɡɨɜɚɧɢɹ ɩɨ ɤɨɫɦɨɫɧɢɦɤɚɦ.
Ɋɢɫ. 2. ɂɡɦɟɧɟɧɢɹ ɜ ɡɟɦɥɟ ɢ ɜɨɞɨɩɨɥɶɡɨɜɚɧɢɢ ɜ ȿɪɬɢɫɫɤɨɦ ɛɚɫɫɟɣɧɟ (ɄɇɊ)
ȼ ɦɢɪɟ ɧɚɫɱɢɬɵɜɚɟɬɫɹ ɨɤɨɥɨ 260 ɦɟɠɞɭɧɚɪɨɞɧɵɯ ɪɟɱɧɵɯ ɢ ɨɡɟɪɧɵɯ ɛɚɫɫɟɣɧɨɜ, 25 ɢɡ ɧɢɯ ɧɚɯɨɞɹɬɫɹ ɩɨɞ ɤɨɧɬɪɨɥɟɦ ɱɟɬɵɪɟɯ ɢ ɛɨɥɟɟ ɝɨɫɭɞɚɪɫɬɜ. Ɉɛɳɚɹ ɩɥɨɳɚɞɶ ɬɚɤɢɯ ɛɚɫɫɟɣɧɨɜ ɨɯɜɚɬɵɜɚɟɬ
ɛɨɥɟɟ 45 % ɡɟɦɧɨɣ ɩɨɜɟɪɯɧɨɫɬɢ. Ʉɚɤ ɩɪɚɜɢɥɨ, ɭ ɝɪɚɧɢɱɚɳɢɯ ɝɨɫɭɞɚɪɫɬɜ ɜɨɡɧɢɤɚɸɬ ɩɪɨɛɥɟɦɵ,
ɫɜɹɡɚɧɧɵɟ ɫ ɡɚɳɢɬɨɣ ɫɜɨɟɣ ɱɚɫɬɢ ɛɚɫɫɟɣɧɚ, ɧɚɩɪɢɦɟɪ, ɢɡ-ɡɚ ɱɪɟɡɦɟɪɧɨɝɨ ɩɨɬɪɟɛɥɟɧɢɹ ɜɨɞɵ ɞɪɭɝɨɣ ɫɬɪɚɧɨɣ ɢɥɢ ɢɡ-ɡɚ ɭɯɭɞɲɟɧɢɹ ɷɤɨɥɨɝɢɢ ɩɨ ɜɢɧɟ ɫɨɫɟɞɧɟɝɨ ɝɨɫɭɞɚɪɫɬɜɚ. ȼ ɷɬɨɦ ɫɥɭɱɚɟ ɨɫɨɛɭɸ
ɚɤɬɭɚɥɶɧɨɫɬɶ ɩɪɢɨɛɪɟɬɚɸɬ ɜɨɩɪɨɫɵ ɪɚɰɢɨɧɚɥɶɧɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɪɢɪɨɞɧɵɯ ɪɟɫɭɪɫɨɜ ɦɟɠɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɡɧɚɱɟɧɢɹ. ɉɨɫɤɨɥɶɤɭ ɧɟ ɫɭɳɟɫɬɜɭɟɬ ɝɪɚɧɢɰ ɞɥɹ ɬɪɚɧɫɝɪɚɧɢɱɧɵɯ ɝɟɨɫɢɫɬɟɦ ɢ ɧɚ ɷɤɨɥɨɝɢɱɟɫɤɨɦ ɫɨɫɬɨɹɧɢɢ ɨɬɪɚɠɚɸɬɫɹ ɩɨɫɥɟɞɫɬɜɢɹ ɧɟɝɚɬɢɜɧɨɣ ɯɨɡɹɣɫɬɜɟɧɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɥɸɛɨɣ
ɢɡ ɫɬɨɪɨɧ. ɗɬɚ ɩɪɨɛɥɟɦɚ ɹɜɥɹɟɬɫɹ ɜɟɫɶɦɚ ɚɤɬɭɚɥɶɧɨɣ ɢ ɞɥɹ Ʉɚɡɚɯɫɬɚɧɚ. Ȼɨɥɶɲɢɧɫɬɜɨ ɪɟɤ, ɩɪɨɬɟɤɚɸɳɢɯ ɩɨ ɬɟɪɪɢɬɨɪɢɢ ɪɟɫɩɭɛɥɢɤɢ, ɛɟɪɭɬ ɧɚɱɚɥɨ ɡɚ ɪɭɛɟɠɨɦ [4].
Ⱦɥɹ ɩɨɧɢɦɚɧɢɹ ɨɛɳɧɨɫɬɢ ɢ ɜɡɚɢɦɨɫɜɹɡɢ ɩɪɢɪɨɞɧɨ-ɝɟɨɝɪɚɮɢɱɟɫɤɢɯ ɢ ɚɧɬɪɨɩɨɝɟɧɧɵɯ ɩɪɨɰɟɫɫɨɜ ɜ ɪɚɡɧɵɯ ɱɚɫɬɹɯ ɜɨɞɨɫɛɨɪɚ, ɩɪɢɧɚɞɥɟɠɚɳɢɯ ɫɨɫɟɞɧɢɦ ɫɬɪɚɧɚɦ, ɧɟɨɛɯɨɞɢɦɚ ɩɨɥɧɚɹ ɢɧɮɨɪɦɚɰɢɹ ɨ ɝɟɨɫɢɫɬɟɦɟ ɫɨ ɜɫɟɣ ɬɟɪɪɢɬɨɪɢɢ ɬɪɚɧɫɝɪɚɧɢɱɧɨɝɨ ɛɚɫɫɟɣɧɚ, ɨɬ ɡɨɧɵ ɜɨɞɨɫɛɨɪɚ ɞɨ ɡɨɧɵ
ɪɚɫɫɟɢɜɚɧɢɹ ɩɨɜɟɪɯɧɨɫɬɧɨɝɨ ɫɬɨɤɚ. ɉɨɥɭɱɟɧɢɟ ɬɚɤɨɣ ɢɧɮɨɪɦɚɰɢɢ ɜɨɡɦɨɠɧɨ ɬɨɥɶɤɨ ɜ ɬɨɦ ɫɥɭɱɚɟ,
ɟɫɥɢ ɫɨɩɪɟɞɟɥɶɧɵɟ ɝɨɫɭɞɚɪɫɬɜɚ ɫɜɹɡɚɧɵ ɫɨɝɥɚɲɟɧɢɟɦ ɩɨ ɪɟɝɭɥɢɪɨɜɚɧɢɸ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɢ ɨɯɪɚɧɟ
ɜɨɞ ɬɪɚɧɫɝɪɚɧɢɱɧɵɯ ɪɟɤ ɢ ɜɨɞɨɟɦɨɜ. Ɉɬɫɭɬɫɬɜɢɟ ɩɨɞɨɛɧɵɯ ɞɨɝɨɜɨɪɟɧɧɨɫɬɟɣ, ɜɵɧɭɠɞɚɟɬ ɢɫɤɚɬɶ
ɚɥɶɬɟɪɧɚɬɢɜɧɵɣ ɦɟɬɨɞ ɢɡɭɱɟɧɢɹ ɫɦɟɠɧɵɯ ɬɟɪɪɢɬɨɪɢɣ (ɩɨ ɜɨɡɦɨɠɧɨɫɬɢ – ɧɟɡɚɜɢɫɢɦɵɣ ɨɬ ɩɨɥɢɬɢɱɟɫɤɢɯ ɜɡɚɢɦɨɨɬɧɨɲɟɧɢɣ). ɗɬɢ ɦɟɬɨɞɵ ɩɨɡɜɨɥɹɬ ɜ ɩɟɪɜɨɦ ɩɪɢɛɥɢɠɟɧɢɢ ɫɨɡɞɚɬɶ ɫɨɜɪɟɦɟɧɧɭɸ
ɢɧɮɨɪɦɚɰɢɨɧɧɭɸ ɛɚɡɭ ɞɚɧɧɵɯ, ɨɫɭɳɟɫɬɜɥɹɬɶ ɤɨɧɬɪɨɥɶ ɢ ɫɥɟɠɟɧɢɟ ɡɚ ɩɪɨɢɫɯɨɞɹɳɢɦɢ ɧɚ ɜɫɟɣ
ɜɨɞɨɫɛɨɪɧɨɣ ɬɟɪɪɢɬɨɪɢɢ ɢɡɦɟɧɟɧɢɹɦɢ, ɩɪɨɝɧɨɡɢɪɨɜɚɬɶ ɜɨɡɦɨɠɧɵɟ ɜɚɪɢɚɧɬɵ ɢɯ ɪɚɡɜɢɬɢɹ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɜɨɞɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɨɥɢɬɢɤɢ ɤɚɠɞɨɝɨ ɫɨɩɪɟɞɟɥɶɧɨɝɨ ɝɨɫɭɞɚɪɫɬɜɚ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
ɋɩɢɜɚɤ Ʌ.Ɏ. Ɉɫɧɨɜɵ ɫɨɡɞɚɧɢɹ ɫɢɫɬɟɦ ɤɨɫɦɢɱɟɫɤɨɝɨ ɦɨɧɢɬɨɪɢɧɝɚ. Ɇɟɬɨɞɢɱɟɫɤɨɟ ɩɨɫɨɛɢɟ. Ⱥɥɦɚɬɵ,
2010. –ɋ. 92
ɉɪɨɤɚɱɟɜɚ ȼ.Ƚ., ɍɫɚɱɟɜ ȼ.Ɏ. Ⱥɷɪɨɤɨɫɦɢɱɟɫɤɚɹ ɢɧɮɨɪɦɚɰɢɹ ɩɪɢ ɨɰɟɧɤɟ ɜɨɞɧɵɯ ɪɟɫɭɪɫɨɜ (Ƚɨɫɭɞɚɪɫɬɜɟɧɧɵɣ ɝɢɞɪɨɥɨɝɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ, ɋ.-ɉɟɬɟɪɛɭɪɝ. E-mail: usachev@VU15040.spb.edu))
351
3.
4.
ɋɢɡɨɜ Ɉ.ɋ., ɉɥɚɬɨɧɨɜɚ ɋ.Ƚ., Ʉɨɲɟɥɟɜɚ ȿ.Ⱦ., Ƚɨɥɭɛɟɜɚ Ⱥ.Ȼ. Ɉɩɵɬ ɩɪɢɦɟɧɟɧɢɹ ɞɢɫɬɚɧɰɢɨɧɧɵɯ ɦɟɬɨɞɨɜ
ɞɥɹ ɨɰɟɧɤɢ ɷɤɨɥɨɝɢɱɟɫɤɢɯ ɪɢɫɤɨɜ ɬɪɚɧɫɝɪɚɧɢɱɧɵɯ ɛɚɫɫɟɣɧɨɜ (ɧɚ ɩɪɢɦɟɪɟ ɪ. ɂɪɬɵɲ)
Ⱥɛɪɨɫɢɦɨɜ Ⱥ.ȼ., Ⱦɜɨɪɤɢɧ Ȼ.Ⱥ. ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɞɚɧɧɵɯ ȾɁɁ ɢɡ ɤɨɫɦɨɫɚ ɞɥɹ ɦɨɧɢɬɨɪɢɧɝɚ ɜɨɞɧɵɯ ɨɛɴɟɤɬɨɜ // Ƚɟɨɩɪɨɮɢ, 2009, ɜɵɩ. 5. – ɋ. 40–45.
ɍȾɄ 681.3:631
ɂɇɎɈɊɆȺɐɂɈɇɇɕȿ ɌȿɏɇɈɅɈȽɂɂ
ȾɅə ɎɈɊɆɂɊɈȼȺɇɂə ɌȿɏɇɈɅɈȽɂɑȿɋɄɂɏ ɄȺɊɌ
ȻɈȻɊɈȼȺ Ɍ.ɇ., ɄɈɅɉȺɄɈȼȺ Ʌ.Ⱥ., ɅȺɉɑȿɇɄɈ ȿ.Ⱥ., ɂɋȺɄɈȼȺ ɋ.ɉ.,
ɎȽȻɇɍ «ɋɢɛɢɪɫɤɢɣ ɮɢɡɢɤɨ-ɬɟɯɧɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ ɚɝɪɚɪɧɵɯ ɩɪɨɛɥɟɦ»,
ɝ. ɇɨɜɨɫɢɛɢɪɫɤ, Ɋɨɫɫɢɹ, sibfti.n@ngs.ru
Ɉɞɧɢɦ ɢɡ ɜɚɠɧɟɣɲɢɯ ɧɚɩɪɚɜɥɟɧɢɣ ɜ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɟ ɢ ɟɝɨ ɪɚɞɢɤɚɥɶɧɨɦ ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɢ,
ɩɪɢɫɩɨɫɨɛɥɟɧɢɢ ɤ ɫɨɜɪɟɦɟɧɧɵɦ ɭɫɥɨɜɢɹɦ ɫɬɚɥɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɧɨɜɟɣɲɢɯ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɢ ɮɨɪɦɢɪɨɜɚɧɢɟ ɧɚ ɢɯ ɨɫɧɨɜɟ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɯ ɩɪɨɝɪɚɦɦɧɵɯ ɩɪɨɞɭɤɬɨɜ. ɗɬɨ ɩɨɡɜɨɥɢɬ ɨɫɭɳɟɫɬɜɢɬɶ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɣ ɪɚɫɱɟɬ ɡɚɬɪɚɬ ɧɚ ɩɪɨɢɡɜɨɞɫɬɜɨ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ
ɩɪɨɞɭɤɰɢɢ ɢ ɩɪɨɜɟɫɬɢ ɚɧɚɥɢɡ ɫɬɪɭɤɬɭɪɵ ɡɚɬɪɚɬ ɢ ɨɩɟɪɚɬɢɜɧɨ ɫɨɡɞɚɬɶ ɬɟɯɧɢɱɟɫɤɭɸ ɨɫɧɨɜɭ ɞɥɹ
ɚɞɚɩɬɚɰɢɢ ɢ ɨɩɬɢɦɢɡɚɰɢɢ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɪɟɲɟɧɢɣ [1].
ȼ ɎȽȻɇɍ ɋɢɛɢɪɫɤɢɣ ɮɢɡɢɤɨ-ɬɟɯɧɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ ɚɝɪɚɪɧɵɯ ɩɪɨɛɥɟɦ ɪɚɡɪɚɛɨɬɚɧɚ ɩɪɨɝɪɚɦɦɚ, ɩɨɡɜɨɥɹɸɳɚɹ: ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɬɶ ɩɪɨɰɟɫɫ ɮɨɪɦɢɪɨɜɚɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɤɚɪɬ; ɩɪɨɢɡɜɨɞɢɬɶ
ɪɚɫɱɟɬ ɡɚɬɪɚɬ ɧɚ ɨɩɥɚɬɭ ɬɪɭɞɚ, ɧɚ ɫɨɞɟɪɠɚɧɢɟ ɨɫɧɨɜɧɵɯ ɮɨɧɞɨɜ, ɪɚɫɯɨɞɚ ɝɨɪɸɱɟ-ɫɦɚɡɨɱɧɵɯ ɦɚɬɟɪɢɚɥɨɜ (ȽɋɆ) ɢ ɞɪɭɝɢɯ ɦɚɬɟɪɢɚɥɶɧɨ-ɞɟɧɟɠɧɵɯ ɡɚɬɪɚɬ; ɫɪɚɜɧɢɜɚɬɶ ɡɚɬɪɚɬɵ ɩɨ ɧɟɫɤɨɥɶɤɢɦ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɤɚɪɬɚɦ, ɧɚɝɥɹɞɧɨ ɩɪɟɞɫɬɚɜɥɹɬɶ ɪɟɡɭɥɶɬɚɬɵ ɫɪɚɜɧɟɧɢɹ [2]. Ɏɨɪɦɢɪɨɜɚɧɢɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɤɚɪɬɵ ɩɪɨɢɫɯɨɞɢɬ ɩɭɬɟɦ ɡɚɩɨɥɧɟɧɢɹ ɪɚɡɪɚɛɨɬɚɧɧɨɣ ɞɥɹ ɞɚɧɧɨɣ ɩɪɨɝɪɚɦɦɵ ɮɨɪɦɵ ɩɨ
ɤɚɠɞɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɨɩɟɪɚɰɢɢ ɜɯɨɞɹɳɟɣ ɜ ɬɟɯɧɨɥɨɝɢɱɟɫɤɭɸ ɤɚɪɬɭ.
ɉɨɥɶɡɨɜɚɬɟɥɸ ɧɟɨɛɯɨɞɢɦɨ ɡɚɩɨɥɧɢɬɶ ɩɨɥɹ: «ȼɢɞ ɪɚɛɨɬ» – ɧɚɢɦɟɧɨɜɚɧɢɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɨɩɟɪɚɰɢɢ (ɜɵɛɪɚɬɶ ɢɡ ɩɪɟɞɥɚɝɚɟɦɨɝɨ ɫɩɢɫɤɚ ɢɥɢ ɫɨɡɞɚɬɶ ɫɜɨɸ); «ɂɫɩɨɥɧɢɬɟɥɢ ɪɚɛɨɬɵ» (ɜɵɛɪɚɬɶ ɢɡ
ɩɪɟɞɥɚɝɚɟɦɨɝɨ ɫɩɢɫɤɚ ɢɥɢ ɜɜɟɫɬɢ ɫɜɨɢ ɞɚɧɧɵɟ ɨ ɪɚɛɨɬɧɢɤɚɯ, ɧɚɞɛɚɜɤɚɯ ɢ ɞɨɩɥɚɬɚɯ); «ɉɚɪɚɦɟɬɪɵ
ɪɚɛɨɬɵ» (ɨɛɴɟɦ ɪɚɛɨɬ – ɩɥɨɳɚɞɶ, ɫɪɨɤɢ, ɬɪɚɧɫɩɨɪɬɧɵɟ ɪɚɫɯɨɞɵ ɢ ɬ.ɞ.); «ȼɧɟɫɟɧɢɟ ɜɟɳɟɫɬɜ» – ɭɤɚɡɚɬɶ ɢɧɮɨɪɦɚɰɢɸ ɨ ɜɧɨɫɢɦɵɯ ɭɞɨɛɪɟɧɢɹɯ, ɢɯ ɫɬɨɢɦɨɫɬɢ ɢ ɤɨɥɢɱɟɫɬɜɟ. Ɂɚɬɟɦ ɩɪɨɝɪɚɦɦɚ ɪɚɫɫɱɢɬɵɜɚɟɬ ɜɫɟ ɜɨɡɦɨɠɧɵɟ ɡɚɬɪɚɬɵ ɩɨ ɞɚɧɧɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɨɩɟɪɚɰɢɢ ɢ ɡɚɧɨɫɢɬ ɷɬɭ ɢɧɮɨɪɦɚɰɢɸ
ɜ ɛɚɡɭ ɞɚɧɧɵɯ.
Ⱦɥɹ ɩɪɨɫɦɨɬɪɚ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɤɚɪɬ (ɩɨ ɜɫɟɦ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɨɩɟɪɚɰɢɹɦ, ɜɯɨɞɹɳɢɯ ɜ ɞɚɧɧɭɸ ɬɟɯɧɨɥɨɝɢɱɟɫɤɭɸ ɤɚɪɬɭ) ɢɫɩɨɥɶɡɭɟɬɫɹ ɮɨɪɦɚ, ɩɪɟɞɫɬɚɜɥɟɧɧɚɹ ɧɚ ɪɢɫɭɧɤɟ 1.
Ɋɢɫ. 1. Ɏɨɪɦɚ ɞɥɹ ɩɪɨɫɦɨɬɪɚ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɤɚɪɬ
ȼ ɮɨɪɦɟ ɦɨɠɧɨ ɩɪɨɫɦɨɬɪɟɬɶ ɡɧɚɱɟɧɢɹ ɡɚɬɪɚɬ ɩɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɤɚɪɬɟ ɤɚɤ ɜ ɨɛɳɟɦ ɜɢɞɟ (ɫɜɨɞɧɵɟ ɡɚɬɪɚɬɵ) ɬɚɤ ɢ ɩɨ ɨɬɞɟɥɶɧɵɦ ɫɬɚɬɶɹɦ ɪɚɫɯɨɞɨɜ (ɡɚɬɪɚɬɵ ɬɪɭɞɚ, ɡɚɬɪɚɬɵ: ɧɚ ȽɋɆ, ɬɪɚɧɫɩɨɪɬ,
352
ɫɟɦɟɧɚ ɢ ɬ.ɞ.). ɋɭɳɟɫɬɜɭɟɬ ɜɨɡɦɨɠɧɨɫɬɶ ɤɨɪɪɟɤɬɢɪɨɜɤɢ ɥɸɛɨɣ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɨɩɟɪɚɰɢɢ (ɞɨɛɚɜɢɬɶ, ɭɞɚɥɢɬɶ ɢɥɢ ɨɬɪɟɞɚɤɬɢɪɨɜɚɬɶ).
Ⱦɥɹ ɧɚɝɥɹɞɧɨɫɬɢ ɪɟɡɭɥɶɬɚɬɨɜ ɫɪɚɜɧɟɧɢɹ ɪɚɡɥɢɱɧɵɯ ɜɢɞɨɜ ɡɚɬɪɚɬ ɩɨ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɨɩɟɪɚɰɢɹɦ ɜ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɤɚɪɬɟ, ɚ ɬɚɤɠɟ ɫɪɚɜɧɟɧɢɹ ɡɚɬɪɚɬ ɩɨ ɧɟɫɤɨɥɶɤɢɦ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɤɚɪɬɚɦ
ɩɪɟɞɭɫɦɨɬɪɟɧɨ ɢɯ ɝɪɚɮɢɱɟɫɤɨɟ ɩɪɟɞɫɬɚɜɥɟɧɢɟ (ɪɢɫɭɧɨɤ 2).
Ɋɢɫ. 2. Ƚɪɚɮɢɱɟɫɤɨɟ ɩɪɟɞɫɬɚɜɥɟɧɢɟ ɡɚɬɪɚɬ
ɉɪɨɝɪɚɦɦɚ ɩɨɡɜɨɥɹɟɬ ɷɤɫɩɨɪɬɢɪɨɜɚɬɶ ɬɟɯɧɨɥɨɝɢɱɟɫɤɭɸ ɤɚɪɬɭ ɢɥɢ ɟɟ ɮɪɚɝɦɟɧɬɵ ɜ MS Excel ɢ
MS Word.
Ⱦɨɫɬɨɢɧɫɬɜɚɦɢ ɞɚɧɧɨɣ ɩɪɨɝɪɚɦɦɵ ɹɜɥɹɟɬɫɹ ɬɨ, ɱɬɨ ɨɧɚ ɡɧɚɱɢɬɟɥɶɧɨ ɫɧɢɠɚɟɬ ɜɪɟɦɹ ɢ ɬɪɭɞɨɜɵɟ
ɡɚɬɪɚɬɵ ɧɚ ɫɨɫɬɚɜɥɟɧɢɟ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɤɚɪɬ, ɩɨɡɜɨɥɹɟɬ ɫɩɟɰɢɚɥɢɫɬɭ ɩɪɚɜɢɥɶɧɨ ɩɪɢɧɹɬɶ ɪɟɲɟɧɢɟ ɩɨ ɪɚɫɩɪɟɞɟɥɟɧɢɸ ɞɟɧɟɠɧɵɯ ɢ ɦɚɬɟɪɢɚɥɶɧɨ-ɬɟɯɧɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ ɞɥɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ ɡɚ ɫɱɟɬ ɨɩɟɪɚɬɢɜɧɨɝɨ ɩɪɟɞɫɬɚɜɥɟɧɢɹ ɢɧɮɨɪɦɚɰɢɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
Ȼɨɛɪɨɜɚ Ɍ.ɇ., Ʉɨɥɩɚɤɨɜɚ Ʌ.Ⱥ. Ⱥɥɝɨɪɢɬɦ ɩɨɞɛɨɪɚ ɬɟɯɧɢɤɢ ɞɥɹ ɜɵɩɨɥɧɟɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɨɩɟɪɚɰɢɣ
ɜ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɟ // ȼɟɫɬɧɢɤ ɇɨɜɨɫɢɛɢɪɫɤɨɝɨ ɝɨɫɭɞɚɪɫɬɜɟɧɧɨɝɨ ɚɝɪɚɪɧɨɝɨ ɭɧɢɜɟɪɫɢɬɟɬɚ. – 2014. –
ʋ 4 (33). – ɋ. 161–167.
Ʌɚɩɱɟɧɤɨ ȿ.Ⱥ., Ȼɨɛɪɨɜɚ Ɍ.ɇ., Ʉɨɥɩɚɤɨɜɚ Ʌ.Ⱥ., ɂɫɚɤɨɜɚ ɋ.ɉ. Ʉɨɦɩɶɸɬɟɪɧɚɹ ɩɪɨɝɪɚɦɦɚ ɞɥɹ ɮɨɪɦɢɪɨɜɚɧɢɹ ɬɟɯɧɨɥɨɝɢɱɟɫɤɨɣ ɤɚɪɬɵ ɜ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɟ. // ɋɢɛɢɪɫɤɢɣ ɜɟɫɬɧɢɤ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɧɚɭɤɢ. –
2013. – ʋ 4. – ɋ. 64-69.
ɍȾɄ 634. 1/7
ɂɋɉɈɅɖɁɈȼȺɇɂȿ ȽȿɈɂɇɎɈɊɆȺɐɂɈɇɇɕɏ ɋɂɋɌȿɆ
ȾɅə ɈɉɊȿȾȿɅȿɇɂə ɉɈɌȿɇɐɂȺɅȺ ɊȺɁȼɂɌɂə
ɉɅɈȾɈȼɈȾɋɌȼȺ ɇȺ ɘȽȿ ɂ ɘȽɈ-ȼɈɋɌɈɄȿ ɄȺɁȺɏɋɌȺɇȺ
ɄȺȻɕɅȻȿɄɈȼȺ Ȼ.ɒ., ɄȺɊɕɑȿȼ Ɋ.Ʉ., əɄɍɒɄɂɇȺ ȼ.Ɇ., ɆȺɄȿȿȼ Ɋ.ȿ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɩɥɨɞɨɜɨɞɫɬɜɚ
ɢ ɜɢɧɨɝɪɚɞɚɪɫɬɜɚ» ɝ. Ⱥɥɦɚɬɵ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ
Ɇɚɫɬɟɪ-ɩɥɚɧ «ɉɥɨɞɨɜɨɞɫɬɜɨ» ɩɪɨɝɪɚɦɦɵ Ɇɋɏ ɊɄ «Ⱥɝɪɨɛɢɡɧɟɫ-2020» ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬ ɩɨɷɬɚɩɧɨɟ ɭɜɟɥɢɱɟɧɢɟ ɩɥɨɳɚɞɟɣ ɩɨɞ ɫɚɞɚɦɢ ɫ ɫɭɛɫɢɞɢɪɨɜɚɧɢɟɦ ɱɚɫɬɢ ɡɚɬɪɚɬ ɧɚ ɡɚɤɥɚɞɤɭ, ɭɯɨɞ ɡɚ
ɩɨɫɚɞɤɚɦɢ ɞɨ ɩɥɨɞɨɧɨɲɟɧɢɹ, ɪɟɚɥɢɡɭɟɬɫɹ ɤɨɦɩɥɟɤɫ ɦɟɪɨɩɪɢɹɬɢɣ ɩɨ ɪɚɡɜɢɬɢɸ ȺɉɄ – ɜɵɞɟɥɹɸɬɫɹ ɢɧɜɟɫɬɢɰɢɢ ɧɚ ɩɨɞɞɟɪɠɤɭ ɷɤɫɩɨɪɬɧɨ-ɨɪɢɟɧɬɢɪɨɜɚɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɥɨɞɨɜɨɣ ɩɪɨɞɭɤ353
ɰɢɢ. Ʉɚɡɚɯɫɤɢɦ ɇɂɂ ɩɥɨɞɨɜɨɞɫɬɜɚ ɢ ɜɢɧɨɝɪɚɞɚɪɫɬɜɚ ɪɚɡɪɚɛɨɬɚɧɵ ɢ ɜɧɟɞɪɟɧɵ ɜ ɯɨɡɹɣɫɬɜɚɯ
Ⱥɥɦɚɬɢɧɫɤɨɣ, ɀɚɦɛɵɥɫɤɨɣ, ɘɠɧɨ-Ʉɚɡɚɯɫɬɚɧɫɤɨɣ ɨɛɥɚɫɬɟɣ ɸɝɚ ɬɟɯɧɨɥɨɝɢɢ ɜɵɪɚɳɢɜɚɧɢɹ ɩɥɨɞɨɜ
ɜ ɢɧɬɟɧɫɢɜɧɵɯ, ɲɩɚɥɟɪɧɨ-ɤɚɪɥɢɤɨɜɵɯ ɫɚɞɚɯ ɧɚ ɤɚɩɟɥɶɧɨɦ ɨɪɨɲɟɧɢɢ, ɩɨɞɨɛɪɚɧɵ ɧɚɢɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɵɟ ɫɨɪɬɨ-ɩɨɞɜɨɣɧɵɟ ɤɨɦɛɢɧɚɰɢɢ, ɚɞɚɩɬɢɪɨɜɚɧɧɵɟ ɤ ɭɫɥɨɜɢɹɦ ɜɵɪɚɳɢɜɚɧɢɹ, ɨɩɬɢɦɚɥɶɧɵɟ
ɤɨɧɫɬɪɭɤɰɢɢ ɧɚɫɚɠɞɟɧɢɣ, ɫɢɫɬɟɦɵ ɮɨɪɦɢɪɨɜɚɧɢɹ, ɨɛɪɟɡɤɢ ɤɪɨɧɵ, ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɜɨɞɨɫɛɟɪɟɝɚɸɳɟɝɨ ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ, ɩɨɜɵɲɚɸɳɟɝɨ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶ ɫɚɞɚ ɜ 2–2,5 ɪɚɡɚ. ɉɪɢ ɩɨɞɞɟɪɠɤɟ ɦɟɠɞɭɧɚɪɨɞɧɨɝɨ ɩɪɨɟɤɬɚ UNEP-GEF Bioversity International, ɝɪɚɧɬɚ ɆɈɇ ɊɄ, ɭɱɟɧɵɯ INRA-Center,
Bordeaux, Ɏɪɚɧɰɢɹ, Apios Institute, ɋɒȺ, Hebrew University of Jerusalem, ɂɡɪɚɢɥɶ, East-Malling
Research Station, ȼɟɥɢɤɨɛɪɢɬɚɧɢɹ ɩɪɨɜɟɞɟɧɵ ɫɨɜɦɟɫɬɧɵɟ ɷɤɫɩɟɞɢɰɢɨɧɧɵɟ ɨɛɫɥɟɞɨɜɚɧɢɹ ɦɚɫɫɢɜɨɜ ɫɚɞɨɜ ɪɟɝɢɨɧɚ. ɋɨɡɞɚɧɚ ɷɥɟɤɬɪɨɧɧɚɹ ɛɚɡɚ ɞɚɧɧɵɯ ɯɨɡɹɣɫɬɜ, ɢɦɟɸɳɢɯ ɬɨɜɚɪɧɵɟ ɫɚɞɵ ɩɨ ɞɟɫɤɪɢɩɬɨɪɚɦ: ɝɟɨɝɪɚɮɢɱɟɫɤɢɟ ɤɨɨɪɞɢɧɚɬɵ ɯɨɡɹɣɫɬɜɚ, ɫɨɪɬ, ɩɨɞɜɨɣ, ɩɥɨɳɚɞɶ ɫɚɞɚ, ɩɥɨɬɧɨɫɬɶ ɩɨɫɚɞɤɢ, ɭɪɨɜɟɧɶ ɚɝɪɨɬɟɯɧɢɤɢ, ɭɪɨɠɚɣɧɨɫɬɶ, ɪɟɧɬɚɛɟɥɶɧɨɫɬɶ. ȼ ɩɪɨɝɪɚɦɦɟ DIVA-GIS 7.5 ɩɪɨɜɟɞɟɧ
ɩɪɨɫɬɪɚɧɫɬɜɟɧɧɵɣ ɫɬɚɬɢɫɬɢɱɟɫɤɢɣ ɚɧɚɥɢɡ ɤɚɠɞɨɝɨ ɞɟɫɤɪɢɩɬɨɪɚ, ɫɨɡɞɚɧɵ ɷɥɟɤɬɪɨɧɧɵɟ ɤɚɪɬɵ. ɉɨ
ɚɥɝɨɪɢɬɦɭ ɞɟɫɤɪɢɩɬɨɪɨɜ ɩɪɨɜɟɞɟɧɨ ɦɨɞɟɥɢɪɨɜɚɧɢɟ ɢ ɨɩɪɟɞɟɥɟɧɚ ɷɤɨɧɨɦɢɱɟɫɤɚɹ ɷɮɮɟɤɬɢɜɧɨɫɬɶ
ɜɵɪɚɳɢɜɚɧɢɹ ɫɚɞɨɜ ɜ ɪɟɝɢɨɧɟ. ȼ ɢɧɬɟɪɚɤɬɢɜɧɵɯ ɤɚɪɬɚɯ ɪɟɥɶɟɮɚ, ɩɨɱɜ, ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɭɫɥɨɜɢɣ,
ɝɟɧɟɬɢɱɟɫɤɢɯ, ɪɚɫɬɢɬɟɥɶɧɵɯ, ɜɨɞɧɵɯ ɪɟɫɭɪɫɨɜ, ɬɪɟɛɨɜɚɧɢɣ ɩɥɨɞɨɜɵɯ ɤɭɥɶɬɭɪ ɤ ɭɫɥɨɜɢɹɦ ɩɪɨɢɡɪɚɫɬɚɧɢɹ ɨɩɪɟɞɟɥɟɧɵ ɧɚɢɛɨɥɟɟ ɩɪɢɝɨɞɧɵɟ ɡɟɦɥɢ ɞɥɹ ɡɚɤɥɚɞɤɢ ɢɧɬɟɧɫɢɜɧɵɯ, ɚɞɚɩɬɢɜɧɵɯ, ɨɪɝɚɧɢɱɟɫɤɢɯ, ɤɨɪɧɟɫɨɛɫɬɜɟɧɧɵɯ ɫɚɞɨɜ. ɍɫɬɚɧɨɜɥɟɧ ɩɨɬɟɧɰɢɚɥ ɪɚɡɜɢɬɢɹ ɩɥɨɞɨɜɨɞɫɬɜɚ ɧɚ ɸɝɟ ɢ ɸɝɨɜɨɫɬɨɤɟ Ʉɚɡɚɯɫɬɚɧɚ ɤɚɤ ɢɧɬɟɝɪɚɥɶɧɨɟ ɜɵɪɚɠɟɧɢɟ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɫɭɳɟɫɬɜɭɸɳɢɯ
ɫɚɞɨɜ, ɪɚɡɪɚɛɨɬɚɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɢ ɧɚɥɢɱɢɹ ɫɚɞɨɩɪɢɝɨɞɧɵɯ ɡɟɦɟɥɶ (ɪɢɫɭɧɨɤ).
Ɋɢɫ. 1. ɉɨɬɟɧɰɢɚɥ ɪɚɡɜɢɬɢɹ ɩɥɨɞɨɜɨɞɫɬɜɚ ɧɚ ɸɝɟ, ɸɝɨ-ɜɨɫɬɨɤɟ Ʉɚɡɚɯɫɬɚɧɚ
ɉɨ ɤɨɦɩɥɟɤɫɭ ɩɨɱɜɟɧɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɯ, ɷɤɨɥɨɝɢɱɟɫɤɢɯ, ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɩɨɤɚɡɚɬɟɥɟɣ ɞɥɹ
ɛɨɥɶɲɢɧɫɬɜɚ ɫɨɪɬɨɜ ɹɛɥɨɧɢ ɧɚɢɛɨɥɟɟ ɩɪɢɝɨɞɧɵ ɩɪɟɞɝɨɪɶɹ Ɍɚɥɝɚɪɫɤɨɝɨ, ȿɧɛɟɤɲɢɤɚɡɚɯɫɤɨɝɨ,
Ʉɚɪɚɫɚɣɫɤɨɝɨ, ɀɚɦɛɵɥɫɤɨɝɨ, ɍɣɝɭɪɫɤɨɝɨ, ɋɚɪɤɚɧɞɫɤɨɝɨ, Ɍɚɥɞɵɤɨɪɝɚɧɫɤɨɝɨ, ɉɚɧɮɢɥɨɜɤɨɝɨ ɪɚɣɨɧɨɜ Ⱥɥɦɚɬɢɧɫɤɨɣ ɨɛɥɚɫɬɢ ɧɚ ɩɥɨɳɚɞɢ ɫɜɵɲɟ 12 ɬɵɫɹɱ ɝɟɤɬɚɪ ɡɟɦɟɥɶ, Ɇɟɪɤɟɧɫɤɨɝɨ, Ɋɵɫɤɭɥɨɜɫɤɨɝɨ,
Ʉɨɪɞɚɣɫɤɨɝɨ ɪɚɣɨɧɨɜ ɀɚɦɛɵɥɫɤɨɣ ɨɛɥɚɫɬɢ ɧɚ ɩɥɨɳɚɞɢ ɛɨɥɟɟ 5 ɬɵɫɹɱ ɝɟɤɬɚɪ, Ɍɸɥɤɭɛɚɫɫɤɨɝɨ,
ɋɚɣɪɚɦɫɤɨɝɨ, ɋɚɪɵɚɝɚɲɫɤɨɝɨ, Ⱥɪɵɫɫɤɨɝɨ, Ʉɚɡɵɝɭɪɬɫɤɨɝɨ ɪɚɣɨɧɨɜ ɘɠɧɨ-Ʉɚɡɚɯɫɬɚɧɫɤɨɣ ɨɛɥɚɫɬɢ – 15 ɬɵɫɹɱ ɝɟɤɬɚɪ. ȼ ɩɪɟɞɟɥɚɯ ɜɵɫɨɬ 900–1200 ɦ ɧɚɞ ɭɪɨɜɧɟɦ ɦɨɪɹ ɰɟɥɟɫɨɨɛɪɚɡɧɨ ɡɚɤɥɚɞɵɜɚɬɶ ɫɚɞɵ Ⱥɩɨɪɬɚ ɩɨ ɢɧɧɨɜɚɰɢɨɧɧɵɦ ɬɟɯɧɨɥɨɝɢɹɦ: ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɨɬɛɨɪɧɵɯ ɮɨɪɦ, ɜɵɞɟɥɟɧɧɵɯ
Ʉɚɡɚɯɫɤɢɦ ɇɂɂ ɩɥɨɞɨɜɨɞɫɬɜɚ ɢ ɜɢɧɨɝɪɚɞɚɪɫɬɜɚ, ɫɪɟɞɧɟɪɨɫɥɵɯ – ɆɆ 106 ɢ ɫɥɚɛɨɪɨɫɥɵɯ – Ȼ 7–35
ɩɨɞɜɨɹɯ ɫ ɭɩɥɨɬɧɟɧɧɨɣ ɫɯɟɦɨɣ ɩɨɫɚɞɤɢ ɢ ɩɨɥɭɩɥɨɫɤɨɣ ɫɢɫɬɟɦɨɣ ɮɨɪɦɢɪɨɜɚɧɢɹ ɤɪɨɧɵ, ɚɞɚɩɬɢɪɨɜɚɧɧɨɣ ɤ ɦɟɫɬɧɨɣ ɪɨɡɟ ɜɟɬɪɨɜ, ɪɟɝɭɥɢɪɭɟɦɵɦ ɜɨɞɧɨ-ɩɢɬɚɬɟɥɶɧɵɦ ɪɟɠɢɦɨɦ. ȼ ɩɪɟɞɝɨɪɧɨɣ ɡɨɧɟ
ɧɚ ɧɚɢɥɭɱɲɢɯ ɩɨɱɜɚɯ ɧɚɢɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɚ ɡɚɤɥɚɞɤɚ ɢɧɬɟɧɫɢɜɧɵɯ ɫɚɞɨɜ ɧɚ ɫɥɚɛɨɪɨɫɥɵɯ ɤɥɨɧɨɜɵɯ ɩɨɞɜɨɹɯ Ɇ9, Ⱥɪɦ.18, 62–396 ɫ ɩɥɨɬɧɨɫɬɶɸ ɩɨɫɚɞɤɢ 2000–2500 ɞɟɪɟɜɶɟɜ ɧɚ ɝɟɤɬɚɪ, ɫɢɫɬɟɦɨɣ
ɮɨɪɦɢɪɨɜɚɧɢɹ ɜɟɪɟɬɟɧɨɜɢɞɧɵɯ ɤɪɨɧ ɢ ɭɪɨɠɚɣɧɨɫɬɶɸ 40–60 ɬ/ɝɚ. ɉɨɫɥɟ ɩɨɥɭɱɟɧɢɹ 5-6 ɬɨɜɚɪɧɵɯ
354
ɭɪɨɠɚɟɜ ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬɫɹ ɰɢɤɥɢɱɟɫɤɚɹ ɨɦɨɥɚɠɢɜɚɸɳɚɹ ɨɛɪɟɡɤɚ ɱɚɫɬɢ ɩɪɢɪɨɫɬɚ, ɩɪɨɞɥɹɸɳɚɹ
ɩɪɨɞɭɤɬɢɜɧɵɣ ɩɟɪɢɨɞ ɟɳɟ ɧɚ 6–7 ɥɟɬ. ɇɚ ɨɬɧɨɫɢɬɟɥɶɧɨ ɩɪɢɝɨɞɧɵɯ ɞɥɹ ɩɥɨɞɨɜɨɞɫɬɜɚ ɡɟɦɥɹɯ ɢ
ɜ ɡɨɧɚɯ ɫ ɫɢɥɶɧɵɦɢ ɜɟɬɪɚɦɢ ɷɮɮɟɤɬɢɜɧɚ ɡɚɤɥɚɞɤɚ ɫɚɞɨɜ ɩɨ ɪɟɫɭɪɫɨɫɛɟɪɟɝɚɸɳɢɦ ɬɟɯɧɨɥɨɝɢɹɦ
– ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɜɵɫɨɤɨɚɞɚɩɬɢɜɧɨɝɨ ɤɥɨɧɨɜɨɝɨ ɩɨɞɜɨɹ ɀɟɬɵɫɭ-5, ɧɟ ɬɪɟɛɭɸɳɟɝɨ ɨɩɨɪɵ, ɫɢɫɬɟɦɵ
ɤɚɩɟɥɶɧɨɝɨ ɨɪɨɲɟɧɢɹ.
ɍɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ɜ ɰɟɥɹɯ ɷɮɮɟɤɬɢɜɧɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɫɚɞɨɩɪɢɝɨɞɧɵɯ ɡɟɦɟɥɶ ɧɟɨɛɯɨɞɢɦɚ ɞɢɜɟɪɫɢɮɢɤɚɰɢɹ ɫɬɪɭɤɬɭɪɵ ɩɨɫɟɜɧɵɯ ɩɥɨɳɚɞɟɣ – ɡɚɦɟɧɚ ɧɢɡɤɨɪɟɧɬɚɛɟɥɶɧɵɯ ɤɭɥɶɬɭɪ ɢɧɬɟɧɫɢɜɧɵɦɢ
ɫɚɞɚɦɢ, ɜɨɜɥɟɱɟɧɢɟ ɜ ɫɚɞɨɨɛɨɪɨɬ ɩɭɫɬɵɪɟɣ, ɨɬɝɨɧɨɜ, ɦɚɥɨɩɪɨɞɭɤɬɢɜɧɵɯ ɩɚɫɬɛɢɳ. Ⱦɥɹ ɭɩɪɚɜɥɟɧɢɹ ɪɟɫɭɪɫɚɦɢ ɢ ɫɛɵɬɨɦ ɩɪɨɞɭɤɰɢɢ ɧɟɨɛɯɨɞɢɦɚ ɤɨɨɩɟɪɚɰɢɹ ɯɨɡɹɣɫɬɜ. ɋɨɜɦɟɫɬɧɨɟ ɩɪɨɢɡɜɨɞɫɬɜɨ,
ɥɢɡɢɧɝ ɬɟɯɧɢɤɢ ɩɪɢ ɧɟɛɨɥɶɲɢɯ ɩɥɨɳɚɞɹɯ ɫɚɞɨɜ ɢ ɝɚɪɚɧɬɢɪɨɜɚɧɧɵɣ ɫɛɵɬ ɩɪɨɞɭɤɰɢɢ ɫɨɡɞɚɸɬ ɭɫɥɨɜɢɹ ɭɫɬɨɣɱɢɜɨɝɨ ɪɚɡɜɢɬɢɹ ɚɫɫɨɰɢɚɰɢɢ, ɤɨɨɩɟɪɚɬɢɜɚ. ɇɚɢɛɨɥɟɟ ɪɟɧɬɚɛɟɥɶɧɵɦɢ ɢ ɷɤɨɧɨɦɢɱɟcɤɢ
ɷɮɮɟɤɬɢɜɧɵɦɢ ɧɚ ɸɝɟ, ɸɝɨ-ɜɨɫɬɨɤɟ Ʉɚɡɚɯɫɬɚɧɚ ɹɜɥɹɸɬɫɹ ɯɨɡɹɣɫɬɜɚ, ɢɦɟɸɳɢɟ ɢɧɬɟɧɫɢɜɧɵɟ ɫɚɞɵ
ɩɥɨɳɚɞɶɸ ɛɨɥɟɟ 10 ɝɟɤɬɚɪ, ɜɵɫɨɤɢɦ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɦ ɭɪɨɜɧɟɦ, ɭɝɥɭɛɥɟɧɧɨɣ ɫɩɟɰɢɚɥɢɡɚɰɢɟɣ
ɩɪɨɢɡɜɨɞɫɬɜɚ. ɇɟɨɛɯɨɞɢɦɨ ɩɨɜɵɲɚɬɶ ɢɧɮɨɪɦɢɪɨɜɚɧɧɨɫɬɶ ɮɟɪɦɟɪɨɜ ɨ ɦɚɬɟɪɢɚɥɶɧɨ-ɮɢɧɚɧɫɨɜɵɯ,
ɩɨɱɜɟɧɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɢɯ, ɷɤɨɥɨɝɢɱɟɫɤɢɯ, ɸɪɢɞɢɱɟɫɤɢɯ, ɢɧɬɟɪɧɟɬ ɪɟɫɭɪɫɚɯ ɞɥɹ ɭɫɬɨɣɱɢɜɨɝɨ ɫɢɫɬɟɦɧɨɝɨ ɪɚɡɜɢɬɢɹ ɩɥɨɞɨɜɨɞɫɬɜɚ.
ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɝɟɨɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɫɢɫɬɟɦ ɜ ɚɝɪɨɢɧɞɭɫɬɪɢɢ ɛɭɞɟɬ ɫɩɨɫɨɛɫɬɜɨɜɚɬɶ ɜɵɩɨɥɧɟɧɢɸ ɩɪɟɞɭɫɦɨɬɪɟɧɧɨɝɨ «Ɇɚɫɬɟɪ-ɩɥɚɧɨɦ» ɡɚɞɚɱ ɩɨ ɭɜɟɥɢɱɟɧɢɸ ɩɥɨɳɚɞɟɣ ɡɚɤɥɚɞɤɢ ɫɚɞɨɜ ɢ ɫɨɡɞɚɧɢɸ ɩɭɥɚ ɩɨ ɷɤɫɩɨɪɬɧɨ-ɨɪɢɟɧɬɢɪɨɜɚɧɧɨɦɭ ɩɪɨɢɡɜɨɞɫɬɜɭ ɩɥɨɞɨɜ.
ɍȾɄ 551.58:631.58
ȺȾȺɉɌȺɐɂɈɇɇɕȿ ȾɂɇȺɆɂɑȿɋɄɂȿ ɆɈȾȿɅɂ
ɈɉɌɂɆɂɁȺɐɂɂ ɂɋɉɈɅɖɁɈȼȺɇɂə
ȺȽɊɈɄɅɂɆȺɌɂɑȿɋɄɂɏ ɊȿɋɍɊɋɈȼ
ɉɈɇɖɄɈ ȼ.Ⱥ., ɄȺɅɂɑɄɂɇ ȼ.Ʉ.*, ɂȼȺɇɈȼȺ Ɇ.ɂ., ɏɂɁȺɆȿɌȾɂɇɈȼ ɋ.ȼ.,
ɎȽȻɇɍ «ɋɢɛɢɪɫɤɢɣ ɇɂɂ ɡɟɦɥɟɞɟɥɢɹ ɢ ɯɢɦɢɡɚɰɢɢ»,
*ɎȽȻɍ «ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ»,
Ɋɨɫɫɢɹ, ɇɨɜɨɫɢɛɢɪɫɤɚɹ ɨɛɥ., ɩ. Ʉɪɚɫɧɨɨɛɫɤ, e-mail: sair49@yandex.ru
Ⱥɞɚɩɬɚɰɢɨɧɧɵɟ ɦɨɞɟɥɢ ɧɟɨɛɯɨɞɢɦɵ ɞɥɹ ɨɛɨɫɧɨɜɚɧɢɹ ɦɟɪɨɩɪɢɹɬɢɣ, ɧɚɩɪɚɜɥɟɧɧɵɯ ɧɚ ɩɨɜɵɲɟɧɢɟ ɭɫɬɨɣɱɢɜɨɫɬɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɡɚ ɫɱɟɬ ɩɪɢɧɹɬɢɹ ɢ ɪɟɚɥɢɡɚɰɢɢ ɝɢɛɤɢɯ ɯɨɡɹɣɫɬɜɟɧɧɵɯ ɪɟɲɟɧɢɣ ɩɪɢ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ. ȼ ɨɩɵɬɟ ɩɨɫɬɪɨɟɧɢɹ ɷɬɢɯ
ɦɨɞɟɥɟɣ ɛɵɥɢ ɢɫɩɨɥɶɡɨɜɚɧɵ ɜɟɪɨɹɬɧɨɫɬɧɵɟ (ɫɬɨɯɚɫɬɢɱɟɫɤɢɟ) ɫɯɟɦɵ [1], ɤɨɬɨɪɵɟ ɨɞɧɚɤɨ ɧɟ ɩɨɡɜɨɥɹɸɬ ɪɚɫɫɱɢɬɵɜɚɬɶ ɛɢɡɧɟɫ-ɩɥɚɧɵ ɧɚ ɝɨɞɵ ɜɩɟɪɟɞ, ɩɨɫɤɨɥɶɤɭ ɜ ɧɢɯ ɧɟ ɭɱɢɬɵɜɚɟɬɫɹ ɢɡɦɟɧɱɢɜɨɫɬɶ
ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ ɢ ɨɩɪɟɞɟɥɹɟɦɚɹ ɟɣ ɭɪɨɠɚɣɧɨɫɬɶ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɤɭɥɶɬɭɪ.
Ɋɟɚɥɶɧɚɹ ɚɞɚɩɬɚɰɢɹ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ, ɡɟɦɥɟɞɟɥɢɹ ɢ ɜɨɞɧɵɯ ɦɟɥɢɨɪɚɰɢɣ ɤ ɢɡɦɟɧɱɢɜɨɫɬɢ ɩɪɢɪɨɞɧɨɣ ɫɪɟɞɵ ɜɨɡɦɨɠɧɚ ɩɭɬɟɦ ɝɢɛɤɨɣ ɩɪɢɜɹɡɤɢ ɚɝɪɨɬɟɯɧɨɥɨɝɢɣ ɫ ɩɨɦɨɳɶɸ ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɯ ɩɪɨɝɧɨɡɨɜ ɧɚ ɞɜɚ ɢ ɛɨɥɟɟ ɜɟɝɟɬɚɰɢɨɧɧɵɯ ɫɟɡɨɧɚ ɜɩɟɪɟɞ. Ɋɟɲɟɧɢɟ ɩɪɨɝɧɨɫɬɢɱɟɫɤɨɣ ɩɪɨɛɥɟɦɵ ɞɟɥɚɟɬ
ɜɨɡɦɨɠɧɵɦ ɩɨɫɬɪɨɟɧɢɟ ɚɞɚɩɬɚɰɢɨɧɧɵɯ ɞɢɧɚɦɢɱɟɫɤɢɯ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɦɨɞɟɥɟɣ. ɂɧɮɨɪɦɚɰɢɨɧɧɨɣ
ɨɫɧɨɜɨɣ ɦɨɞɟɥɟɣ, ɩɪɟɞɧɚɡɧɚɱɟɧɧɵɯ ɞɥɹ ɨɩɬɢɦɢɡɚɰɢɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ, ɦɨɝɭɬ ɛɵɬɶ ɤɥɢɦɚɬɢɱɟɫɤɢɟ ɦɨɞɟɥɢ [2,3] ɢ ɩɪɨɝɧɨɡɵ, ɪɚɫɫɱɢɬɵɜɚɟɦɵɟ ɩɨ ɷɤɫɬɪɚɩɨɥɹɰɢɢ ɧɚ
ɛɭɞɭɳɟɟ ɝɟɨɤɨɫɦɢɱɟɫɤɢɯ ɫɜɹɡɟɣ [4,5]. Ƚɟɨɤɨɫɦɢɱɟɫɤɢɟ ɫɜɹɡɢ ɜ ɞɚɧɧɨɦ ɫɥɭɱɚɟ ɩɪɟɞɫɬɚɜɥɹɸɬ ɫɨɛɨɣ
ɡɚɜɢɫɢɦɨɫɬɢ ɦɟɠɞɭ ɦɧɨɝɨɥɟɬɧɢɦɢ ɯɚɪɚɤɬɟɪɢɫɬɢɤɚɦɢ ɬɟɩɥɨ-ɜɥɚɝɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɢ ɭɪɨɠɚɣɧɨɫɬɢ
ɤɭɥɶɬɭɪ, ɫ ɨɞɧɨɣ ɫɬɨɪɨɧɵ, ɢ ɫɨɥɧɟɱɧɨ-ɩɥɚɧɟɬɨ-ɥɭɧɧɨ-ɨɛɭɫɥɨɜɥɟɧɧɵɦɢ ɮɚɤɬɨɪɚɦɢ, ɫ ɞɪɭɝɨɣ ɫɬɨɪɨɧɵ. Ʉɨɫɦɢɱɟɫɤɢɟ ɮɚɤɬɨɪɵ ɪɚɫɫɱɢɬɵɜɚɸɬɫɹ ɜ ɩɪɨɲɥɨɟ ɢ ɧɚ ɛɭɞɭɳɟɟ ɧɚ ɞɟɬɟɪɦɢɧɢɫɬɢɱɟɫɤɨɣ
ɨɫɧɨɜɟ ɫɨɝɥɚɫɧɨ ɤɚɧɨɧɚɦ ɧɟɛɟɫɧɨɣ ɦɟɯɚɧɢɤɢ.
ȼɧɚɱɚɥɟ ɩɪɨɜɨɞɢɬɫɹ ɚɧɚɥɢɡ ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ ɪɚɣɨɧɨɜ (ɪɟɝɢɨɧɨɜ) ɜ ɪɚɦɤɚɯ ɦɨɞɟɥɢ,
ɫɜɹɡɵɜɚɸɳɟɣ ɩɚɪɚɦɟɬɪɵ ɤɥɢɦɚɬɚ, ɩɨɱɜɟɧɧɨɝɨ ɩɨɤɪɨɜɚ ɢ ɭɪɨɠɚɣɧɨɫɬɢ [3]. Ʉɥɢɦɚɬɢɱɟɫɤɢ ɨɛɟɫɩɟɱɟɧɧɚɹ ɭɪɨɠɚɣɧɨɫɬɶ (V), ɜɵɪɚɠɟɧɧɚɹ ɜ ɡɟɪɧɨɜɵɯ ɟɞɢɧɢɰɚɯ ɛɟɡ ɭɱɟɬɚ ɜɢɞɨɜɵɯ ɢ ɫɨɪɬɨɜɵɯ ɨɫɨɛɟɧɧɨɫɬɟɣ ɤɭɥɶɬɭɪ, ɪɚɫɫɱɢɬɵɜɚɟɬɫɹ ɩɨ ɮɨɪɦɭɥɟ:
V
1
0 K t (e
V
1
0 K t (e
k y ˜kɪ˜p
(1 / k y )˜kɪ˜p
1) ,
ɟɫɥɢ ky < 1,
1) , ɟɫɥɢ ky > 1,
355
ɝɞɟ Kt – ɤɨɷɮɮɢɰɢɟɧɬ ɬɟɩɥɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ – ɨɬɧɨɲɟɧɢɟ ɫɭɦɦɵ ɫɪɟɞɧɟɫɭɬɨɱɧɵɯ ɩɨɥɨɠɢɬɟɥɶɧɵɯ (ɚɤɬɢɜɧɵɯ) ɬɟɦɩɟɪɚɬɭɪ ɜɟɝɟɬɚɰɢɨɧɧɨɝɨ ɩɟɪɢɨɞɚ ɤ ɦɚɤɫɢɦɚɥɶɧɨɣ ɫɭɦɦɟ ɬɟɦɩɟɪɚɬɭɪ ɧɚ Ɂɟɦɧɨɦ
ɲɚɪɟ (10946ɨ);
ky – ɤɨɷɮɮɢɰɢɟɧɬ ɭɜɥɚɠɧɟɧɢɹ – ɫɨɨɬɧɨɲɟɧɢɟ ɦɟɠɞɭ ɤɨɥɢɱɟɫɬɜɨɦ ɨɫɚɞɤɨɜ (R) ɢ ɢɫɩɚɪɹɟɦɨɫɬɶɸ, ɫɜɹɡɚɧɧɨɣ ɫ ɫɭɦɦɨɣ ɬɟɦɩɟɪɚɬɭɪ: R / (0,177*™T>0ɨ);
ɤɨɧɫɬɚɧɬɵ ɟ = 2,718…, p = 3,14…; kɪ – ɤɨɷɮɮɢɰɢɟɧɬ ɪɚɜɧɵɣ 1,0507.
ȼ ɮɨɪɦɭɥɟ ɨɬɪɚɠɟɧɵ ɩɪɨɩɨɪɰɢɢ ɬɪɚɧɫɮɨɪɦɚɰɢɢ ɜ ɛɢɨɬɢɱɟɫɤɭɸ ɩɪɨɞɭɤɰɢɸ ɷɧɟɪɝɢɢ ɫɜɟɬɚ,
ɬɟɩɥɚ ɢ ɜɥɚɝɢ, ɩɪɢ ɷɬɨɦ ɡɧɚɱɟɧɢɹ V ɫɨɨɬɜɟɬɫɬɜɭɸɬ ɪɚɡɦɟɪɧɨɫɬɢ: ɤɝ, ɦ: (102 ɤɝ/104 ɦ2). Ɇɚɤɫɢɦɭɦ
ɟɫɬɟɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɩɨɱɜ ɞɥɹ ɡɥɚɤɨɜɵɯ ɤɭɥɶɬɭɪ ɢɞɟɧɬɢɮɢɰɢɪɭɟɬɫɹ ɫ ɝɪɚɧɢɰɟɣ ɨɛɵɤɧɨɜɟɧɧɵɯ ɢ ɜɵɳɟɥɨɱɟɧɧɵɯ ɱɟɪɧɨɡɟɦɨɜ (ky = 1,0), ɝɞɟ ɚɬɦɨɫɮɟɪɧɵɟ ɨɫɚɞɤɢ ɦɨɝɭɬ ɩɟɪɟɯɨɞɢɬɶ ɜ ɬɪɚɧɫɩɢɪɚɰɢɸ ɪɚɫɬɟɧɢɣ. ɋɪɟɞɧɟɦɧɨɝɨɥɟɬɧɢɟ ɡɧɚɱɟɧɢɹ ky>1,0 ɯɚɪɚɤɬɟɪɢɡɭɸɬ ɧɚɱɚɥɨ ɩɟɪɟɭɜɥɚɠɧɟɧɢɹ.
Ⱦɥɹ ɨɬɪɚɠɟɧɢɹ ɷɬɨɝɨ ɝɢɞɪɨɬɟɪɦɢɱɟɫɤɨɝɨ ɨɩɬɢɦɭɦɚ ɤɨɷɮɮɢɰɢɟɧɬɵ ɭɜɥɚɠɧɟɧɢɹ ɪɚɫɫɱɢɬɵɜɚɸɬɫɹ
ɨɬɧɨɫɢɬɟɥɶɧɨ 1,0: ky = ky, ɟɫɥɢ ky <1, ɢ ky = 1/ ky , ɟɫɥɢ ky >1.
Ɂɧɚɱɟɧɢɹ ɤɥɢɦɚɬɢɱɟɫɤɢ ɨɛɟɫɩɟɱɟɧɧɨɣ ɢ ɩɨɬɟɧɰɢɚɥɶɧɨɣ ɭɪɨɠɚɣɧɨɫɬɢ ɜ ɧɚɲɟɣ ɦɨɞɟɥɢ ɫɨɝɥɚɫɭɸɬɫɹ ɫ ɯɚɪɚɤɬɟɪɢɫɬɢɤɚɦɢ ɡɟɪɧɨɜɨɝɨ ɩɨɬɟɧɰɢɚɥɚ 5 ɤɥɚɫɫɨɜ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɩɨɱɜ (Ɇɋɏ ɊɎ): I – 5561 ɰ/ɝɚ; II – 47–53 ɰ/ɝɚ; III – 39–45 ɰ/ɝɚ; IV – 31–37 ɰ/ɝɚ; V – <29 ɰ/ɝɚ.
ɇɚ ɛɨɥɶɲɟɣ ɱɚɫɬɢ ɡɟɦɥɟɞɟɥɶɱɟɫɤɨɣ ɬɟɪɪɢɬɨɪɢɢ Ɋɨɫɫɢɢ ɩɪɟɨɛɥɚɞɚɟɬ ɞɟɮɢɰɢɬ ɬɟɩɥɚ ɢ ɜɥɚɝɢ,
ɤɨɬɨɪɵɣ ɧɚɪɹɞɭ ɫ ɦɟɠɝɨɞɨɜɨɣ ɢɡɦɟɧɱɢɜɨɫɬɶɸ ɚɝɪɨɦɟɬɟɨɭɫɥɨɜɢɣ ɨɛɭɫɥɨɜɥɢɜɚɟɬ ɫɧɢɠɟɧɢɟ ɭɪɨɠɚɣɧɨɫɬɢ, ɨɫɨɛɟɧɧɨ ɹɪɨɜɵɯ ɤɭɥɶɬɭɪ. Ⱥɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɣ ɩɨɬɟɧɰɢɚɥ ɡɟɪɧɨɜɵɯ ɜ ɡɟɦɥɟɞɟɥɶɱɟɫɤɢɯ
ɡɨɧɚɯ ɋɢɛɢɪɫɤɨɝɨ ɮɟɞɟɪɚɥɶɧɨɝɨ ɨɤɪɭɝɚ (ɋɎɈ) ɩɪɟɞɫɬɚɜɥɟɧ ɜ ɬɚɛɥ. 1.
Ɍɚɛɥɢɰɚ 1
Ⱥɝɪɨɤɥɢɦɚɬɢɱɟɫɤɚɹ ɯɚɪɚɤɬɟɪɢɫɬɢɤɚ ɡɨɧ ɡɟɦɥɟɞɟɥɶɱɟɫɤɨɣ ɬɟɪɪɢɬɨɪɢɢ ɋɢɛɢɪɫɤɨɝɨ ɮɟɞɟɪɚɥɶɧɨɝɨ ɨɤɪɭɝɚ
ɇɚɡɜɚɧɢɟ ɡɨɧɵ
ɉɨɞɬɚɟɠɧɨ-ɥɟɫɧɚɹ
Ʌɟɫɨɫɬɟɩɶ
ɋɭɯɚɹ ɥɟɫɨɫɬɟɩɶ
ɋɬɟɩɶ
ɋɭɯɚɹ ɫɬɟɩɶ
Ɉɱɚɝɢ ɝɨɪɧɨ-ɱɟɪɧɨɡɟɦɧɵɯ ɡɟɦɟɥɶ
ɋɭɦɦɵ ɬɟɦɩɟɪɚɬɭɪ
ɜ ɞɢɚɩɚɡɨɧɟ
10ɨ-12ɨ
Ʉɨɷɮɮɢɰɢɟɧɬɵ
ɭɜɥɚɠɧɟɧɢɹ
Ⱥɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɣ
ɩɨɬɟɧɰɢɚɥ, ɰ ɡ.ɟɞ./ɝɚ
1550–1750
1600–1900
1650–1950
1700–2000
1750–2050
1500–1750
1,27–1,07
1,07-0,93
0,93-0,76
0,76-0,62
0,62-0,5
1,5-0,93
29–45
47–61
25-44
13–25
9–16
13–29
ɇɚ ɷɬɨɦ ɮɨɧɟ ɪɚɫɫɦɚɬɪɢɜɚɟɬɫɹ ɯɨɡɹɣɫɬɜɟɧɧɚɹ ɭɪɨɠɚɣɧɨɫɬɶ – ɢɧɬɟɝɪɚɥɶɧɵɣ ɩɨɤɚɡɚɬɟɥɶ ɤɥɢɦɚɬɚ
ɢ ɚɝɪɨɬɟɯɧɢɤɢ, ɢ ɨɰɟɧɢɜɚɸɬɫɹ ɪɟɡɟɪɜɵ. ɋ ɩɨɦɨɳɶɸ ɤɥɢɦɚɬɢɱɟɫɤɨɣ ɦɨɞɟɥɢ ɦɨɠɧɨ ɪɟɲɚɬɶ ɡɚɞɚɱɢ
ɪɚɡɦɟɳɟɧɢɹ ɤɭɥɶɬɭɪ ɩɨ ɬɟɩɥɨ- ɢ ɜɥɚɝɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɢ ɩɪɨɢɡɜɨɞɢɬɶ ɪɚɫɱɟɬɵ ɚɝɪɨɦɟɬɟɨɪɨɥɨɝɢɱɟɫɤɢɯ ɩɨɬɟɧɰɢɚɥɨɜ ɡɟɦɟɥɶɧɵɯ ɭɱɚɫɬɤɨɜ (VȺɆɉ).
ɇɚ ɪɢɫ. 1,2 ɞɚɧɵ ɩɪɢɦɟɪɵ ɨɰɟɧɤɢ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɫɟɜɨɨɛɨɪɨɬɨɜ ɢ ɭɪɨɠɚɣɧɨɫɬɢ ɤɭɥɶɬɭɪ ɜ
ɭɫɥɨɜɢɹɯ ɡɚɫɭɯɢ 2012 ɝ. ɢ ɩɟɪɟɭɜɥɚɠɧɟɧɢɹ 2013 ɝ. ɧɚ ɫɬɚɰɢɨɧɚɪɟ ɎȽȻɇɍ ɋɢɛɇɂɂɁɢɏ ɜ ɎȽɍɉ
«ɗɥɢɬɧɨɟ» ɇɨɜɨɫɢɛɢɪɫɤɨɝɨ ɪɚɣɨɧɚ ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ (Ɇɋ Ɉɝɭɪɰɨɜɨ). ɉɨɥɹ ɫɬɚɰɢɨɧɚɪɚ ɧɚɯɨɞɹɬɫɹ ɧɚ ɜɵɳɟɥɨɱɟɧɧɨɦ ɱɟɪɧɨɡɟɦɟ (Ʉɭ = 1,04), ɱɬɨ ɫɨɨɬɜɟɬɫɬɜɭɟɬ ɧɢɠɧɟɣ ɝɪɚɧɢɰɟ ɩɪɨɞɭɤɬɢɜɧɨɫɬɢ ɩɨɱɜ I ɤɥɚɫɫɚ. ɇɚ ɝɪɚɮɢɤɚɯ ɜɵɞɟɥɟɧɵ ɩɪɢɛɚɜɤɢ ɭɪɨɠɚɣɧɨɫɬɢ ɤɭɥɶɬɭɪ ɨɬ ɫɪɟɞɫɬɜ ɡɚɳɢɬɵ
ɪɚɫɬɟɧɢɣ ɢ ɭɞɨɛɪɟɧɢɣ.
Ⱥɝɪɨɦɟɬɟɨɪɨɥɨɝɢɱɟɫɤɢɟ ɩɨɬɟɧɰɢɚɥɵ VȺɆɉ ɪɚɫɫɱɢɬɚɧɵ ɩɨ ɬɟɩɥɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɢ ɨɫɚɞɤɚɦ ɩɨ
Ɇɋ Ɉɝɭɪɰɨɜɨ ɫ ɫɟɧɬɹɛɪɹ ɩɪɟɞɲɟɫɬɜɭɸɳɟɝɨ ɝɨɞɚ ɧɚɪɚɫɬɚɸɳɢɦ ɢɬɨɝɨɦ ɩɨ ɦɚɣ, ɢɸɧɶ, ɢɸɥɶ ɢ ɚɜɝɭɫɬ, ɜɤɥɸɱɢɬɟɥɶɧɨ. ȼ ɝɨɞɵ ɚɧɨɦɚɥɶɧɨɝɨ ɭɜɥɚɠɧɟɧɢɹ, ɤɚɤ ɢ ɜ ɞɪɭɝɢɟ ɜɟɝɟɬɚɰɢɨɧɧɵɟ ɫɟɡɨɧɵ (ɧɚɱɢɧɚɹ ɫ 1996 ɝ.), ɚɝɪɨɦɟɬɟɨɪɨɥɨɝɢɱɟɫɤɢɟ ɩɨɬɟɧɰɢɚɥɵ ɛɵɥɢ ɪɟɚɥɢɡɨɜɚɧɵ ɜ ɩɨɫɟɜɚɯ ɨɡɢɦɨɣ ɪɠɢ
ɩɨɫɥɟ ɩɚɪɚ, ɜɢɤɢ-ɨɜɫɚ, ɤɥɟɜɟɪɚ (ɞɨ 70 ɰ ɡ.ɟɞ./ɝɚ). ɍɪɨɠɚɣɧɨɫɬɶ ɹɪɨɜɵɯ ɤɭɥɶɬɭɪ ɨɝɪɚɧɢɱɢɜɚɥɚɫɶ
ɜɟɥɢɱɢɧɨɣ 57 ɰ/ɝɚ. ɂɡ ɷɬɨɝɨ ɫɥɟɞɭɟɬ, ɱɬɨ ɨɡɢɦɵɟ ɢ ɡɟɪɧɨ-ɬɪɚɜɹɧɵɟ ɚɝɪɨɰɟɧɨɡɵ ɛɨɥɟɟ ɷɮɮɟɤɬɢɜɧɨ
ɢɫɩɨɥɶɡɭɸɬ ɫɨɥɧɟɱɧɭɸ ɪɚɞɢɚɰɢɸ ɢ ɜɥɚɝɭ.
Ɉɰɟɧɤɚ ɩɪɨɞɭɤɰɢɨɧɧɵɯ ɜɨɡɦɨɠɧɨɫɬɟɣ ɩɨɱɜ ɩɨɡɜɨɥɹɟɬ ɪɚɫɫɱɢɬɵɜɚɬɶ ɤɥɢɦɚɬɢɱɟɫɤɢɟ ɢ ɟɠɟɝɨɞɧɵɟ ɪɟɡɟɪɜɵ, ɤɨɬɨɪɵɟ ɦɨɝɭɬ ɛɵɬɶ ɪɟɚɥɢɡɨɜɚɧɵ ɜ ɭɪɨɠɚɹɯ ɫ ɩɨɦɨɳɶɸ ɚɞɚɩɬɚɰɢɢ ɚɝɪɨɬɟɯɧɢɤɢ,
ɜɤɥɸɱɚɹ ɫɪɟɞɫɬɜɚ ɢɧɬɟɧɫɢɮɢɤɚɰɢɢ, ɤ ɨɠɢɞɚɟɦɵɦ ɚɧɨɦɚɥɢɹɦ ɩɨɝɨɞɵ.
ɗɤɫɩɨɧɟɧɰɢɚɥɶɧɚɹ ɡɚɜɢɫɢɦɨɫɬɶ ɤɥɢɦɚɬɢɱɟɫɤɨɣ ɦɨɞɟɥɢ ɭɪɨɠɚɣɧɨɫɬɢ ɦɨɠɟɬ ɛɵɬɶ ɤɨɪɪɟɤɬɧɨ
ɩɪɢɜɹɡɚɧɚ ɢ ɤ ɡɟɦɟɥɶɧɵɦ ɭɱɚɫɬɤɚɦ. ɇɟɥɢɧɟɣɧɵɣ ɯɚɪɚɤɬɟɪ ɷɬɨɣ ɡɚɜɢɫɢɦɨɫɬɢ ɢɥɥɸɫɬɪɢɪɭɟɬɫɹ
ɫɥɟɞɭɸɳɢɦ ɩɪɢɦɟɪɨɦ. ɉɪɢ ɫɧɢɠɟɧɢɢ ɤɨɷɮɮɢɰɢɟɧɬɚ ɭɜɥɚɠɧɟɧɢɹ ɨɬ «ɨɩɬɢɦɭɦɚ» ɜ ɥɟɫɨɫɬɟɩɧɨɦ
Ɉɝɭɪɰɨɜɨ ɧɚ 35 % ɜ ɫɬɟɩɧɨɦ Ʉɚɪɚɫɭɤɟ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶ ɩɨɱɜ, ɜɵɪɚɠɟɧɧɚɹ ɜ ɡɟɪɧɨɜɨɦ ɷɤɜɢɜɚɥɟɧɬɟ,
ɫɧɢɠɚɟɬɫɹ ɜ 3,5 ɪɚɡɚ. ɋɥɟɞɭɟɬ ɬɚɤɠɟ ɭɱɢɬɵɜɚɬɶ ɩɨɬɟɪɢ ɜɥɚɝɢ ɜ ɩɨɫɟɜɚɯ ɹɪɨɜɵɯ ɤɭɥɶɬɭɪ ɢ ɡɚɜɢɫɢɦɨɫɬɶ ɢɯ ɨɬ ɨɫɚɞɤɨɜ ɩɟɪɜɨɣ ɩɨɥɨɜɢɧɵ ɜɟɝɟɬɚɰɢɨɧɧɵɯ ɫɟɡɨɧɨɜ.
356
Ɋɢɫ. 1. ɉɪɨɞɭɤɬɢɜɧɨɫɬɶ ɫɟɜɨɨɛɨɪɨɬɨɜ ɢ ɭɪɨɠɚɣɧɨɫɬɶ (ɰ ɡ.ɟɞ./ɝɚ) ɜ 2012 ɝ.
Ȼɟɥɵɟ ɩɪɹɦɨɭɝɨɥɶɧɢɤɢ ɩɨɤɚɡɵɜɚɸɬ ɪɚɫɱɟɬɧɵɟ ɡɧɚɱɟɧɢɹ VȺɆɉ ɧɚ 1.06 – 48 ɰ/ɝɚ,
1.07 – 22,5, 1.08 -14,3, 1.09 – 18,7 ɰ/ɝɚ
Ɋɢɫ. 2. ɉɪɨɞɭɤɬɢɜɧɨɫɬɶ ɫɟɜɨɨɛɨɪɨɬɨɜ ɢ ɭɪɨɠɚɣɧɨɫɬɶ (ɰ ɡ.ɟɞ./ɝɚ) ɜ 2013 ɝ.
Ȼɟɥɵɟ ɩɪɹɦɨɭɝɨɥɶɧɢɤɢ ɩɨɤɚɡɵɜɚɸɬ ɪɚɫɱɟɬɧɵɟ ɡɧɚɱɟɧɢɹ VȺɆɉ ɧɚ 1.06 – 53,6 ɰ/ɝɚ,
1.07 – 56,5, 1.08 – 56,4, 1.09 – 45 ɰ/ɝɚ
ɋɥɟɞɭɸɳɢɣ ɜɨɩɪɨɫ ɡɚɤɥɸɱɚɟɬɫɹ ɜ ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɨɦ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɢ ɧɚ ɩɪɟɞɫɬɨɹɳɢɟ ɜɟɝɟɬɚɰɢɨɧɧɵɟ ɫɟɡɨɧɵ. Ɉɞɧɚɤɨ ɞɥɹ ɩɨɫɟɜɧɵɯ ɩɥɨɳɚɞɟɣ ɜ ɫɨɬɧɢ ɬɵɫɹɱ ɝɟɤɬɚɪɨɜ ɞɚɠɟ ɬɨɱɧɵɯ ɞɨɥɝɨɫɪɨɱɧɵɯ ɩɪɨɝɧɨɡɨɜ ɬɟɩɥɨ-ɜɥɚɝɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɤɭɥɶɬɭɪ, ɪɚɫɫɱɢɬɚɧɧɵɯ ɩɨ ɨɬɞɟɥɶɧɵɦ ɦɟɬɟɨɫɬɚɧɰɢɹɦ, ɨɤɚɡɵɜɚɟɬɫɹ ɧɟ ɞɨɫɬɚɬɨɱɧɨ. ȼ ɪɟɝɪɟɫɫɢɨɧɧɵɯ ɥɢɧɟɣɧɵɯ ɦɨɞɟɥɹɯ ɦɨɠɧɨ ɨɰɟɧɢɬɶ ɨɤɨɥɨ 70 %
ɞɢɫɩɟɪɫɢɢ ɫɜɹɡɟɣ ɩɨɝɨɞɧɵɯ ɮɚɤɬɨɪɨɜ ɩɨ ɬɨɱɤɚɦ ɢ ɭɪɨɠɚɣɧɨɫɬɢ ɤɭɥɶɬɭɪ ɧɚ ɛɨɥɶɲɢɯ ɩɥɨɳɚɞɹɯ.
Ɉɫɬɚɟɬɫɹ ɜɚɪɢɚɧɬ, ɩɪɢ ɤɨɬɨɪɨɦ ɷɬɢ ɧɟɨɩɪɟɞɟɥɟɧɧɨɫɬɢ ɫɧɢɦɚɸɬɫɹ, ɚ ɢɦɟɧɧɨ: ɩɨɫɬɪɨɟɧɢɟ ɦɨɞɟ357
ɥɟɣ ɯɨɡɹɣɫɬɜɟɧɧɨɣ ɭɪɨɠɚɣɧɨɫɬɢ ɤɭɥɶɬɭɪ ɜ ɪɚɣɨɧɚɯ ɢ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɟ ɚɝɪɨɦɟɬɟɨɩɨɬɟɧɰɢɚɥɨɜ ɩɨ
ɪɟɩɟɪɧɵɦ ɦɟɬɟɨɫɬɚɧɰɢɹɦ. ɗɬɢ ɦɨɞɟɥɢ ɪɚɫɫɱɢɬɵɜɚɸɬɫɹ, ɤɚɤ ɨɬɦɟɱɟɧɨ ɜɵɲɟ, ɩɨ ɷɤɫɬɪɚɩɨɥɹɰɢɢ ɜ
ɛɭɞɭɳɟɟ ɞɟɬɟɪɦɢɧɢɪɨɜɚɧɧɵɯ ɝɟɨɤɨɫɦɢɱɟɫɤɢɯ ɫɜɹɡɟɣ.
ɇɚ ɪɢɫ. 3 ɩɨɤɚɡɚɧ ɩɪɢɦɟɪ ɮɨɧɨɜɨɝɨ ɩɪɨɝɧɨɡɚ ɭɪɨɠɚɣɧɨɫɬɢ ɡɟɪɧɨɜɵɯ ɤɭɥɶɬɭɪ ɜ Ⱥɥɬɚɣɫɤɨɦ ɤɪɚɟ
ɧɚ 2015–2017 ɝɝ. Ⱥɥɝɨɪɢɬɦ ɩɨɫɬɪɨɟɧɢɹ ɦɨɞɟɥɢ ɫɥɟɞɭɸɳɢɣ. ȼ ɫɬɪɭɤɬɭɪɟ ɢɫɯɨɞɧɨɝɨ ɜɪɟɦɟɧɧɨɝɨ
ɪɹɞɚ ɜɵɞɟɥɹɸɬɫɹ ɫɟɪɢɢ ɰɢɤɥɢɱɟɫɤɢɯ ɤɨɦɩɨɧɟɧɬ. Ʉɚɠɞɨɣ ɢɡ ɤɨɦɩɨɧɟɧɬ ɞɚɟɬɫɹ ɨɛɨɫɧɨɜɚɧɢɟ, ɨɬɪɚɠɚɸɳɟɟ ɪɟɡɨɧɚɧɫɧɵɟ ɫɨɱɟɬɚɧɢɹ ɚɫɬɪɨɧɨɦɢɱɟɫɤɢɯ (ɤɨɫɦɢɱɟɫɤɢɯ) ɮɚɤɬɨɪɨɜ, ɨɩɪɟɞɟɥɹɸɳɢɯ ɞɢɧɚɦɢɤɭ ɜɨɥɧ ɚɬɦɨɫɮɟɪɵ ɧɚɞ ɞɚɧɧɵɦ ɪɟɝɢɨɧɨɦ. Ɇɚɤɫɢɦɭɦɵ ɤɨɫɢɧɭɫɨɢɞ ɫɨɨɬɜɟɬɫɬɜɭɸɬ ɰɢɤɥɨɧɚɥɶɧɨɦɭ ɯɚɪɚɤɬɟɪɭ ɩɨɝɨɞɵ, ɨɫɚɞɤɚɦ ɢ ɩɨɜɵɲɟɧɢɸ ɭɪɨɠɚɣɧɨɫɬɢ, ɚ ɦɢɧɢɦɭɦɵ ɤɨɫɢɧɭɫɨɢɞ ɫɜɹɡɚɧɵ ɫ
ɝɪɟɛɧɹɦɢ ɜɨɥɧ, ɚɧɬɢɰɢɤɥɨɧɚɦɢ ɢ ɞɟɮɢɰɢɬɨɦ ɨɫɚɞɤɨɜ. ɉɨ ɨɛɨɫɧɨɜɚɧɧɨɦɭ ɧɚɛɨɪɭ ɤɨɦɩɨɧɟɧɬ ɩɪɨɜɨɞɢɬɫɹ ɚɩɩɪɨɤɫɢɦɚɰɢɹ ɪɹɞɚ ɫɭɦɦɨɣ ɤɨɫɢɧɭɫɨɢɞ, ɩɚɪɚɦɟɬɪɵ (ɚɦɩɥɢɬɭɞɚ, ɩɟɪɢɨɞ, ɮɚɡɚ) ɤɨɬɨɪɵɯ
ɪɚɫɫɱɢɬɵɜɚɸɬɫɹ ɫ ɩɨɦɨɳɶɸ ɫɩɨɫɨɛɚ «ɋɩɟɤɬɪ» (ɫɦ. ɪɢɫ. 3). ɉɪɟɞɭɫɦɚɬɪɢɜɚɟɬɫɹ ɜɨɡɦɨɠɧɨɫɬɶ ɮɢɤɫɚɰɢɢ ɮɚɡ ɰɢɤɥɨɜ ɢ ɜɜɨɞɚ ɮɭɧɤɰɢɣ, ɨɬɪɚɠɚɸɳɢɯ ɜɥɢɹɧɢɟ ɮɚɤɬɨɪɨɜ ɭɞɚɪɧɨɝɨ ɬɢɩɚ (ɧɚɩɪɢɦɟɪ, ɫɜɹɡɚɧɧɵɯ ɫ ɭɡɥɨɜɵɦɢ ɬɨɱɤɚɦɢ ɥɭɧɧɨɣ ɨɪɛɢɬɵ). Ɏɭɧɤɰɢɢ, ɡɚɞɚɜɚɟɦɵɟ ɱɢɫɥɟɧɧɨ ɢɥɢ ɬɚɛɭɥɢɪɨɜɚɧɧɨ,
ɦɨɝɭɬ ɜɤɥɸɱɚɬɶɫɹ ɜ ɩɪɨɰɟɞɭɪɭ ɧɚɯɨɠɞɟɧɢɹ ɤɨɷɮɮɢɰɢɟɧɬɨɜ ɦɨɞɟɥɢ:
X [ n]
px
¦ Axi cos[wxi (n 1)T j
i 1
pɌɎ
x
i
] ¦ AɌɎk F [( n 1)T ] ,
k 1
ɝɞɟ AɌɎk – ɚɦɩɥɢɬɭɞɚ k-ɨɣ ɬɚɛɭɥɢɪɨɜɚɧɧɨɣ ɮɭɧɤɰɢɢ F.
Ɋɢɫ. 3. ɉɪɨɝɧɨɡ ɧɚ 2015–2017 ɝɝ. ɭɪɨɠɚɣɧɨɫɬɢ ɡɟɪɧɨɜɵɯ ɜ Ⱥɥɬɚɣɫɤɨɦ ɤɪɚɟ
ɐɢɤɥɢɱɟɫɤɢɟ ɩɚɪɚɦɟɬɪɵ ɦɨɞɟɥɢ ɜ ɝɨɞɚɯ
2,01
2,13
2,23
2,91
3,13
4,23
4,42
5,21
7,42
9,93
14,7
19,85
37,2
Ɉɰɟɧɤɚ ɞɨɫɬɨɜɟɪɧɨɫɬɢ ɦɨɞɟɥɢ ɩɪɨɜɨɞɢɬɫɹ ɩɨ «ɩɪɨɝɧɨɡɭ» ɜ ɩɪɨɲɥɨɟ ɢ ɩɪɨɝɧɨɡɭ-«ɷɤɡɚɦɟɧɭ»,
ɤɨɝɞɚ ɞɚɧɧɵɟ ɩɨ ɧɟɫɤɨɥɶɤɢɦ ɝɨɞɚɦ ɜ ɪɚɫɱɟɬɚɯ ɧɟ ɭɱɚɫɬɜɭɸɬ ɢ ɧɚ ɧɢɯ ɞɚɟɬɫɹ ɩɪɨɝɧɨɡ. Ɉɫɨɛɭɸ ɰɟɧɧɨɫɬɶ ɢɦɟɟɬ ɩɪɨɜɟɪɤɚ ɞɚɧɧɵɯ ɦɨɞɟɥɢ ɩɨ ɷɤɫɬɪɟɦɚɥɶɧɵɦ ɹɜɥɟɧɢɹɦ ɡɚ ɩɪɨɲɥɵɟ ɜɟɤɚ ɢɡ ɥɟɬɨɩɢɫɧɵɯ
ɢ ɞɟɧɞɪɨɥɨɝɢɱɟɫɤɢɯ (ɩɨ ɞɪɟɜɟɫɧɵɦ ɤɨɥɶɰɚɦ) ɢɫɬɨɱɧɢɤɨɜ.
Ɍɚɤɠɟ ɪɚɫɫɱɢɬɵɜɚɸɬɫɹ ɩɪɨɝɧɨɡɵ ɭɪɨɠɚɣɧɨɫɬɢ ɜ ɝɪɭɩɩɚɯ ɪɚɣɨɧɨɜ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ ɢ ɞɪɭɝɢɯ ɪɟɝɢɨɧɚɯ ɋɎɈ. Ɍɚɤɢɟ ɩɪɨɝɧɨɡɵ ɩɨɡɜɨɥɹɸɬ ɫɨɡɞɚɬɶ ɚɞɚɩɬɚɰɢɨɧɧɵɟ ɞɢɧɚɦɢɱɟɫɤɢɟ ɦɨɞɟɥɢ ɧɨɜɨɝɨ ɬɢɩɚ
ɞɥɹ ɩɨɫɬɪɨɟɧɢɹ ɛɢɡɧɟɫ ɩɥɚɧɨɜ ɞɥɹ ɪɚɣɨɧɨɜ ɢ ɪɟɝɢɨɧɨɜ ɧɚ 3-5 ɥɟɬ. ɉɪɨɝɧɨɡɵ ɭɪɨɠɚɣɧɨɫɬɢ ɞɥɹ ɡɚɞɚɧɧɵɯ ɩɥɨɳɚɞɟɣ ɤɨɪɪɟɤɬɢɪɭɸɬɫɹ ɚɝɪɨɦɟɬɟɨɪɨɥɨɝɢɱɟɫɤɢɦɢ ɩɪɨɝɧɨɡɚɦɢ ɞɥɹ ɪɚɫɱɟɬɨɜ ɜɚɪɢɚɧɬɨɜ ɚɞɚɩɬɚɰɢɢ ɚɝɪɨɬɟɯɧɢɤɢ ɫ ɭɱɟɬɨɦ ɡɚɬɪɚɬ ɧɚ ɭɞɨɛɪɟɧɢɹ, ɞɢɡɬɨɩɥɢɜɨ, ɚɦɨɪɬɢɡɚɰɢɸ, ɤɚɩɜɥɨɠɟɧɢɹ ɢ ɞɪ.
Ʉɪɢɬɟɪɢɹɦɢ ɨɩɬɢɦɢɡɚɰɢɢ ɜ ɷɤɨɧɨɦɢɱɟɫɤɢɯ ɦɨɞɟɥɹɯ ɦɨɝɭɬ ɛɵɬɶ ɦɚɤɫɢɦɭɦ ɩɪɢɛɵɥɢ ɢ ɦɢɧɢɦɭɦ
ɡɚɬɪɚɬ ɩɪɢ ɨɝɪɚɧɢɱɟɧɢɹɯ ɧɚ ɩɪɨɢɡɜɨɞɫɬɜɨ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ. ɗɬɨ ɨɝɪɚɧɢɱɟɧɢɹ ɩɨ
358
ɪɟɫɭɪɫɚɦ ɫɟɥɶɯɨɡɭɝɨɞɢɣ, ɬɪɭɞɨɡɚɬɪɚɬɚɦ, ɤɚɩɢɬɚɥɶɧɵɦ ɜɥɨɠɟɧɢɹɦ, ɬɪɚɧɫɩɨɪɬɧɵɦ ɩɨɬɨɤɚɦ, ɜɢɞɚɦ
ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ (ɦɹɫɨ ɝɨɜɹɠɶɟ, ɫɜɢɧɢɧɚ, ɦɨɥɨɤɨ ɢ ɞɪ.), ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɟ ɨɝɪɚɧɢɱɟɧɢɹ ɩɨ ɪɚɰɢɨɧɚɦ ɢ ɞɪ. Ɋɚɫɱɟɬɵ ɦɨɝɭɬ ɩɪɨɜɨɞɢɬɶɫɹ ɫ ɩɨɦɨɳɶɸ ɫɢɦɩɥɟɤɫ-ɦɟɬɨɞɚ ɩɨ ɫɩɟɰɢɚɥɶɧɨɣ
ɤɨɦɩɶɸɬɟɪɧɨɣ ɩɪɨɝɪɚɦɦɟ.
ɗɤɨɧɨɦɢɱɟɫɤɚɹ ɦɨɞɟɥɶ ɫɨɫɬɚɜɥɹɟɬɫɹ ɢɡ ɛɥɨɤɨɜ ɩɨ ɪɟɝɢɨɧɚɦ (ɪɚɣɨɧɚɦ) ɢ ɩɨ ɝɨɞɚɦ (ɪɢɫ. 4).
Ɋɢɫ.4. Ȼɥɨɤ-ɫɯɟɦɚ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɦɨɞɟɥɢ
ȼ ɦɨɞɟɥɢ ɩɪɢɧɢɦɚɟɬɫɹ ɫɥɟɞɭɸɳɚɹ ɫɢɫɬɟɦɚ ɨɛɨɡɧɚɱɟɧɢɣ:
i – ɢɧɞɟɤɫ ɜɢɞɚ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɪɟɫɭɪɫɨɜ (i=1,2,…,m);
j – ɢɧɞɟɤɫ ɜɢɞɚ ɩɪɨɞɭɤɰɢɢ (j=1,2,...,n);
k – ɢɧɞɟɤɫ ɪɚɣɨɧɚ (k=1,2,…,K);
t – ɢɧɞɟɤɫ ɝɨɞɚ (t=1,2,…,T);
xjkt – ɨɛɴɟɦ ɩɪɨɢɡɜɨɞɫɬɜɚ ɩɪɨɞɭɤɰɢɢ j-ɝɨ ɜɢɞɚ ɜ k-ɦ ɪɚɣɨɧɟ ɜ t ɝɨɞɭ;
aijkt – ɧɨɪɦɚ ɡɚɬɪɚɬ ɪɟɫɭɪɫɨɜ i-ɝɨ ɜɢɞɚ ɧɚ ɟɞɢɧɢɰɭ j-ɨɣ ɩɪɨɞɭɤɰɢɢ ɜ k-ɦ ɪɚɣɨɧɟ ɜ t ɝɨɞɭ;
Aikt – ɨɛɴɟɦ ɪɟɫɭɪɫɨɜ i-ɝɨ ɜɢɞɚ ɜ k-ɦ ɪɚɣɨɧɟ ɜ t ɝɨɞɭ;
Ait – ɨɛɳɢɣ ɨɛɴɟɦ ɪɟɫɭɪɫɨɜ i-ɝɨ ɜɢɞɚ ɜ t ɝɨɞɭ;
bijkt – ɫɨɞɟɪɠɚɧɢɟ i-ɝɨ ɪɟɫɭɪɫɚ ɜ ɟɞɢɧɢɰɟ j-ɣ ɩɪɨɞɭɤɰɢɢ ɜ k-ɦ ɪɚɣɨɧɟ ɜ t ɝɨɞɭ;
Cjkt – ɡɚɬɪɚɬɵ ɨɬ ɟɞɢɧɢɰɵ j-ɣ ɩɪɨɞɭɤɰɢɢ ɜ k-ɦ ɪɚɣɨɧɟ ɜ t ɝɨɞɭ.
ɐɟɥɟɜɚɹ ɮɭɧɤɰɢɹ ɜ ɫɥɭɱɚɟ ɤɪɢɬɟɪɢɹ ɦɚɤɫɢɦɭɦɚ ɩɪɢɛɵɥɢ ɫɥɟɞɭɸɳɚɹ:
ɧɚɣɬɢ L=
max ɩɪɢ ɭɫɥɨɜɢɢ:
jkt
ijkt
ikt
(i=1,2,…,i1)
(ɡɚɬɪɚɬɵ ɪɟɫɭɪɫɨɜ i-ɝɨ ɜɢɞɚ ɜ k-ɦ ɪɚɣɨɧɟ ɧɚ ɩɪɨɢɡɜɨɞɫɬɜɨ j-ɯ ɩɪɨɞɭɤɬɨɜ ɧɟ ɞɨɥɠɧɵ ɩɪɟɜɵɲɚɬɶ
ɪɟɫɭɪɫɚ ɷɬɨɝɨ ɜɢɞɚ);
x –
ijkt jkt
x
ijkt jkt
0 (i=i1+1,…,m)
(ɨɛɴɟɦ i-ɯ ɪɟɫɭɪɫɨɜ, ɩɨɥɭɱɚɟɦɵɯ ɨɬ l ɨɬɪɚɫɥɟɣ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ ɜ k-ɦ ɪɟɝɢɨɧɟ ɞɨɥɠɟɧ ɛɵɬɶ ɧɟ
ɦɟɧɟɟ ɪɚɫɯɨɞɚ ɷɬɢɯ ɪɟɫɭɪɫɨɜ ɜ ɨɬɪɚɫɥɹɯ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ. ɉɪɢ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɭɱɢɬɵɜɚɸɬɫɹ ɩɟɪɟɯɨɞɹɳɢɟ ɡɚɩɚɫɵ, ɜɨɡɦɨɠɧɨɫɬɶ ɩɪɢɨɛɪɟɬɟɧɢɹ ɪɟɫɭɪɫɨɜ ɫɨ ɫɬɨɪɨɧɵ, ɜ ɬɨɦ ɱɢɫɥɟ ɢɫɩɨɥɶɡɨɜɚɧɢɟ
ɪɟɫɭɪɫɨɜ ɞɪɭɝɢɯ ɪɟɝɢɨɧɨɜ);
Xjkt
0.
ȼ ɪɚɫɱɟɬɟ ɤɚɠɞɵɣ ɛɥɨɤ ɦɨɞɟɥɢ ɧɚ ɨɫɧɨɜɟ ɩɪɨɝɧɨɡɚ ɭɪɨɠɚɣɧɨɫɬɢ ɡɟɪɧɨɜɵɯ ɢ ɤɨɪɦɨɜɵɯ ɤɭɥɶɬɭɪ (ɜ ɪɚɫɫɦɚɬɪɢɜɚɟɦɨɦ ɩɪɢɦɟɪɟ ɧɚ 3 ɝɨɞɚ) ɞɨɥɠɟɧ ɛɚɥɚɧɫɢɪɨɜɚɬɶɫɹ ɩɨ ɠɢɜɨɬɧɨɜɨɞɫɬɜɭ ɫ ɭɱɟɬɨɦ
ɡɚɩɚɫɨɜ ɤɨɪɦɨɜ ɢ ɩɨɫɬɚɜɨɤ ɢɡ ɞɪɭɝɢɯ ɪɟɝɢɨɧɨɜ. ɋɭɦɦɚɪɧɵɟ ɨɛɴɟɦɵ ɪɚɫɬɟɧɢɟɜɨɞɱɟɫɤɨɣ ɢ ɠɢɜɨɬɧɨɜɨɞɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ ɛɚɥɚɧɫɢɪɭɸɬɫɹ ɜ ɤɨɨɪɞɢɧɢɪɭɸɳɟɦ ɛɥɨɤɟ. Ɂɚɬɪɚɬɵ ɪɟɫɭɪɫɨɜ ɭɱɢɬɵɜɚɸɬɫɹ
ɜ ɰɟɥɟɜɨɣ ɮɭɧɤɰɢɢ ɧɚ ɩɪɨɢɡɜɨɞɫɬɜɨ ɩɪɨɞɭɤɰɢɢ. ɗɬɨ ɩɨɡɜɨɥɢɬ ɦɢɧɢɦɢɡɢɪɨɜɚɬɶ ɭɳɟɪɛ ɨɬ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɯ ɭɫɥɨɜɢɣ ɩɪɢ ɨɛɟɫɩɟɱɟɧɢɢ ɪɟɝɢɨɧɨɜ ɫɨɛɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɟɣ ɢ ɷɤɫɩɨɪɬɚ.
359
ɉɪɢ ɩɨɫɬɪɨɟɧɢɢ ɷɤɨɧɨɦɢɱɟɫɤɨɣ ɞɢɧɚɦɢɱɟɫɤɨɣ ɦɨɞɟɥɢ ɪɚɫɫɱɢɬɵɜɚɸɬɫɹ ɤɨɷɮɮɢɰɢɟɧɬɵ a, b ɢ
ɩɚɪɚɦɟɬɪɵ Ⱥ ɢ ɋ. ɗɬɨ ɧɨɪɦɵ ɢ ɫɨɞɟɪɠɚɧɢɟ ɪɟɫɭɪɫɨɜ ɢ ɨɛɴɟɦɨɜ ɡɚɬɪɚɬ, ɨɬ ɤɨɬɨɪɵɯ ɡɚɜɢɫɢɬ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɚɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɯ ɪɟɫɭɪɫɨɜ.
Ⱥɧɚɥɨɝɢɱɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɢ ɪɚɫɱɟɬɵ ɦɨɠɧɨ ɜɵɩɨɥɧɢɬɶ ɞɥɹ ɪɟɝɢɨɧɨɜ, ɩɪɟɞɫɬɚɜɢɬɟɥɢ ɤɨɬɨɪɵɯ
ɭɱɚɫɬɜɭɸɬ ɧɚ XVIII Ɇɟɠɞɭɧɚɪɨɞɧɨɣ ɧɚɭɱɧɨ-ɩɪɚɤɬɢɱɟɫɤɨɣ ɤɨɧɮɟɪɟɧɰɢɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
Ʉɭɪɰɟɜ ɂ.ȼ., Ɂɚɞɤɨɜ Ⱥ.ɉ. Ɇɨɞɟɥɢɪɨɜɚɧɢɟ ɚɞɚɩɬɢɜɧɵɯ ɫɢɫɬɟɦ ɜɟɞɟɧɢɹ ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ // ɋɈ ȼȺɋɏɇɂɅ – 1990. – 95 ɫ.
ɉɨɧɶɤɨ ȼ.Ⱥ. Ⱥɝɪɨɤɥɢɦɚɬɢɱɟɫɤɚɹ ɚɞɚɩɬɚɰɢɹ ɡɟɦɥɟɞɟɥɢɹ // ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɢ ɨɯɪɚɧɚ ɩɪɢɪɨɞɧɵɯ ɪɟɫɭɪɫɨɜ
ɜ Ɋɨɫɫɢɢ. – 2008.3. – ɋ. 57–62; 2008.4. – ɋ. 42–48.
ɉɨɧɶɤɨ ȼ.Ⱥ., Ʉɚɥɢɱɤɢɧ ȼ.Ʉ., ɂɜɚɧɨɜɚ Ɇ.ɂ. ɉɨɱɜɟɧɧɨ-ɤɥɢɦɚɬɢɱɟɫɤɨɟ ɡɨɧɢɪɨɜɚɧɢɟ ɢ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶ
ɚɝɪɨɥɚɧɞɲɚɮɬɨɜ // ɋɢɛɢɪɫɤɢɣ ɜɟɫɬɧɢɤ ɫ.-ɯ. ɧɚɭɤɢ. – 2009. – ʋ 12. – ɋ.5–13.
ɉɚɬɟɧɬ ɧɚ ɢɡɨɛɪɟɬɟɧɢɟ ɊɎ ʋ 2164029 ɋɩɨɫɨɛ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɹ ɚɧɨɦɚɥɢɣ ɷɤɨɫɮɟɪɵ ɧɚ Ɂɟɦɥɟ ɢɥɢ ɟɺ
ɱɚɫɬɢ (2000).
Ʉɚɥɢɱɤɢɧ ȼ.Ʉ., ɉɨɧɶɤɨ ȼ.Ⱥ., ɂɜɚɧɨɜɚ Ɇ.ɂ., ɏɢɡɚɦɟɬɞɢɧɨɜ ɋ.ȼ. Ⱥɝɪɨɤɥɢɦɚɬɢɱɟɫɤɢɣ ɩɪɨɝɧɨɡ ɢ ɟɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɜ ɫɩɟɰɢɚɥɢɡɚɰɢɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ // ɋɈ ɊȺɋɏɇ – 2009. – ɋ. 202–210.
1.
2.
3.
4.
5.
ɍȾɄ 631.5
ɉȿɊɋɉȿɄɌɂȼɕ ɂɋɉɈɅɖɁɈȼȺɇɂə Ƚɂɋ-ɌȿɏɇɈɅɈȽɂɃ
ȼ ɋȿɅɖɋɄɈɆ ɏɈɁəɃɋɌȼȿ
ɋȺɊɆȺɇɈȼȺ Ɋ.ɋ.,
ɌɈɈ «ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ, ɚ. Ȼɟɫɤɨɥɶ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, e-mail: roz79@mail.ru
ɇɨɜɵɣ ɜɟɤ ɫɬɚɜɢɬ ɩɟɪɟɞ ɱɟɥɨɜɟɱɟɫɬɜɨɦ ɧɨɜɵɟ ɩɪɨɛɥɟɦɵ, ɜ ɱɚɫɬɧɨɫɬɢ: ɧɚɤɨɪɦɢɬɶ ɪɚɫɬɭɳɟɟ ɧɚɫɟɥɟɧɢɟ ɩɥɚɧɟɬɵ, ɭɞɨɜɥɟɬɜɨɪɢɬɶ ɫɩɪɨɫ ɜ ɤɚɱɟɫɬɜɟɧɧɵɯ ɩɪɨɞɭɤɬɚɯ ɩɢɬɚɧɢɹ, ɤɚɤ ɞɨɛɢɬɶɫɹ ɩɨɜɵɲɟɧɢɹ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɬɪɭɞɚ ɧɚ ɩɪɟɞɩɪɢɹɬɢɹɯ ȺɉɄ. ɑɬɨ ɡɚ ɷɬɢɦ ɫɬɨɢɬ – ɫɬɪɚɯ ɦɚɫɫɨɜɨɝɨ ɝɨɥɨɞɚ,
ɧɟɯɜɚɬɤɚ ɡɟɦɟɥɶɧɵɯ ɢ ɜɨɞɧɵɯ ɪɟɫɭɪɫɨɜ? ɇɚɜɟɪɧɨɟ, ɜɫɟɝɨ ɩɨɧɟɦɧɨɝɭ. ɉɨɷɬɨɦɭ ɫɟɝɨɞɧɹ ɩɪɨɞɨɜɨɥɶɫɬɜɟɧɧɚɹ ɛɟɡɨɩɚɫɧɨɫɬɶ ɫɬɚɧɨɜɢɬɫɹ ɧɟɨɬɴɟɦɥɟɦɨɣ ɱɚɫɬɶɸ ɫɬɪɚɬɟɝɢɢ ɧɚɰɢɨɧɚɥɶɧɨɣ ɩɨɥɢɬɢɤɢ ɥɸɛɨɣ
ɫɬɪɚɧɵ, ɞɭɦɚɸɳɟɣ ɨ ɫɜɨɟɦ ɛɭɞɭɳɟɦ. ɇɟ ɢɫɤɥɸɱɟɧɢɟ ɡɞɟɫɶ ɢ Ʉɚɡɚɯɫɬɚɧ.
Ɂɚ ɝɨɞɵ ɧɟɡɚɜɢɫɢɦɨɫɬɢ ɜ ɫɬɪɚɧɟ ɛɵɥɢ ɫɞɟɥɚɧɵ ɫɟɪɶɟɡɧɵɟ ɲɚɝɢ ɩɨ ɞɢɜɟɪɫɢɮɢɤɚɰɢɢ ɚɝɪɚɪɧɨɝɨ
ɫɟɤɬɨɪɚ, ɪɚɡɜɢɬɢɸ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ. ɋɟɣɱɚɫ, ɤɨɧɟɱɧɨ, ɧɟɥɶɡɹ ɫɤɚɡɚɬɶ, ɱɬɨ ɪɟɫɩɭɛɥɢɤɚ ɧɚɯɨɞɢɬɫɹ ɜ ɱɢɫɥɟ ɥɢɞɟɪɨɜ ɩɨ ɜɧɟɞɪɟɧɢɸ ɚɝɪɨɬɟɯɧɨɥɨɝɢɣ. ɇɨ ɜɚɠɧɨ, ɱɬɨ ɫɟɥɶɫɤɨɟ ɯɨɡɹɣɫɬɜɨ ɫɬɪɚɧɵ ɚɤɬɢɜɧɨ ɪɚɡɜɢɜɚɟɬɫɹ, ɩɪɨɛɭɟɬ ɪɚɡɧɵɟ ɦɨɞɟɥɢ ɢ ɮɨɪɦɵ, ɢɳɟɬ ɫɜɨɟ ɦɟɫɬɨ ɧɚ ɝɥɨɛɚɥɶɧɨɦ
ɪɵɧɤɟ. ɉɨɥɨɠɢɬɟɥɶɧɵɟ ɢɡɦɟɧɟɧɢɹ ɜ ɫɮɟɪɟ ɨɬɦɟɱɚɟɬ ɢ ɎȺɈ ɜ ɫɜɨɟɦ ɟɠɟɝɨɞɧɨɦ ɫɬɚɬɢɫɬɢɱɟɫɤɨɦ
ɨɬɱɟɬɟ. ɉɨ ɞɚɧɧɵɦ ɨɪɝɚɧɢɡɚɰɢɢ, Ʉɚɡɚɯɫɬɚɧ ɩɪɨɢɡɜɟɥ ɫɜɵɲɟ 3,6 ɦɥɧ ɬɨɧɧ ɨɜɨɳɟɣ (2011 ɝɨɞ), ɡɚɧɹɜ
ɜɬɨɪɨɟ ɦɟɫɬɨ ɩɨɫɥɟ ɍɡɛɟɤɢɫɬɚɧɚ. ɑɬɨ ɤɚɫɚɟɬɫɹ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ, ɬɨ ɡɞɟɫɶ, ɜ 2011 ɝɨɞɭ ɱɢɫɥɨ ɝɨɥɨɜ
ɤɪɭɩɧɨɝɨ ɪɨɝɚɬɨɝɨ ɫɤɨɬɚ ɜ ɪɟɫɩɭɛɥɢɤɟ ɩɪɟɜɵɫɢɥɨ 6 ɦɥɧ, ɨɜɟɰ – 14,6 ɦɥɧ ɢ ɩɬɢɰɵ – 32,7 ɦɥɧ. ɉɪɢ
ɷɬɨɦ ɩɪɨɢɡɜɨɞɫɬɜɨ ɝɨɜɹɞɢɧɵ ɜ ɪɟɫɩɭɛɥɢɤɟ ɞɨɫɬɢɝɥɨ 407 ɬɵɫɹɱ ɬɨɧɧ, ɛɚɪɚɧɢɧɵ – 123 ɬɵɫɹɱ ɬɨɧɧ.
ɋɟɝɨɞɧɹ ɭɫɩɟɯɚ ɞɨɛɢɜɚɸɬɫɹ ɫɬɪɚɧɵ, ɫɨɡɞɚɸɳɢɟ ɜɡɚɢɦɨɫɜɹɡɚɧɧɵɣ ɤɨɦɩɥɟɤɫ, ɝɞɟ ɫɟɥɶɫɤɨɟ ɯɨɡɹɣɫɬɜɨ ɜɵɫɬɭɩɚɟɬ ɧɚɱɚɥɶɧɵɦ ɡɜɟɧɨɦ, ɬɟɫɧɨ ɫɜɹɡɚɧɧɵɦ ɫ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɟɣ ɩɪɨɦɵɲɥɟɧɧɨɫɬɶɸ,
ɫɤɥɚɞɫɤɢɦɢ ɢ ɯɨɥɨɞɢɥɶɧɵɦɢ ɦɨɳɧɨɫɬɹɦɢ, ɫɟɥɶɯɨɡɦɚɲɢɧɨɫɬɪɨɟɧɢɟɦ, ɩɪɨɢɡɜɨɞɢɬɟɥɹɦɢ ɯɢɦɢɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ ɢ ɛɚɧɤɚɦɢ. Ʉɚɡɚɯɫɬɚɧɭ ɧɟɨɛɯɨɞɢɦɨ ɫɤɨɧɰɟɧɬɪɢɪɨɜɚɬɶɫɹ ɧɚ ɜɵɜɟɞɟɧɢɢ ɧɨɜɵɯ
ɫɨɪɬɨɜ ɢ ɝɢɛɪɢɞɨɜ ɫɟɥɶɯɨɡɤɭɥɶɬɭɪ, ɭɫɬɨɣɱɢɜɵɯ ɤ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɦ ɭɫɥɨɜɢɹɦ, ɛɨɥɟɡɧɹɦ ɢ ɜɪɟɞɢɬɟɥɹɦ, ɭɜɟɥɢɱɟɧɢɢ ɩɨɝɨɥɨɜɶɹ ɦɹɫɧɨɝɨ ɫɤɨɬɚ, ɩɬɢɰɵ, ɜɧɟɞɪɟɧɢɢ ɷɧɟɪɝɨɫɛɟɪɟɝɚɸɳɢɯ ɢ ɩɟɪɟɪɚɛɚɬɵɜɚɸɳɢɯ ɬɟɯɧɨɥɨɝɢɣ [1].
ɋɟɥɶɫɤɨɟ ɯɨɡɹɣɫɬɜɨ – ɢɞɟɚɥɶɧɚɹ ɫɪɟɞɚ ɞɥɹ ɩɪɢɦɟɧɟɧɢɹ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ (ɂɌ).
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ, ɞɥɹ ɷɮɮɟɤɬɢɜɧɨɝɨ ɢ ɭɫɬɨɣɱɢɜɨɝɨ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɹ ɯɨɡɹɣɫɬɜɭɸɳɢɯ ɫɭɛɴɟɤɬɨɜ
ɪɟɫɩɭɛɥɢɤɢ ɜ ɧɨɜɵɯ ɭɫɥɨɜɢɹɯ ɧɟɨɛɯɨɞɢɦɨ ɩɪɢɦɟɧɹɬɶ ɩɟɪɟɞɨɜɵɟ ɢɧɮɨɪɦɚɰɢɨɧɧɵɟ ɬɟɯɧɨɥɨɝɢɢ,
ɩɨɡɜɨɥɹɸɳɢɟ ɜɵɹɜɢɬɶ ɢɯ ɜɧɭɬɪɟɧɧɢɟ ɪɟɡɟɪɜɵ, ɩɪɢɜɥɟɱɶ ɜɧɟɲɧɢɟ ɜɥɨɠɟɧɢɹ, ɚ ɬɚɤɠɟ ɩɪɨɜɨɞɢɬɶ
ɪɟɫɬɪɭɤɬɭɪɢɡɚɰɢɸ ɨɪɝɚɧɢɡɚɰɢɨɧɧɵɯ ɫɬɪɭɤɬɭɪ [2].
360
ɋɨɜɟɪɲɟɧɧɨ ɨɱɟɜɢɞɧɨ, ɱɬɨ ɜɧɟɞɪɟɧɢɟ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɞɨɥɠɧɨ ɧɚɱɢɧɚɬɶɫɹ ɫ ɩɟɪɟɩɢɫɢ ɢɦɟɸɳɢɯɫɹ ɩɪɨɢɡɜɨɞɫɬɜɟɧɧɵɯ ɪɟɫɭɪɫɨɜ, ɫ ɫɨɡɞɚɧɢɹ ɛɚɡɵ ɞɚɧɧɵɯ. Ɍɚɤ ɤɚɤ ɨɫɧɨɜɧɵɦ ɪɟɫɭɪɫɨɦ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ ɹɜɥɹɟɬɫɹ ɡɟɦɥɹ, ɬɨ ɬɚɤɚɹ ɛɚɡɚ ɞɚɧɧɵɯ ɨɛɹɡɚɬɟɥɶɧɨ ɛɭɞɟɬ ɧɨɫɢɬɶ ɩɪɨɫɬɪɚɧɫɬɜɟɧɧɵɣ ɯɚɪɚɤɬɟɪ. ɍɠɟ ɫɟɣɱɚɫ ɞɥɹ ɫɬɪɚɧ, ɠɟɥɚɸɳɢɯ ɜɫɬɭɩɢɬɶ ɜ ȿɜɪɨɩɟɣɫɤɨɟ ɋɨɨɛɳɟɫɬɜɨ,
ɫɭɳɟɫɬɜɭɟɬ ɨɛɹɡɚɬɟɥɶɧɨɟ ɬɪɟɛɨɜɚɧɢɟ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɹ ɧɚɰɢɨɧɚɥɶɧɨɣ ȿɞɢɧɨɣ ɚɞɦɢɧɢɫɬɪɚɬɢɜɧɨ – ɭɩɪɚɜɥɹɸɳɟɣ ɫɢɫɬɟɦɵ (IACS), ɜɤɥɸɱɚɸɳɟɣ ɜ ɫɟɛɹ ɞɚɧɧɵɟ ɩɨ ɜɫɟɦ ɡɟɦɟɥɶɧɵɦ ɭɱɚɫɬɤɚɦ ɢ
ɡɟɦɥɟɩɨɥɶɡɨɜɚɬɟɥɹɦ.
Ɍɚɤɚɹ ɫɢɫɬɟɦɚ ɩɪɨɫɬɨ ɧɟɨɛɯɨɞɢɦɚ ɞɥɹ ɷɮɮɟɤɬɢɜɧɨɣ ɪɟɚɥɢɡɚɰɢɢ ɩɪɨɝɪɚɦɦ ɫɭɛɫɢɞɢɪɨɜɚɧɢɹ ɩɪɨɢɡɜɨɞɢɬɟɥɟɣ ɫɟɥɶɯɨɡɩɪɨɞɭɤɰɢɢ ɢ ɤɨɧɬɪɨɥɹ ɡɚ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɷɬɢɯ ɫɭɛɫɢɞɢɣ, ɫɭɦɦɚ ɤɨɬɨɪɵɯ ɩɨ
ȿɜɪɨɫɨɸɡɭ ɫɨɫɬɚɜɥɹɟɬ ɧɟɫɤɨɥɶɤɨ ɞɟɫɹɬɤɨɜ ɦɢɥɥɢɚɪɞɨɜ ɟɜɪɨ.
ȼ ɋɒȺ ɛɨɥɶɲɨɟ ɱɢɫɥɨ ɩɨɞɨɛɧɵɯ ɢ ɞɪɭɝɢɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɩɪɨɝɪɚɦɦ ɢ ɩɪɨɟɤɬɨɜ, ɨɫɧɨɜɚɧɧɵɯ ɧɚ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ, ɫɪɟɞɢ ɤɨɬɨɪɵɯ ɨɫɨɛɨɟ ɦɟɫɬɨ ɨɬɜɨɞɢɬɫɹ
Ƚɂɋ, ɨɱɟɧɶ ɚɤɬɢɜɧɨ ɪɟɚɥɢɡɭɟɬɫɹ ɦɧɨɝɨɱɢɫɥɟɧɧɵɦɢ ɚɝɟɧɬɫɬɜɚɦɢ, ɨɬɧɨɫɹɳɢɦɢɫɹ ɤ Ɇɢɧɢɫɬɟɪɫɬɜɭ
ɫɟɥɶɫɤɨɝɨ ɯɨɡɹɣɫɬɜɚ (USDA) [3].
Ɉɫɧɨɜɧɵɟ ɨɛɥɚɫɬɢ ɩɪɢɦɟɧɟɧɢɹ Ƚɂɋ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ – ɭɜɟɥɢɱɟɧɢɟ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɣ ɩɪɨɞɭɤɰɢɢ, ɨɩɬɢɦɢɡɚɰɢɹ ɟɟ ɬɪɚɧɫɩɨɪɬɢɪɨɜɤɢ ɢ ɫɛɵɬɚ. Ʉɨɦɩɥɟɤɫɧɚɹ Ƚɂɋ ɧɚɢɛɨɥɟɟ ɱɚɫɬɨ ɜɤɥɸɱɚɟɬ ɜ ɫɟɛɹ ɬɚɤɢɟ ɰɢɮɪɨɜɵɟ ɤɚɪɬɵ, ɤɚɤ ɤɚɪɬɵ ɫɨɞɟɪɠɚɧɢɹ ɦɢɧɟɪɚɥɶɧɵɯ ɜɟɳɟɫɬɜ ɜ
ɩɨɱɜɟ, ɬɢɩɨɜ ɢ ɯɚɪɚɤɬɟɪɢɫɬɢɤ ɩɨɱɜ, ɤɚɪɬɵ ɭɤɥɨɧɨɜ (ɫ ɰɢɮɪɨɜɨɣ ɦɨɞɟɥɶɸ ɪɟɥɶɟɮɚ) ɢ ɷɤɫɩɨɡɢɰɢɣ
ɫɤɥɨɧɨɜ, ɩɨɝɨɞɧɵɯ, ɤɥɢɦɚɬɢɱɟɫɤɢɯ ɢ ɝɢɞɪɨɥɨɝɢɱɟɫɤɢɯ ɭɫɥɨɜɢɣ. Ʉɪɚɣɧɟ ɜɚɠɧɨɣ ɢɧɮɨɪɦɚɰɢɟɣ ɹɜɥɹɸɬɫɹ ɰɢɮɪɨɜɵɟ ɤɚɪɬɵ ɡɚ ɪɹɞ ɩɨɫɥɟɞɨɜɚɬɟɥɶɧɵɯ ɬɚɤɢɯ ɮɚɤɬɨɪɨɜ, ɤɚɤ ɭɪɨɠɚɣɧɨɫɬɶ ɢ ɬɢɩ ɩɨɫɟɜɨɜ,
ɬɢɩ ɦɟɯɚɧɢɱɟɫɤɨɣ ɢ ɯɢɦɢɱɟɫɤɨɣ ɨɛɪɚɛɨɬɤɢ ɩɨɱɜ, ɩɪɨɫɬɪɚɧɫɬɜɟɧɧɨɟ ɪɚɫɩɪɟɞɟɥɟɧɢɟ ɡɚɛɨɥɟɜɚɧɢɣ
ɤɭɥɶɬɭɪ ɢ ɞɢɧɚɦɢɤɚ ɪɚɫɩɪɨɫɬɪɚɧɟɧɢɹ ɜɪɟɞɧɵɯ ɧɚɫɟɤɨɦɵɯ. ɉɪɢ ɧɚɥɢɱɢɢ ɬɚɤɨɣ ɢɧɮɨɪɦɚɰɢɢ ɨɬɤɪɵɜɚɸɬɫɹ ɧɟɨɝɪɚɧɢɱɟɧɧɵɟ ɜɨɡɦɨɠɧɨɫɬɢ ɚɧɚɥɢɡɚ, ɩɪɨɝɧɨɡɚ ɢ ɨɩɬɢɦɢɡɚɰɢɢ ɞɟɹɬɟɥɶɧɨɫɬɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɩɪɟɞɩɪɢɹɬɢɣ. Ɉɫɨɛɟɧɧɨ ɜɚɠɧɨ ɩɪɢɦɟɧɟɧɢɟ ɝɟɨɢɧɮɨɪɦɚɰɨɢɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ,
ɜ ɨɫɨɛɟɧɧɨɫɬɢ ɬɟɯɧɨɥɨɝɢɣ ɨɛɪɚɛɨɬɤɢ ɞɚɧɧɵɯ ɞɢɫɬɚɧɰɢɨɧɧɨɝɨ ɡɨɧɞɢɪɨɜɚɧɢɹ (ɚɷɪɨɮɨɬɨɫɧɢɦɤɨɜ,
ɤɨɫɦɨɫɧɢɦɤɨɜ, ɜ ɩɟɪɜɭɸ ɨɱɟɪɟɞɶ ɦɧɨɝɨɡɨɧɚɥɶɧɵɯ ɢ ɝɢɩɟɪɫɩɟɤɬɪɚɥɶɧɵɯ), ɞɥɹ ɬɟɦɚɬɢɱɟɫɤɨɝɨ ɞɟɲɢɮɪɢɪɨɜɚɧɢɹ ɬɟɪɪɢɬɨɪɢɢ. ɗɬɨ ɦɨɠɟɬ ɫɬɚɬɶ ɨɫɧɨɜɨɣ ɞɥɹ ɫɨɡɞɚɧɢɹ ɰɢɮɪɨɜɨɣ ɤɚɪɬɨɝɪɚɮɢɱɟɫɤɨɣ
ɨɫɧɨɜɵ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɫɢɫɬɟɦ ɚɝɪɨɩɪɨɦɵɲɥɟɧɧɨɝɨ ɤɨɦɩɥɟɤɫɚ.
Ɋɚɡɜɢɬɢɟ ɦɟɬɨɞɨɜ ɤɨɧɬɪɨɥɹ ɡɟɪɧɨɜɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɫ ɩɨɦɨɳɶɸ ɫɩɭɬɧɢɤɨɜɨɣ ɢɧɮɨɪɦɚɰɢɢ ɢɦɟɟɬ ɛɨɥɶɲɨɟ ɫɨɰɢɚɥɶɧɨ-ɷɤɨɧɨɦɢɱɟɫɤɨɟ ɡɧɚɱɟɧɢɟ ɞɥɹ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ
ɬɟɯɧɨɥɨɝɢɹ ɤɨɫɦɢɱɟɫɤɨɝɨ ɦɨɧɢɬɨɪɢɧɝɚ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɭɝɨɞɢɣ ɢ ɨɛɴɟɦɨɜ ɪɚɫɬɟɧɢɟɜɨɞɱɟɫɤɨɣ ɩɪɨɞɭɤɰɢɢ ɜɧɟɞɪɟɧɚ ɜ Ɇɋɏ ɊɄ.
ȼ ɧɚɱɚɥɟ 2014 ɝɨɞɚ ɪɚɡɪɚɛɨɬɚɧ ɩɪɨɟɤɬ ɋɰɟɧɚɪɢɹ «ɍɫɬɨɣɱɢɜɨɟ ɪɚɡɜɢɬɢɟ ɚɝɪɚɪɧɨɝɨ ɫɟɤɬɨɪɚ, ɩɟɪɟɪɚɛɨɬɤɚ ɢ ɛɟɡɨɩɚɫɧɨɫɬɶ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ» ɜ Ʉɚɡɚɯɫɬɚɧɟ ɧɚ ɩɟɪɢɨɞ ɞɨ 2030 ɝɨɞɚ ɜ ɪɚɦɤɚɯ ɩɪɨɜɟɞɟɧɢɹ ɫɢɫɬɟɦɧɨɝɨ ɚɧɚɥɢɡɚ ɢ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɹ ɜ ɫɮɟɪɟ ɧɚɭɤɢ ɢ ɬɟɯɧɨɥɨɝɢɣ. Ɉɞɧɢɦ ɢɡ ɧɚɩɪɚɜɥɟɧɢɣ
ɞɚɧɧɨɝɨ ɩɪɨɟɤɬɚ, ɹɜɥɹɟɬɫɹ ɪɚɡɪɚɛɨɬɤɚ ɝɟɨɢɧɮɨɪɦɚɰɢɨɧɧɨɣ ɫɢɫɬɟɦɵ ɮɢɬɨɫɚɧɢɬɚɪɧɨɝɨ ɦɨɧɢɬɨɪɢɧɝɚ ɡɚ ɨɫɨɛɨ ɨɩɚɫɧɵɦɢ ɢ ɤɚɪɚɧɬɢɧɧɵɦɢ ɜɪɟɞɢɬɟɥɹɦɢ, ɫɨɪɧɵɦɢ ɪɚɫɬɟɧɢɹɦɢ ɢ ɛɨɥɟɡɧɹɦɢ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɵɯ, ɦɧɨɝɨɥɟɬɧɢɯ ɢ ɥɟɫɧɵɯ ɤɭɥɶɬɭɪ ɜ ɪɟɫɩɭɛɥɢɤɟ.
ɂɫɫɥɟɞɨɜɚɧɢɹ ɨɫɧɨɜɵɜɚɸɬɫɹ ɧɚ ɫɬɚɧɞɚɪɬɧɵɯ ɩɨɞɯɨɞɚɯ ɨɛɪɚɛɨɬɤɢ ɞɚɧɧɵɯ ɞɢɫɬɚɧɰɢɨɧɧɨɝɨ ɡɨɧɞɢɪɨɜɚɧɢɹ, ɩɨɞɫɩɭɬɧɢɤɨɜɵɯ ɧɚɛɥɸɞɟɧɢɣ ɢ Ƚɂɋ-ɬɟɯɧɨɥɨɝɢɣ. Ɉɛɨɪɭɞɨɜɚɧɢɟ, ɧɟɨɛɯɨɞɢɦɨɟ ɞɥɹ ɨɫɭɳɟɫɬɜɥɟɧɢɹ ɧɚɛɥɸɞɟɧɢɣ, ɜɤɥɸɱɚɟɬ ɜ ɫɟɛɹ ɬɚɤɢɟ ɩɥɚɬɮɨɪɦɵ, ɤɚɤ ɢɫɤɭɫɫɬɜɟɧɧɵɟ ɫɩɭɬɧɢɤɢ Ɂɟɦɥɢ,
ɫɚɦɨɥɟɬɵ, ɧɚɡɟɦɧɵɟ ɢ ɚɜɬɨɦɚɬɢɱɟɫɤɢɟ ɧɢɡɤɨɥɟɬɚɸɳɢɟ ɛɟɫɩɢɥɨɬɧɵɟ ɩɥɚɬɮɨɪɦɵ, ɚ ɬɚɤɠɟ ɫɢɫɬɟɦɵ
ɪɟɝɢɫɬɪɚɰɢɢ ɞɚɧɧɵɯ (ɰɢɮɪɨɜɵɟ ɮɨɬɨɤɚɦɟɪɵ, ɬɟɥɟɚɩɩɚɪɚɬɭɪɚ, ɦɧɨɝɨɤɚɧɚɥɶɧɵɟ ɫɤɚɧɟɪɵ, ɜɵɫɨɤɨɪɚɡɪɟɲɚɸɳɢɟ ɜɢɡɭɚɥɶɧɵɟ ɫɢɫɬɟɦɵ) [4].
Ɉɩɵɬ ɤɨɫɦɢɱɟɫɤɨɝɨ ɦɨɧɢɬɨɪɢɧɝɚ ɨɫɧɨɜɧɵɯ ɡɟɪɧɨɫɟɸɳɢɯ ɪɟɝɢɨɧɨɜ Ʉɚɡɚɯɫɬɚɧɚ ɩɨɤɚɡɚɥ ɩɟɪɫɩɟɤɬɢɜɧɨɫɬɶ ɞɚɧɧɨɝɨ ɧɚɩɪɚɜɥɟɧɢɹ ɤɚɤ ɨɞɧɨɝɨ ɢɡ ɢɫɬɨɱɧɢɤɨɜ ɨɛɴɟɤɬɢɜɧɨɣ ɢɧɮɨɪɦɚɰɢɢ ɨ ɩɚɪɚɦɟɬɪɚɯ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ. Ɍɟɯɧɨɥɨɝɢɢ ɤɨɫɦɢɱɟɫɤɨɝɨ ɦɨɧɢɬɨɪɢɧɝɚ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɜɨɡɦɨɠɧɨɫɬɟɣ ɫɟɬɢ ɂɧɬɟɪɧɟɬ, ɛɟɡɭɫɥɨɜɧɨ, ɭɜɟɥɢɱɚɬ ɷɮɮɟɤɬɢɜɧɨɫɬɶ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ
ɨɛɟɫɩɟɱɟɧɢɹ ȺɉɄ ɢ ɪɚɛɨɬɵ ɚɝɪɚɪɧɨɝɨ ɫɟɤɬɨɪɚ ɪɟɫɩɭɛɥɢɤɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
ɂɫɩɨɥɶɡɨɜɚɧɢɟ ɫɨɜɪɟɦɟɧɧɵɯ ɢɧɮɨɪɦɚɰɢɨɧɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ]. – http: // www.bibliofond.ru/view.aspxid.
ɂɫɩɨɥɶɡɨɜɚɧɢɟ Ƚɂɋ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ]. – http: // www.ieassa.org/ru/.
Ƚɂɋ ɜ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ]. – http:// www.vevivi.ru/best/GIS.
Ʉɨɫɦɢɱɟɫɤɢɣ ɦɨɧɢɬɨɪɢɧɝ ɫɟɥɶɫɤɨɯɨɡɹɣɫɬɜɟɧɧɨɝɨ ɩɪɨɢɡɜɨɞɫɬɜɚ ɜ Ʉɚɡɚɯɫɬɚɧɟ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ]. –
http: // d902.iki.rssi.ru/theses-cgi.
361
ɍȾɄ 63:681.2:001.89:004
ɄɅȺɋɌȿɊɇɕɃ ȺɇȺɅɂɁ
ɉɈɄȺɁȺɌȿɅȿɃ ɄȺɑȿɋɌȼȺ ɉɂɓȿȼɈȽɈ ɋɕɊɖə
ɇȺ ɊȺɇɇȿɃ ɋɌȺȾɂɂ ȿȽɈ ɉɊɈɂɁȼɈȾɋɌȼȺ
ɑȺɇɕɒȿȼ Ⱦ.ɂ., ȺɅȿɃɇɂɄɈȼ Ⱥ.Ɏ, ɑȿɒɄɈȼȺ Ⱥ.Ɏ., ɋɌȬɉɈɑɄɂɇ ɉ.ɂ.,
ɎȽȻɇɍ ɋɢɛɢɪɫɤɢɣ ɮɢɡɢɤɨ-ɬɟɯɧɢɱɟɫɤɢɣ ɢɧɫɬɢɬɭɬ ɚɝɪɚɪɧɵɯ ɩɪɨɛɥɟɦ, Ʉɪɚɫɧɨɨɛɫɤ,
Ɋɨɫɫɢɹ, e-mail: fti2009@yandex.ru
ɇɟɨɛɯɨɞɢɦɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ɤɨɦɩɶɸɬɟɪɧɵɯ ɬɟɯɧɨɥɨɝɢɣ ɜ ɫɟɥɟɤɰɢɢ ɪɚɫɬɟɧɢɣ ɨɛɭɫɥɨɜɥɟɧɚ ɭɫɬɚɧɨɜɢɜɲɟɣɫɹ ɩɪɚɤɬɢɤɨɣ ɪɚɧɠɢɪɨɜɚɧɢɹ ɪɟɡɭɥɶɬɚɬɨɜ ɫɟɥɟɤɰɢɢ ɧɚ ɨɫɧɨɜɟ ɨɩɵɬɚ ɢ ɩɪɟɞɩɨɱɬɟɧɢɹɯ
ɫɟɥɟɤɰɢɨɧɟɪɚ, ɤɨɬɨɪɚɹ ɧɭɠɞɚɟɬɫɹ ɜ ɦɚɬɟɦɚɬɢɱɟɫɤɨɦ ɩɨɞɬɜɟɪɠɞɟɧɢɢ. ȼ ɪɚɛɨɬɚɯ [1] – [4] ɚɜɬɨɪɵ
ɢɫɫɥɟɞɨɜɚɥɢ ɩɪɢɦɟɧɟɧɢɟ ɧɟɣɪɨɧɧɨɣ ɫɟɬɢ PNN [5] ɫ ɨɛɭɱɚɸɳɟɣ ɜɵɛɨɪɤɨɣ ɞɥɹ ɪɟɲɟɧɢɹ ɡɚɞɚɱɢ
ɫɟɥɟɤɰɢɢ.
ȼ ɞɚɧɧɨɣ ɪɚɛɨɬɟ ɩɪɢɜɟɞɺɧ ɚɥɝɨɪɢɬɦ ɩɪɨɝɧɨɡɚ ɧɚ ɨɫɧɨɜɟ ɢɫɤɭɫɫɬɜɟɧɧɵɯ ɧɟɣɪɨɧɧɵɯ ɫɟɬɟɣ – ɫɥɨɹ
Ʉɨɯɨɧɟɧɚ ɤ ɤɨɥɥɟɤɰɢɢ ɬɪɢɬɢɤɚɥɟ ɢɡ 210 ɨɛɪɚɡɰɨɜ ɭɪɨɠɚɹ 2011 ɝɨɞɚ ɫ ɛɚɥɥɨɜɨɣ ɨɰɟɧɤɨɣ ɜɯɨɞɧɵɯ
ɩɚɪɚɦɟɬɪɨɜ. Ⱦɥɹ ɫɪɚɜɧɟɧɢɹ ɨɛɪɚɡɰɨɜ ɛɵɥɨ ɜɵɛɪɚɧɨ 20 ɩɪɢɡɧɚɤɨɜ ɫ ɩɪɢɫɜɨɟɧɧɵɦɢ ɢɦ ɫɟɥɟɤɰɢɨɧɧɨ-ɡɧɚɱɢɦɵɦɢ ɜɟɫɚɦɢ (ɜ ɬɚɛɥɢɰɟ ɩɪɟɞɫɬɚɜɥɟɧ ɮɪɚɝɦɟɧɬ ɢɡ ɫɥɭɱɚɣɧɨ ɜɵɛɪɚɧɧɵɯ 6 ɨɛɪɚɡɰɨɜ). ȼ
ɬɚɛɥɢɰɟ ɩɪɢɜɟɞɟɧ 21-ɣ ɩɪɢɡɧɚɤ – ɫɟɥɟɤɰɢɨɧɧɚɹ ɰɟɧɧɨɫɬɶ ɨɛɪɚɡɰɚ (ȼȼ), ɱɬɨ ɹɜɥɹɟɬɫɹ ɫɭɛɴɟɤɬɢɜɧɵɦ ɮɚɤɬɨɪɨɦ, ɩɥɨɞɨɦ ɢɧɬɭɢɰɢɢ ɢ ɨɩɵɬɚ ɫɟɥɟɤɰɢɨɧɟɪɚ. ɐɟɥɶ ɢɫɫɥɟɞɨɜɚɧɢɣ – ɩɨɞɬɜɟɪɞɢɬɶ ɜɵɛɨɪ
ɫɟɥɟɤɰɢɨɧɟɪɚ: ɜɵɹɜɢɬɶ ɨɬɤɥɨɧɟɧɢɟ 21-ɝɨ ɩɪɢɡɧɚɤɚ ɜ ɤɥɚɫɬɟɪɟ.
Ɍɚɛɥɢɰɚ 1
Ʉɨɥɥɟɤɰɢɹ ɬɪɢɬɢɤɚɥɟ ɭɪɨɠɚɹ 2011 ɝɨɞɚ (ɮɪɚɝɦɟɧɬ)
AH
0
0
0
0
0
0
AI
0
5
0
0
2
0
AJ
5
5
5
2
5
5
AK
3
3
3
3
3
3
AL AM AN AO AP AQ AR AS AT AU AV AW AX AY
3
3
3
3
5
3 0
5
3
2
0
0
0
0
3
3
3
3
5
3 4
5
3
3
0
0
0
0
3
4
3
3
5
3 0
5
4
3
0
0
0
0
3
3
3
4
5
5 0
5
3
3
0
0
0
0
3
3
2
2
5
3 0
5
2
3
0
0
0
0
3
3
3
2
5
2 0
4
0
3
0
0
0
0
AZ
0
0
0
0
0
0
BA
0
0
0
0
0
0
BB
0.406
0.470
0.413
0.423
0.408
0.357
AH – ɞɧɢ ɜɫɯɨɞɨɜ ɤɨɥɨɲɟɧɢɹ
AS – ɧɚɬɭɪɚ ɡɟɪɧɚ
AI – ɱɢɫɥɨ ɩɪɨɞɭɤɬɢɜɧɵɯ ɩɨɛɟɝɨɜ
AT – ɞɥɢɧɚ ɨɫɬɟɣ
AJ – ɜɵɫɨɬɚ ɫɪɟɞɧɟɝɨ ɫɬɟɛɥɹ
AU – ɞɢɚɦɟɬɪ ɲɟɣɤɢ
AK – ɞɥɢɧɚ ɫɪɟɞɧɟɝɨ ɤɨɥɨɫɚ
AV – ɜɢɞ ɡɺɪɟɧ
AL – ɱɢɫɥɨ ɤɨɥɨɫɤɨɜ ɫɪɟɞɧɟɝɨ ɤɨɥɨɫɚ
AW – ɨɩɭɲɟɧɢɟ ɲɟɣɤɢ
AM – ɩɥɨɬɧɨɫɬɶ ɫɪɟɞɧɟɝɨ ɤɨɥɨɫɚ
AX – ɩɟɪɟɡɢɦɨɜɤɚ
AN – ɱɢɫɥɨ ɡɺɪɟɧ ɫɪɟɞɧɟɝɨ ɤɨɥɨɫɚ
AY – ɭɫɬɨɣɱɢɜɨɫɬɶ ɤ ɛɭɪɨɣ ɪɠɚɜɱɢɧɟ
AO – ɜɟɫ ɡɺɪɟɧ ɫɪɟɞɧɟɝɨ ɤɨɥɨɫɚ
AZ – ɭɫɬɨɣɱɢɜɨɫɬɶ ɤ ɫɟɩɬɨɪɢɨɡɭ
AP – ɜɟɫ ɡɺɪɟɧ 10-ɬɢ ɤɨɥɨɫɶɟɜ
BA – ɨɬɧɨɲɟɧɢɟ ɞɥɢɧɵ ɤɨɥɨɫɚ ɤ ɜɵɫɨɬɟ
AQ – ɦɚɫɫɚ 1000-ɬɢ ɡɺɪɟɧ
AR – ɨɛɳɢɣ ɜɟɫ
BB – ɜɢɡɭɚɥɶɧɚɹ ɰɟɧɧɨɫɬɶ ɨɛɪɚɡɰɚ
Ɏɨɪɦɢɪɨɜɚɧɢɟ ɫɥɨɹ Ʉɨɯɨɧɟɧɚ ɜɵɩɨɥɧɹɟɬɫɹ ɫ ɩɨɦɨɳɶɸ MatLab-ɮɭɧɤɰɢɢ newc [5].
ɇɚ ɩɪɨɫɬɨɦ ɩɪɢɦɟɪɟ ɩɨɤɚɠɟɦ, ɤɚɤ ɪɚɛɨɬɚɟɬ ɫɥɨɣ Ʉɨɯɨɧɟɧɚ. ɉɪɟɞɩɨɥɨɠɢɦ, ɱɬɨ ɡɚɞɚɧ ɦɚɫɫɢɜ ɢɡ
4 ɞɜɭɯɷɥɟɦɟɧɬɧɵɯ ɜɟɤɬɨɪɨɜ, ɤɨɬɨɪɵɟ ɧɚɞɨ ɪɚɡɞɟɥɢɬɶ ɧɚ ɞɜɚ ɤɥɚɫɫɚ.
clear, p = [.1 .8 .1 .9; .2 .9 .1 .8]
p=
0.1000 0.8000 0.1000 0.9000
0.2000 0.9000 0.1000 0.8000
ȼ ɷɬɨɦ ɩɪɢɦɟɪɟ ɜɢɞɧɨ, ɱɬɨ ɨɞɧɚ ɩɚɪɚ ɜɟɤɬɨɪɨɜ ɪɚɫɩɨɥɨɠɟɧɚ ɜɛɥɢɡɢ ɬɨɱɤɢ (0,0), ɚ ɞɪɭɝɚɹ – ɜɛɥɢɡɢ ɬɨɱɤɢ (1, 1). ɋɮɨɪɦɢɪɭɟɦ ɫɥɨɣ Ʉɨɯɨɧɟɧɚ ɫ ɞɜɭɦɹ ɧɟɣɪɨɧɚɦɢ ɞɥɹ ɚɧɚɥɢɡɚ ɞɜɭɯɷɥɟɦɟɧɬɧɵɯ ɜɟɤɬɨɪɨɜ ɜɯɨɞɚ ɫ ɞɢɚɩɚɡɨɧɨɦ ɡɧɚɱɟɧɢɣ ɨɬ 0 ɞɨ 1.
net = newc([0 1; 0 1],2);
ɉɟɪɜɵɣ ɚɪɝɭɦɟɧɬ ɭɤɚɡɵɜɚɟɬ ɞɢɚɩɚɡɨɧ ɜɯɨɞɧɵɯ ɡɧɚɱɟɧɢɣ, ɜɬɨɪɨɣ ɨɩɪɟɞɟɥɹɟɬ ɤɨɥɢɱɟɫɬɜɨ ɧɟɣɪɨɧɨɜ ɜ ɫɥɨɟ. ɇɚɱɚɥɶɧɵɟ ɡɧɚɱɟɧɢɹ ɷɥɟɦɟɧɬɨɜ ɦɚɬɪɢɰɵ ɜɟɫɨɜ ɡɚɞɚɸɬɫɹ ɤɚɤ ɫɪɟɞɧɟɟ ɦɚɤɫɢɦɚɥɶɧɨɝɨ ɢ
ɦɢɧɢɦɚɥɶɧɨɝɨ ɡɧɚɱɟɧɢɣ, ɬɨ ɟɫɬɶ ɜ ɰɟɧɬɪɟ ɢɧɬɟɪɜɚɥɚ ɜɯɨɞɧɵɯ ɡɧɚɱɟɧɢɣ; ɷɬɨ ɪɟɚɥɢɡɭɟɬɫɹ ɩɨ ɭɦɨɥ362
ɱɚɧɢɸ ɫ ɩɨɦɨɳɶɸ Ɇ-ɮɭɧɤɰɢɢ midpoint ɩɪɢ ɫɨɡɞɚɧɢɢ ɫɟɬɢ. ɍɛɟɞɢɦɫɹ, ɱɬɨ ɷɬɨ ɞɟɣɫɬɜɢɬɟɥɶɧɨ ɬɚɤ
wts = net.IW{1,1}
wts =
0.5000 0.5000
0.5000 0.5000
ɋɟɬɶ ɢɫɩɨɥɶɡɭɟɬ ɮɭɧɤɰɢɸ ɟɜɤɥɢɞɨɜɚ ɪɚɫɫɬɨɹɧɢɹ dist, ɮɭɧɤɰɢɸ ɢɧɢɰɢɚɥɢɡɚɰɢɢ initwb, ɮɭɧɤɰɢɸ
ɨɛɪɚɛɨɬɤɢ ɜɯɨɞɨɜ netsum, ɮɭɧɤɰɢɸ ɚɤɬɢɜɚɰɢɢ compet ɢ ɮɭɧɤɰɢɸ ɨɩɢɫɚɧɢɹ ɬɨɩɨɥɨɝɢɢ hextop.
ɋɦɟɳɟɧɢɹ ɡɚɞɚɸɬɫɹ ɮɭɧɤɰɢɟɣ initcon ɢ ɞɥɹ ɢɧɢɰɢɚɥɢɡɢɪɨɜɚɧɧɨɣ ɫɟɬɢ ɪɚɜɧɵ
net.b{1}
ans =
5.4366
5.4366
Ɉɛɭɱɟɧɢɟ ɫɟɬɢ
Ɋɟɚɥɢɡɭɟɦ 10 ɰɢɤɥɨɜ ɨɛɭɱɟɧɢɹ. Ⱦɥɹ ɷɬɨɝɨ ɦɨɠɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɮɭɧɤɰɢɢ train ɢɥɢ adapt
net.trainParam.epochs = 10; net = train(net,p);
net.adaptParam.passes = 10; [net,y,e] = adapt(net,mat2cell(p));
TRAINR, Epoch 0/10
TRAINR, Epoch 10/10
TRAINR, Maximum epoch reached.
Ɂɚɦɟɬɢɦ, ɱɬɨ ɞɥɹ ɫɟɬɟɣ ɫ ɤɨɧɤɭɪɢɪɭɸɳɢɦ ɫɥɨɟɦ ɩɨ ɭɦɨɥɱɚɧɢɸ ɢɫɩɨɥɶɡɭɟɬɫɹ ɨɛɭɱɚɸɳɚɹ ɮɭɧɤɰɢɹ trainwb1, ɤɨɬɨɪɚɹ ɧɚ ɤɚɠɞɨɦ ɰɢɤɥɟ ɨɛɭɱɟɧɢɹ ɫɥɭɱɚɣɧɨ ɜɵɛɢɪɚɟɬ ɜɯɨɞɧɨɣ ɜɟɤɬɨɪ ɢ ɩɪɟɞɴɹɜɥɹɟɬ
ɟɝɨ ɫɟɬɢ; ɩɨɫɥɟ ɷɬɨɝɨ ɩɪɨɢɡɜɨɞɢɬɫɹ ɤɨɪɪɟɤɰɢɹ ɜɟɫɨɜ ɢ ɫɦɟɳɟɧɢɣ.
ȼɵɩɨɥɧɢɦ ɦɨɞɟɥɢɪɨɜɚɧɢɟ ɫɟɬɢ ɩɨɫɥɟ ɨɛɭɱɟɧɢɹ
a = sim(net,p); ac = vec2ind(a)
ac =
2121
ȼɢɞɢɦ, ɱɬɨ ɫɟɬɶ ɨɛɭɱɟɧɚ ɤɥɚɫɫɢɮɢɤɚɰɢɢ ɜɟɤɬɨɪɨɜ ɜɯɨɞɚ ɧɚ ɞɜɚ ɤɥɚɫɬɟɪɚ: ɩɟɪɜɵɣ ɪɚɫɩɨɥɨɠɟɧ ɜ
ɨɤɪɟɫɬɧɨɫɬɢ ɜɟɤɬɨɪɚ (0, 0), ɜɬɨɪɨɣ – ɜ ɨɤɪɟɫɬɧɨɫɬɢ ɜɟɤɬɨɪɚ (1, 1).
ɉɪɢɦɟɧɟɧɢɟ ɫɥɨɹ Ʉɨɯɨɧɟɧɚ ɤ ɤɨɥɥɟɤɰɢɢ ɬɪɢɬɢɤɚɥɟ ɭɪɨɠɚɹ 2011ɝɨɞɚ ɜɵɹɜɢɥɨ ɬɚɤɢɟ ɨɫɨɛɟɧɧɨɫɬɢ. Ⱦɨ 200 ɰɢɤɥɨɜ ɨɛɭɱɟɧɢɹ ɫɟɬɶ ɧɟ ɪɚɡɥɢɱɚɟɬ ɨɛɪɚɡɰɵ ɢ ɜɫɸ ɤɨɥɥɟɤɰɢɸ ɫɜɨɞɢɬ ɜ 1 ɤɥɚɫɬɟɪ. ɉɨɫɥɟ
600 ɰɢɤɥɨɜ ɨɛɭɱɟɧɢɹ ɫɟɬɶ ɜɵɹɜɢɥɚ ɜ ɤɨɥɥɟɤɰɢɢ 45 ɤɥɚɫɬɟɪɨɜ, ɚ ɩɨɫɥɟ 1100 ɰɢɤɥɨɜ – 111.
ɇɚ ɪɢɫɭɧɤɟ 1 ɩɪɟɞɫɬɚɜɥɟɧ ɚɥɝɨɪɢɬɦ ɤɥɚɫɬɟɪɢɡɚɰɢɢ.
Ɋɢɫ. 1. ɋɯɟɦɚ ɚɥɝɨɪɢɬɦɚ ɤɥɚɫɬɟɪɢɡɚɰɢɢ.
363
ȼ ɬɚɛɥ. 2 ɩɪɟɞɫɬɚɜɥɟɧɵ 7 ɤɥɚɫɬɟɪɨɜ ɩɨɫɥɟ 1100 ɰɢɤɥɨɜ ɨɛɭɱɟɧɢɹ.
Ɍɚɛɥɢɰɚ 2
ɉɪɢɡɧɚɤɢ ɤɥɚɫɬɟɪɨɜ
N ɤɥɚɫɬɟɪɚ
ɂɫɯɨɞɧɵɟ ɧɨɦɟɪɚ ɤɨɥɥɟɤɰɢɢ
ɋɟɥɟɤɰɢɨɧɧɚɹ ɰɟɧɧɨɫɬɶ
1
2
3
4
5
6
7
6
3
4
5 28 38
16
9 20 22
24
0,428
0,421
0,418
0,427 0,412 0,414
0,415
0,409 0,406 0,413
0,408
ɋɪɟɞɧɟɚɪɢɮɦ. ɫɟɥɟɤɰɢɨɧɧɨɣ
ɰɟɧɧɨɫɬɢ
0,428
0,421
0,418
0,4178
0,415
0,4093
0,408
ɇɚ ɪɢɫ. 2 ɩɪɟɞɫɬɚɜɥɟɧɵ ɪɟɡɭɥɶɬɚɬɵ ɪɚɫɱɟɬɨɜ ɩɨɫɥɟ 1100 ɰɢɤɥɨɜ ɨɛɭɱɟɧɢɹ ɢ ɝɪɚɮɢɤɢ ɩɪɨɰɟɧɬɧɨɝɨ ɨɬɤɥɨɧɟɧɢɹ ɫɟɥɟɤɰɢɨɧɧɨɣ ɰɟɧɧɨɫɬɢ ɜ ɤɥɚɫɬɟɪɟ.
Ɍɚɤɢɦ ɨɛɪɚɡɨɦ, ɪɚɡɪɚɛɨɬɚɧɧɵɟ ɦɟɬɨɞɢɤɚ ɢ ɚɥɝɨɪɢɬɦ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɹ ɩɨɤɚɡɚɬɟɥɟɣ ɤɚɱɟɫɬɜɚ ɩɢɳɟɜɨɝɨ ɫɵɪɶɹ ɦɨɠɧɨ ɩɪɢɦɟɧɹɬɶ ɫ ɜɵɫɨɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɶɸ ɧɚ ɪɚɡɥɢɱɧɵɯ ɷɬɚɩɚɯ ɫɟɥɟɤɰɢɢ ɤɭɥɶɬɭɪ.
Ɋɢɫ. 2. Ɋɟɡɭɥɶɬɚɬɵ ɨɰɟɧɤɢ ɫɟɥɟɤɰɢɨɧɧɨɣ ɰɟɧɧɨɫɬɢ
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
364
Ⱥɥɟɣɧɢɤɨɜ Ⱥ.Ɏ. , ɋɬɺɩɨɱɤɢɧ ɉ.ɂ., Ƚɪɟɛɟɧɧɢɤɨɜɚ ɂ.Ƚ.,ɑɚɧɵɲɟɜ Ⱦ.ɂ. Ƚɨɥɵɲɟɜ Ⱦ.ɇ. ɉɪɨɝɪɚɦɦɧɨ-ɚɥɝɨɪɢɬɦɢɱɟɫɤɢɟ ɫɪɟɞɫɬɜɚ ɢ ɢɫɤɭɫɫɬɜɟɧɧɵɟ ɧɟɣɪɨɧɧɵɟ ɫɟɬɢ ɜ ɫɟɥɟɤɰɢɢ ɪɚɫɬɟɧɢɣ: ɦɟɬɨɞɢɱɟɫɤɢɟ ɪɟɤɨɦɟɧɞɚɰɢɢ. – ɇɨɜɨɫɢɛɢɪɫɤ», 2008. – 16 ɫ.
ɑɚɧɵɲɟɜ Ⱦ.ɂ., Ⱥɥɟɣɧɢɤɨɜ Ⱥ. Ɏ. Ⱥɥɝɨɪɢɬɦ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɹ ɩɨɤɚɡɚɬɟɥɟɣ ɤɚɱɟɫɬɜɚ ɩɢɳɟɜɨɝɨ ɫɵɪɶɹ
ɪɚɫɬɢɬɟɥɶɧɨɝɨ ɩɪɨɢɫɯɨɠɞɟɧɢɹ // ɉɢɳɚ. ɗɤɨɥɨɝɢɹ. Ʉɚɱɟɫɬɜɨ: ɬɪɭɞɵ VII ɦɟɠɞɭɧɚɪ. ɧɚɭɱɧ.-ɩɪɚɤɬ. ɤɨɧɮ. –
ɇɨɜɨɫɢɛɢɪɫɤ, 2010. – ɋ. 258–260.
Ƚɪɟɛɟɧɧɢɤɨɜɚ ɂ.Ƚ. , Ⱥɥɟɣɧɢɤɨɜ Ⱥ. Ɏ., ɋɬɺɩɨɱɤɢɧ ɉ.ɂ., ɑɚɧɵɲɟɜ Ⱦ.ɂ. ɋɬɪɭɤɬɭɪɚ ɤɨɦɩɥɟɤɫɚ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɨɛɟɫɩɟɱɟɧɢɹ ɫɟɥɟɤɰɢɨɧɧɨɝɨ ɢɧɮɨɪɦɚɰɢɨɧɧɨɝɨ ɩɪɨɰɟɫɫɚ ɬɪɢɬɢɤɚɥɟ // ɇɨɜɟɣɲɢɟ ɧɚɩɪɚɜɥɟɧɢɹ ɪɚɡɜɢɬɢɹ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ ɜ ɪɚɛɨɬɚɯ ɦɨɥɨɞɵɯ ɭɱɺɧɵɯ: ɬɪɭɞɵ IV ɦɟɠɞɭɧɚɪ. ɧɚɭɱɧ. ɤɨɧɮ. ɦɨɥɨɞɵɯ
ɭɱɺɧɵɯ, ɩɨɫɜɹɳɺɧɧɨɣ 40-ɥɟɬɢɸ ɋɈ Ɋɨɫɫɟɥɶɯɨɡɚɤɚɞɟɦɢɢ. – ɇɨɜɨɫɢɛɢɪɫɤ, 2010. – ɋ. 247–249.
ɑɚɧɵɲɟɜ Ⱦ.ɂ., Ƚɪɟɛɟɧɧɢɤɨɜɚ ɂ.Ƚ. , Ⱥɥɟɣɧɢɤɨɜ Ⱥ. Ɏ., ɋɬɺɩɨɱɤɢɧ ɉ.ɂ. Ⱥɥɝɨɪɢɬɦ ɩɪɨɝɧɨɡɢɪɨɜɚɧɢɹ ɫɟɥɟɤɰɢɨɧɧɨɣ ɰɟɧɧɨɫɬɢ ɨɛɪɚɡɰɨɜ ɬɪɢɬɢɤɚɥɟ ɧɚ ɨɫɧɨɜɟ ɢɫɤɭɫɫɬɜɟɧɧɵɯ ɧɟɣɪɨɧɧɵɯ ɫɟɬɟɣ // ȺȽɊɈɂɇɎɈ2012 – ɋ. 107–113.
Notebook “ɇɟɣɪɨɧɧɵɟ ɫɟɬɢ” (ɋ. 3) [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ] – http://pandia.org/text/78/102/560–3.php.
ɂɇɇɈȼȺɐɂə ɂ ɉȿɊȿȾȺɑȺ ɉɊɈȽɊȿɋɋɂȼɇɕɏ
ɌȿɏɇɈɅɈȽɂɃ ȼ ȺȽɊɈɂɇȾɍɋɌɊɂɂ
ɍȾɄ 668.411: 636.294
ɌȿɏɇɈɅɈȽɂə ɉɈɅɍɑȿɇɂə ɋɍɉɊȺɆɈɅȿɄɍɅəɊɇɕɏ
ɄɈɆɉɅȿɄɋɈȼ ɂɁ ɄɈɆɉɈɇȿɇɌɈȼ ɉȺɇɌɈȼ
ȾɍɒɄɂɇ Ⱥ.ȼ.1, ɆȿɅɖɇɂɄɈȼ ȼ.Ⱥ.2, ɒȿɅȿɉɈȼ ȼ.Ƚ.2,
1
ɂɧɫɬɢɬɭɬ ɯɢɦɢɢ ɬɜɟɪɞɨɝɨ ɬɟɥɚ ɢ ɦɟɯɚɧɨɯɢɦɢɢ ɋɈ ɊȺɇ
(ɊɎ, Ⱥɤɚɞɟɦɝɨɪɨɞɨɤ, ɝ. ɇɨɜɨɫɢɛɢɪɫɤ).
2
ɎȽȻɍ “ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ”
(ɊɎ, ɩɨɫ. Ʉɪɚɫɧɨɨɛɫɤ ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ), vshelepov@yandex.ru
Ȼɥɚɝɨɞɚɪɹ ɡɧɚɱɢɬɟɥɶɧɨɦɭ ɫɨɞɟɪɠɚɧɢɸ ɜ ɪɚɫɬɢɬɟɥɶɧɨɦ ɫɵɪɶɟ ɢ ɭɧɢɤɚɥɶɧɵɦ ɫɜɨɣɫɬɜɚɦ ɜɨɞɨɪɚɫɬɜɨɪɢɦɵɣ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧ (ȺȽ) ɡɚɧɢɦɚɟɬ ɨɫɨɛɨɟ ɦɟɫɬɨ ɫɪɟɞɢ ɩɨɥɢɫɚɯɚɪɢɞɨɜ. ɋɨɝɥɚɫɧɨ Ⱦɠ.
Ⱥɫɩɢɧɚɥɥɭ [1], ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɵ ɩɨɞɪɚɡɞɟɥɹɸɬɫɹ ɧɚ ɞɜɚ ɬɢɩɚ: ɚɪɚɛɢɧɨ-4-ɝɚɥɚɤɬɚɧɵ (ɬɢɩ I) ɢ
ɚɪɚɛɢɧɨ-3,6-ɝɚɥɚɤɬɚɧɵ (ɬɢɩ II). Ⱥɪɚɛɢɧɨɝɚɥɚɤɬɚɧɵ II ɬɢɩɚ ɧɚɢɛɨɥɟɟ ɪɚɫɩɪɨɫɬɪɚɧɟɧɵ ɢ ɢɦɟɸɬ ɫɭɳɟɫɬɜɟɧɧɨɟ ɩɪɚɤɬɢɱɟɫɤɨɟ ɡɧɚɱɟɧɢɟ. Ɉɧɢ ɫɨɫɬɚɜɥɹɸɬ ɨɫɧɨɜɭ ɤɚɦɟɞɟɣ ɩɨɤɪɵɬɨɫɟɦɟɧɧɵɯ ɪɚɫɬɟɧɢɣ,
ɧɚɩɪɢɦɟɪ ɚɤɚɰɢɢ, ɚ ɬɚɤɠɟ ɝɨɥɨɫɟɦɟɧɧɵɯ, ɨɫɨɛɟɧɧɨ ɥɢɫɬɜɟɧɧɢɰɵ (ɪɨɞ Larix). Ʉɚɦɟɞɶ ɚɤɚɰɢɢ ɢ
ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧ ɥɢɫɬɜɟɧɧɢɰɵ ɫɨɫɬɚɜɥɹɸɬ ɡɧɚɱɢɬɟɥɶɧɭɸ ɱɚɫɬɶ ɢɯ ɛɢɨɦɚɫɫɵ. Ɍɚɤ, ɹɞɪɨɜɚɹ ɞɪɟɜɟɫɢɧɚ ɧɟɤɨɬɨɪɵɯ ɜɢɞɨɜ ɥɢɫɬɜɟɧɧɢɰɵ ɫɨɞɟɪɠɢɬ ɞɨ 35 % ȺȽ, ɚ ɨɞɧɨ ɞɟɪɟɜɨ ɚɤɚɰɢɢ ɦɨɠɟɬ ɟɠɟɝɨɞɧɨ
ɩɪɨɞɭɰɢɪɨɜɚɬɶ ɛɨɥɟɟ 2 ɤɝ ɤɚɦɟɞɢ [2].
Ɇɧɨɝɨɥɟɬɧɢɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨɥɢɫɚɯɚɪɢɞɨɜ ɜɵɫɲɢɯ ɪɚɫɬɟɧɢɣ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɨɧɢ ɨɛɥɚɞɚɸɬ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɶɸ, ɛɥɚɝɨɞɚɪɹ ɱɟɦɭ ɦɨɝɭɬ ɧɚɣɬɢ ɲɢɪɨɤɨɟ ɩɪɢɦɟɧɟɧɢɟ. Ȼɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɟ ɪɚɫɬɢɬɟɥɶɧɵɟ ɩɨɥɢɫɚɯɚɪɢɞɵ ɢɫɩɨɥɶɡɭɸɬɫɹ ɞɥɹ ɥɟɱɟɧɢɹ ɹɡɜɟɧɧɨɣ ɛɨɥɟɡɧɢ, ɜɵɜɟɞɟɧɢɹ ɢɡ ɨɪɝɚɧɢɡɦɚ ɫɨɥɟɣ ɬɹɠɟɥɵɯ ɦɟɬɚɥɥɨɜ ɢ ɪɚɞɢɨɧɭɤɥɢɞɨɜ [3, 4]. Ȼɨɥɶɲɢɧɫɬɜɨ ɩɪɟɞɫɬɚɜɢɬɟɥɟɣ ɝɚɥɚɤɬɚɧɫɨɞɟɪɠɚɳɢɯ ɩɨɥɢɫɚɯɚɪɢɞɨɜ ɜɵɫɲɢɯ ɪɚɫɬɟɧɢɣ ɹɜɥɹɸɬɫɹ ɢɦɦɭɧɨɦɨɞɭɥɹɬɨɪɚɦɢ, ɚɤɬɢɜɢɪɭɸɳɢɦɢ
ɪɟɬɢɤɭɥɨɷɧɞɨɬɟɥɢɚɥɶɧɭɸ ɫɢɫɬɟɦɭ (Ɋɗɋ), ɭɜɟɥɢɱɢɜɚɸɬ ɮɚɝɨɰɢɬɚɪɧɵɣ ɢɧɞɟɤɫ.
ȼ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɢɫɫɥɟɞɨɜɚɧɢɹ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɚɤɬɢɜɧɨɫɬɢ ȺȽ ɪɟɡɤɨ ɚɤɬɢɜɢɡɢɪɨɜɚɥɢɫɶ. ɗɬɨɦɭ
ɫɩɨɫɨɛɫɬɜɭɸɬ ɬɚɤɢɟ ɟɝɨ ɫɜɨɣɫɬɜɚ, ɤɚɤ ɜɵɫɨɤɚɹ ɪɚɫɬɜɨɪɢɦɨɫɬɶ ɜ ɜɨɞɟ, ɭɧɢɤɚɥɶɧɨ ɧɢɡɤɚɹ ɜɹɡɤɨɫɬɶ
ɪɚɫɬɜɨɪɨɜ, ɭɡɤɨɟ ɦɨɥɟɤɭɥɹɪɧɨ-ɦɚɫɫɨɜɨɟ ɪɚɫɩɪɟɞɟɥɟɧɢɟ, ɚ ɬɚɤɠɟ ɛɢɨɪɚɡɥɚɝɚɟɦɨɫɬɶ.
ɍɫɬɚɧɨɜɥɟɧɨ, ɱɬɨ ȺȽ ɫɬɢɦɭɥɢɪɭɟɬ ɮɚɝɨɰɢɬɚɪɧɭɸ ɚɤɬɢɜɧɨɫɬɶ ɦɚɤɪɨɮɚɝɨɜ ɜ ɨɬɧɨɲɟɧɢɢ ɩɫɟɜɞɨɬɭɛɟɪɤɭɥɟɡɧɵɯ ɦɢɤɪɨɛɨɜ, ɨɤɚɡɵɜɚɹ ɜɵɪɚɠɟɧɧɨɟ ɢɧɝɢɛɢɪɭɸɳɟɟ ɞɟɣɫɬɜɢɟ ɧɚ ɪɚɡɦɧɨɠɟɧɢɟ ɩɨɫɥɟɞɧɢɯ ɜɧɭɬɪɢ ɦɚɤɪɨɮɚɝɨɜ. Ɉɧ ɞɟɣɫɬɜɭɟɬ ɧɚ ɜɫɟ ɡɜɟɧɶɹ
ɮɚɝɨɰɢɬɚɪɧɨɝɨ ɩɪɨɰɟɫɫɚ, ɚɤɬɢɜɢɪɭɹ
ɯɟɦɨɬɚɤɫɢɫ, ɚɞɝɟɡɢɸ, ɩɨɝɥɨɬɢɬɟɥɶɧɭɸ ɢ ɛɚɤɬɟɪɢɰɢɞɧɭɸ ɫɩɨɫɨɛɧɨɫɬɶ ɩɟɪɢɬɨɧɟɚɥɶɧɵɯ ɦɚɤɪɨɮɚɝɨɜ
[5]. ɇɚ ɨɫɧɨɜɟ ȺȽ ɢɡ ɡɚɩɚɞɧɨɣ ɥɢɫɬɜɟɧɧɢɰɵ ɪɚɡɪɚɛɨɬɚɧɚ ɢɦɦɭɧɨɫɬɢɦɭɥɢɪɭɸɳɚɹ ɩɢɳɟɜɚɹ ɞɨɛɚɜɤɚ
«ImmunEnhancer TMAG», ɨɛɟɫɩɟɱɢɜɚɸɳɚɹ ɭɤɪɟɩɥɟɧɢɟ ɢɦɦɭɧɧɨɣ ɫɢɫɬɟɦɵ ɱɟɥɨɜɟɤɚ ɩɪɢ ɩɪɢɟɦɟ
20 ɦɝ/ɤɝ (~1,5 ɝ) ɜ ɞɟɧɶ. ɉɨɜɵɲɟɧɢɟ ɢɦɦɭɧɢɬɟɬɚ ɩɪɢ ɩɪɢɟɦɟ «ImmunEnhancer TMAG» ɨɛɭɫɥɨɜɥɟɧɨ
ɭɫɢɥɟɧɢɟɦ ɩɪɨɥɢɮɟɪɚɰɢɢ ɢɦɦɭɧɧɵɯ ɤɥɟɬɨɤ. Ʉɪɨɦɟ ɬɨɝɨ, ɨɧ ɚɤɬɢɜɢɪɭɟɬ ɞɪɭɝɭɸ ɜɟɬɜɶ ɢɦɦɭɧɧɨɣ
ɫɢɫɬɟɦɵ ɱɟɥɨɜɟɤɚ – ɫɢɫɬɟɦɭ ɤɨɦɩɥɟɦɟɧɬɚ. ɗɮɮɟɤɬɵ ȺȽ ɦɧɨɝɨɩɥɚɧɨɜɵ ɢ, ɜɟɪɨɹɬɧɨ, ɨɛɭɫɥɨɜɥɟɧɵ
ɟɝɨ ɩɨɞɨɛɢɟɦ ɤɨɦɩɨɧɟɧɬɚɦ ɤɥɟɬɨɱɧɨɣ ɫɬɟɧɤɢ ɧɟɤɨɬɨɪɵɯ ɛɚɤɬɟɪɢɣ. ɉɨɞɨɛɧɨɟ ɫɨɟɞɢɧɟɧɢɟ ɹɜɥɹɟɬɫɹ
ɨɫɧɨɜɨɣ ɤɥɟɬɨɱɧɨɣ ɫɬɟɧɤɢ ɧɟɤɨɬɨɪɵɯ ɜɢɞɨɜ ɛɚɤɬɟɪɢɣ, ɤɨɬɨɪɵɟ ɢɫɩɨɥɶɡɭɸɬɫɹ ɜ ɪɹɞɟ ɫɬɢɦɭɥɢɪɭɸɳɢɯ ɢɦɦɭɧɧɭɸ ɫɢɫɬɟɦɭ ɜɚɤɰɢɧ. ɍ ɥɸɞɟɣ, ɩɪɢɧɢɦɚɜɲɢɯ ɷɬɭ ɞɨɛɚɜɤɭ, ɧɚɛɥɸɞɚɥɨɫɶ ɭɥɭɱɲɟɧɢɟ
ɮɢɡɢɱɟɫɤɨɝɨ ɢ ɷɦɨɰɢɨɧɚɥɶɧɨɝɨ ɡɞɨɪɨɜɶɹ.
ȼɫɟ ɨɩɢɫɚɧɧɨɟ ɜɵɲɟ ɩɨɛɭɞɢɥɨ ɧɚɫ ɫɨɟɞɢɧɢɬɶ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧ ɫ ɩɚɧɬɚɦɢ ɫ ɰɟɥɶɸ ɫɨɡɞɚɧɢɹ
ɧɨɜɨɝɨ ɤɨɦɩɨɡɢɬɧɨɝɨ ɩɪɨɞɭɤɬɚ ɧɚ ɨɫɧɨɜɟ ɩɪɢɪɨɞɧɵɯ ɪɟɫɭɪɫɨɜ ɋɢɛɢɪɢ.
ȼ ɧɚɲɢɯ ɭɫɥɨɜɢɹɯ ɩɪɨɢɡɜɨɞɫɬɜɚ ɚɪɚɛɢɧɨ-3,6-ɝɚɥɚɤɬɚɧɚ ɩɪɚɤɬɢɱɟɫɤɢ ɢɫɤɥɸɱɟɧ ɩɪɨɰɟɫɫ ɧɚɝɪɟɜɚ
ɢɫɯɨɞɧɨɝɨ ɫɵɪɶɹ ɢ ɜɵɩɚɪɢɜɚɧɢɟ ɡɚ ɫɱɟɬ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɭɥɶɬɪɚɡɜɭɤɨɜɵɯ ɱɚɫɬɨɬ. ȼ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɣ
ɩɪɨɰɟɫɫ ɤɨɧɰɟɧɬɪɚɰɢɢ ɜɨɞɧɨɝɨ ɚɷɪɨɡɨɥɹ ɩɪɢɦɟɧɹɟɬɫɹ ɞɢɩɨɥɹɪɢɡɚɰɢɹ ɱɚɫɬɢɰ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚ.
ɋɨɝɥɚɫɧɨ ɩɪɟɞɥɨɠɟɧɧɨɦɭ ɫɩɨɫɨɛɭ, ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɷɤɫɬɪɚɤɰɢɹ ɞɪɟɜɟɫɢɧɵ ɥɢɫɬɜɟɧɧɢɰɵ, ɢɡɦɟɥɶɱɟɧɧɨɣ ɞɨ ɪɚɡɦɟɪɚ ɬɟɯɧɨɥɨɝɢɱɧɨɣ ɳɟɩɵ. ɗɤɫɬɪɚɤɰɢɹ ɫɵɪɶɹ ɩɪɨɜɨɞɢɬɫɹ ɜɨɞɨɣ, ɜ ɪɟɠɢɦɟ ɭɥɶɬɪɚɡɜɭɤɨɜɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ ɜ ɬɟɱɟɧɢɟ 30–40 ɦɢɧɭɬ ɩɪɢ ɬɟɦɩɟɪɚɬɭɪɟ 20–25°ɋ. ɉɪɢ ɷɬɨɦ ɝɢɞɪɨɦɨɞɭɥɶ
ɫɨɫɬɚɜɥɹɟɬ 1:5 ɤ ɦɚɫɫɟ ɚɛɫɨɥɸɬɧɨ ɫɭɯɨɝɨ ɫɵɪɶɹ, ɡɚɬɟɦ ɜɨɞɧɵɣ ɷɤɫɬɪɚɤɬ ɨɬɮɢɥɶɬɪɨɜɵɜɚɸɬ. ȼɨɞɧɵɣ
ɷɤɫɬɪɚɤɬ ɦɟɬɨɞɨɦ ɢɫɩɚɪɟɧɢɹ ɜ ɭɥɶɬɪɚɡɜɭɤɨɜɨɦ ɢɫɩɚɪɢɬɟɥɟ ɪɚɡɞɟɥɹɸɬ ɩɨ ɮɪɚɤɰɢɹɦ. Ⱥɷɪɨɡɨɥɶ ɨɬ
ɢɫɩɚɪɢɬɟɥɹ ɩɪɨɩɭɫɤɚɸɬ ɱɟɪɟɡ ɤɨɥɨɧɤɢ ɞɥɹ ɨɫɚɠɞɟɧɢɹ ɤɨɧɞɟɧɫɚɬɚ, ɫ ɩɨɫɥɟɞɭɸɳɟɣ ɮɢɥɶɬɪɚɰɢɟɣ ɢ
365
ɨɫɚɠɞɟɧɢɟɦ ȺȽ ɱɟɬɵɪɟɯɤɪɚɬɧɵɦ ɨɛɴɟɦɨɦ ɷɬɢɥɨɜɨɝɨ ɫɩɢɪɬɚ, ɞɟɤɚɧɬɚɰɢɟɣ, ɩɪɨɦɵɜɚɧɢɟɦ ɨɫɚɞɤɚ
ɫɩɢɪɬɨɦ ɢ ɜɵɫɭɲɢɜɚɧɢɟɦ, ɧɚɞɨɫɚɞɨɱɧɚɹ ɠɢɞɤɨɫɬɶ ɩɨɫɥɟ ɨɫɚɠɞɟɧɢɹ ȺȽ ɢ ɟɝɨ ɩɪɨɦɵɜɤɢ ɩɨɞɜɟɪɝɚɟɬɫɹ ɩɟɪɟɝɨɧɤɟ ɢ ɜɧɨɜɶ ɜɤɥɸɱɚɟɬɫɹ ɜ ɩɪɨɰɟɫɫ ɩɪɨɢɡɜɨɞɫɬɜɚ ȺȽ.
ɐɟɥɟɜɨɣ ɩɪɨɞɭɤɬ, ɫɨɞɟɪɠɢɬ ɧɟ ɦɟɧɟɟ 99 % ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧɚ ɢ ɧɟ ɛɨɥɟɟ 1 % ɞɢɝɢɞɪɨɤɜɟɪɰɟɬɢɧɚ. ɉɪɟɞɥɨɠɟɧɧɵɣ ɫɩɨɫɨɛ ɩɨɡɜɨɥɹɟɬ ɩɨɥɭɱɢɬɶ ɚɪɚɛɢɧɨɝɚɥɚɤɬɚɧ ɫ ɧɟɡɧɚɱɢɬɟɥɶɧɵɦ ɤɨɥɢɱɟɫɬɜɨɦ
ɮɟɧɨɥɶɧɵɯ ɩɪɢɦɟɫɟɣ.
ɂɫɯɨɞɧɵɦ ɫɵɪɶɟɦ ɩɪɢ ɢɡɦɟɥɶɱɟɧɢɢ, ɫɦɟɲɢɜɚɧɢɢ ɢ ɤɨɦɩɥɟɤɫɨɨɛɪɚɡɨɜɚɧɢɢ ɩɚɧɬɨɜɨɣ ɩɪɨɞɭɤɰɢɢ ɫ ɚɪɚɛɢɧɨ-3,6-ɝɚɥɚɤɬɚɧɨɦ ɦɨɝɭɬ ɢɫɩɨɥɶɡɨɜɚɬɶɫɹ ɧɚɬɢɜɧɵɟ ɤɨɦɩɨɧɟɧɬɵ (ɢɡɦɟɥɶɱɟɧɧɵɟ ɩɚɧɬɵ),
ɚ ɬɚɤɠɟ ɫɭɯɢɟ ɷɤɫɬɪɚɤɬɵ ɩɚɧɬɨɜ ɢ ɢɯ ɮɪɚɤɰɢɢ.
ȼ ɩɪɨɰɟɫɫɟ ɨɛɪɚɛɨɬɤɢ ɜ ɦɟɯɚɧɢɱɟɫɤɨɦ ɚɤɬɢɜɚɬɨɪɟ, ɦɨɳɧɨɦ ɢɡɦɟɥɶɱɢɬɟɥɶɧɨɦ ɚɩɩɚɪɚɬɟ, ɫ ɜɟɳɟɫɬɜɨɦ ɩɪɨɢɫɯɨɞɹɬ ɪɚɡɥɢɱɧɵɟ ɢɡɦɟɧɟɧɢɹ, ɢɦɟɸɳɢɟ ɧɟɫɤɨɥɶɤɨ ɫɬɚɞɢɣ: ɢɡɦɟɥɶɱɟɧɢɟ ɢɫɯɨɞɧɵɯ
ɬɜɟɪɞɵɯ ɱɚɫɬɢɰ, ɢɯ ɚɝɪɟɝɚɰɢɹ ɢ ɡɚɬɟɦ ɫɦɟɲɟɧɢɟ ɜɯɨɞɹɳɢɯ ɜ ɢɯ ɫɨɫɬɚɜ ɜɟɳɟɫɬɜ ɧɚ ɩɪɚɤɬɢɱɟɫɤɢ ɦɨɥɟɤɭɥɹɪɧɨɦ ɭɪɨɜɧɟ. ɇɚ ɩɨɫɥɟɞɧɟɣ ɫɬɚɞɢɢ ɦɨɝɭɬ ɩɪɨɢɫɯɨɞɢɬɶ ɯɢɦɢɱɟɫɤɢɟ ɩɪɟɜɪɚɳɟɧɢɹ, ɢɡɦɟɧɟɧɢɹ
ɤɪɢɫɬɚɥɥɢɱɟɫɤɨɣ ɫɬɪɭɤɬɭɪɵ, ɨɛɪɚɡɨɜɚɧɢɟ ɬɜɟɪɞɵɯ ɪɚɫɬɜɨɪɨɜ ɢ ɬ. ɞ. ɇɟɤɨɬɨɪɵɟ ɩɪɨɰɟɫɫɵ ɜɨɡɦɨɠɧɵ ɬɨɥɶɤɨ ɩɪɢ ɦɟɯɚɧɢɱɟɫɤɨɣ ɚɤɬɢɜɚɰɢɢ – ɧɚɩɪɢɦɟɪ, ɨɛɪɚɡɨɜɚɧɢɟ ɤɨɦɩɨɡɢɬɧɵɯ ɱɚɫɬɢɰ-ɚɝɪɟɝɚɬɨɜ
ɢɡ ɱɚɫɬɢɰ ɜɟɳɟɫɬɜ-ɪɟɚɝɟɧɬɨɜ ɢɥɢ ɬɜɟɪɞɵɯ ɪɚɫɬɜɨɪɨɜ ɜɟɳɟɫɬɜ ɪɚɡɥɚɝɚɸɳɢɯɫɹ ɩɪɢ ɩɥɚɜɥɟɧɢɢ
Ɍɚɤɢɟ ɡɧɚɱɢɬɟɥɶɧɵɟ ɢ ɛɥɚɝɨɩɪɢɹɬɧɵɟ ɢɡɦɟɧɟɧɢɹ ɮɚɪɦɚɤɨɥɨɝɢɱɟɫɤɢɯ ɯɚɪɚɤɬɟɪɢɫɬɢɤ ɨɛɭɫɥɨɜɥɟɧɵ ɨɛɪɚɡɨɜɚɧɢɟɦ ɫɭɩɪɚɦɨɥɟɤɭɥɹɪɧɵɯ ɤɨɦɩɥɟɤɫɨɜ ɬɢɩɚ «ɝɨɫɬɶ – ɯɨɡɹɢɧ», ɝɞɟ «ɝɨɫɬɶ» – ɦɨɥɟɤɭɥɵ ɩɚɧɬɨɜɨɣ ɩɪɨɞɭɤɰɢɢ, «ɯɨɡɹɢɧ» – ɦɚɤɪɨɦɨɥɟɤɭɥɚ ɩɨɥɢɫɚɯɚɪɢɞɚ (ɧɨɫɢɬɟɥɶ).
Ɏɚɪɦɚɤɨɥɨɝɢɱɟɫɤɢɣ ɷɮɮɟɤɬ ɬɚɤɢɯ ɫɬɪɭɤɬɭɪ, ɜɟɪɨɹɬɧɨ, ɞɨɫɬɢɝɚɟɬɫɹ ɡɚ ɫɱɟɬ «ɚɞɪɟɫɧɨɣ» ɞɨɫɬɚɜɤɢ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ ɤ ɚɤɬɢɜɧɵɦ ɰɟɧɬɪɚɦ ɫɨɨɬɜɟɬɫɬɜɭɸɳɢɯ ɪɟɰɟɩɬɨɪɨɜ ɨɪɝɚɧɢɡɦɚ,
ɬ.ɟ. ɛɥɚɝɨɞɚɪɹ ɢɫɩɨɥɶɡɨɜɚɧɢɸ ɩɨɞɯɨɞɚ Drug Delivery.
ɉɪɟɞɜɚɪɢɬɟɥɶɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɩɨɥɭɱɟɧɧɵɣ ɩɪɨɞɭɤɬ ɹɜɥɹɟɬɫɹ ɧɨɜɵɦ ɩɪɨɪɵɜɧɵɦ ɧɚɩɪɚɜɥɟɧɢɟɦ ɜ ɩɟɪɟɪɚɛɨɬɤɟ ɩɚɧɬɨɜɨɣ ɩɪɨɞɭɤɰɢɢ ɫ ɪɚɡɥɢɱɧɵɦ ɰɟɥɟɜɵɦ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ, ɨɬ
ɦɟɞɢɰɢɧɵ ɞɨ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ.
Ʉɨɦɩɥɟɤɫɧɵɟ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɪɨɞɨɥɠɚɸɬɫɹ, ɪɟɡɭɥɶɬɚɬɵ ɢɯ ɩɨɡɜɨɥɹɬ ɜ ɰɟɥɨɦ ɢɡɦɟɧɢɬɶ ɬɟɯɧɨɥɨɝɢɸ ɩɨɥɭɱɟɧɢɹ ɦɟɞɢɰɢɧɫɤɢɯ, ɛɚɥɶɧɟɨɥɨɝɢɱɟɫɤɢɯ (ɩɚɧɬɨɜɵɟ ɜɚɧɧɵ), ɜɟɬɟɪɢɧɚɪɧɵɯ ɩɪɟɩɚɪɚɬɨɜ,
ɫɪɟɞɫɬɜ ɤɨɫɦɟɬɨɥɨɝɢɢ ɢ ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ ɮɭɧɤɰɢɨɧɚɥɶɧɨɣ ɧɚɩɪɚɜɥɟɧɧɨɫɬɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
4.
5.
Aspinall G.O. Some recent developments in the chemistry of arabinogalactans // In: Chimie et Biochimie de
la Lignine, de la Cellulose et des Hemicelluloses. Actes du Symposium International de Grenoble. 1964. –
P. 89–97.
Clarcke A.E., Anderson R.L., Stone B.A. Form and function of arabinogalactans and arabinogalactan-proteins
// Phytochemistry. – 1979. – Vol. 18. – P. 521–540.
Wagner H. Search for plant natural products with immunostimulatory activity (recent advances) // Pure and
Appl. Chem. – 1990. – Vol. 62, N 7. – P. 1217–1222.
Ɉɜɨɞɨɜ ɘ.ɋ. ɉɨɥɢɫɚɯɚɪɢɞɵ ɰɜɟɬɤɨɜɵɯ ɪɚɫɬɟɧɢɣ: ɫɬɪɭɤɬɭɪɚ ɢ ɮɢɡɢɨɥɨɝɢɱɟɫɤɚɹ ɚɤɬɢɜɧɨɫɬɶ // Ȼɢɨɨɪɝɚɧɢɱɟɫɤɚɹ ɯɢɦɢɹ. – 1998. Ɍ. 24, ʋ7. – ɋ. 483–501.
Ɇɟɞɜɟɞɟɜɚ ɋ.Ⱥ., Ⱥɥɟɤɫɚɧɞɪɨɜɚ Ƚ.ɉ., Ⱦɭɛɪɨɜɢɧɚ ȼ.ɂ. ɢ ɞɪ. Ⱥɪɚɛɢɧɨɝɚɥɚɤɬɚɧ ɥɢɫɬɜɟɧɧɢɰɵ – ɩɟɪɫɩɟɤɬɢɜɧɚɹ ɩɨɥɢɦɟɪɧɚɹ ɦɚɬɪɢɰɚ ɞɥɹ ɛɢɨɝɟɧɧɵɯ ɦɟɬɚɥɥɨɜ // Butlerov Commun. – 2002. – ʋ7. – Ɋ. 45–49.
ɍȾɄ 626/627:628.011.56
ɈɐȿɇɄȺ ɌȿɏɇɂɑȿɋɄɈȽɈ ɋɈɋɌɈəɇɂə ɂɊɊɂȽȺɐɂɈɇɇɕɏ
ɋɂɋɌȿɆ ɇȺ ɈɋɇɈȼȿ ɌȿɏɇɈɅɈȽɂɃ ȾɂɋɌȺɇɐɂɈɇɇɈȽɈ
ɁɈɇȾɂɊɈȼȺɇɂə ɁȿɆɅɂ
ɂȻɊȺȿȼ Ɍ.Ɍ., Ʌɂ Ɇ.Ⱥ., ȻȺɄȻȿɊȽȿɇɈȼ ɇ.ɇ.,
Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɜɨɞɧɨɝɨ ɯɨɡɹɣɫɬɜɚ,
Ɍɚɪɚɡ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, ɟ-mail: tursun_ibraev@mail.ru
Ɉɪɨɲɚɟɦɵɟ ɡɟɦɥɢ Ʉɚɡɚɯɫɬɚɧɚ ɜ 7–8 ɪɚɡ ɩɪɨɞɭɤɬɢɜɧɟɟ, ɱɟɦ ɧɟɩɨɥɢɜɧɵɟ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ
ɢɡ 2075 ɬɵɫ. ɝɚ ɨɪɨɲɚɟɦɵɯ ɡɟɦɟɥɶ (ɫ ɩɨɬɟɧɰɢɚɥɶɧɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ ɞɨ 600 ɦɥɪɞ ɬɟɧɝɟ ɜ ɝɨɞ),
ɢɦɟɸɳɢɯɫɹ ɜ ɧɚɥɢɱɢɢ, ɢɫɩɨɥɶɡɭɸɬɫɹ 1420 ɬɵɫ. ɝɚ ɢɥɢ 68 % (62 % ɨɬ ɪɚɧɟɟ ɨɫɜɨɟɧɧɵɯ ɡɟɦɟɥɶ), ɧɚ
ɤɨɬɨɪɵɯ ɢɪɪɢɝɚɰɢɨɧɧɵɟ ɫɢɫɬɟɦɵ (ɂɋ) ɢ ɝɢɞɪɨɬɟɯɧɢɱɟɫɤɢɟ ɫɨɨɪɭɠɟɧɢɹ (ȽɌɋ) ɢɡɧɨɲɟɧɵ ɛɨɥɟɟ
ɱɟɦ ɧɚ 70 % [1]. ɉɨ ɞɚɧɧɵɦ Ʉɨɦɢɬɟɬɚ ɩɨ ɱɪɟɡɜɵɱɚɣɧɵɦ ɫɢɬɭɚɰɢɹɦ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟ366
ɦɹ ɢɡ ɢɦɟɸɳɢɯɫɹ 643 ȽɌɋ 268 ɝɢɞɪɨɫɨɨɪɭɠɟɧɢɣ, ɜ ɬɨɦ ɱɢɫɥɟ 28 ɤɪɭɩɧɵɯ – ɧɭɠɞɚɸɬɫɹ ɜ ɫɪɨɱɧɨɦ
ɪɟɦɨɧɬɟ.
Ⱦɥɹ ɨɰɟɧɤɢ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɂɋ ɢ ȽɌɋ ɛɵɥɢ ɩɪɨɜɟɞɟɧ ɤɨɦɩɥɟɤɫ ɧɚɡɟɦɧɨ-ɤɨɫɦɢɱɟɫɤɢɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɧɚ 2-ɯ ɩɢɥɨɬɧɵɯ ɭɱɚɫɬɤɚɯ (ɨɪɨɫɢɬɟɥɶɧɵɟ ɫɢɫɬɟɦɵ ɀɚɧɚɤɨɪɝɚɧɫɤɨɝɨ ɪɚɣɨɧɚ
Ʉɵɡɵɥɨɪɞɢɧɫɤɨɣ ɨɛɥɚɫɬɢ ɢ Ʉɨɪɞɚɣɫɤɨɝɨ ɪɚɣɨɧɚ ɀɚɦɛɵɥɫɤɨɣ ɨɛɥɚɫɬɢ).
Ɇɟɬɨɞɢɱɟɫɤɨɟ ɨɛɟɫɩɟɱɟɧɢɟ ɢɫɫɥɟɞɨɜɚɧɢɣ ɨɫɧɨɜɵɜɚɥɫɹ ɧɚ ɮɭɧɞɚɦɟɧɬɚɥɶɧɵɯ ɩɨɞɯɨɞɚɯ ɢɡɭɱɟɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɜɨɞɨɯɨɡɹɣɫɬɜɟɧɧɵɯ ɨɛɴɟɤɬɨɜ, ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɧɚɡɟɦɧɨ-ɤɨɫɦɢɱɟɫɤɢɯ ɦɟɬɨɞɨɜ ɨɰɟɧɤɢ ɢ ɞɢɚɝɧɨɫɬɢɪɨɜɚɧɢɹ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɂɋ ɢ ȽɌɋ.
ɀɚɧɚɤɨɪɝɚɧɫɤɢɣ ɦɚɫɫɢɜ ɨɪɨɲɟɧɢɹ ɢɦɟɟɬ ɦɟɠɯɨɡɹɣɫɬɜɟɧɧɵɟ ɤɚɧɚɥɵ – 86,4 ɤɦ ɢ ɜɧɭɬɪɢɯɨɡɹɣɫɬɜɟɧɧɵɟ ɤɚɧɚɥɵ – 948 ɤɦ (97 % ɨɛɨɢɯ ɜ ɡɟɦɥɹɧɨɦ ɪɭɫɥɟ), ɚ ɬɚɤɠɟ 19 ȽɌɋ. Ƚɟɨɪɝɢɟɜɫɤɢɣ ɦɚɫɫɢɜ
ɨɪɨɲɟɧɢɹ ɢɦɟɟɬ ɦɚɝɢɫɬɪɚɥɶɧɵɣ ɤɚɧɚɥ – 4,2 ɤɦ, ɦɟɠɯɨɡɹɣɫɬɜɟɧɧɵɟ ɤɚɧɚɥɵ – 111,5 ɤɦ ɢ 23 ȽɌɋ.
Ɍɚɤ ɤɚɤ ɫɪɨɤ ɷɤɫɩɥɭɚɬɚɰɢɢ ɤɚɧɚɥɨɜ ɢ ɫɨɨɪɭɠɟɧɢɣ ɧɚ ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ (1966–76 ɝɝ.) ɢ Ƚɟɨɪɝɢɟɜɫɤɨɣ
(1931–1936 ɝɝ.) ɂɋ ɫɨɫɬɚɜɥɹɟɬ ɫɜɵɲɟ 50–80 ɥɟɬ, ɦɧɨɝɢɟ ɢɡ ɧɢɯ ɯɚɪɚɤɬɟɪɢɡɭɸɬɫɹ ɭɯɭɞɲɟɧɧɵɦ ɬɟɯɧɢɱɟɫɤɢɦ ɫɨɫɬɨɹɧɢɟɦ, ɫɥɟɞɨɜɚɬɟɥɶɧɨ, ɢ ɫɧɢɠɟɧɧɨɣ ɝɢɞɪɚɜɥɢɱɟɫɤɨɣ ɷɮɮɟɤɬɢɜɧɨɫɬɶɸ ɢ ɷɤɫɩɥɭɚɬɚɰɢɨɧɧɨɣ ɧɚɞɟɠɧɨɫɬɶɸ. Ɏɚɤɬɢɱɟɫɤɢɣ ɢɡɧɨɫ ɤɚɧɚɥɨɜ ɢ ȽɌɋ ɫɨɫɬɚɜɥɹɟɬ ɛɨɥɟɟ 60–70 %.
ɉɪɨɩɭɫɤɧɚɹ ɫɩɨɫɨɛɧɨɫɬɶ ɤɚɧɚɥɨɜ ɫɧɢɠɟɧɚ (ɢɧɨɝɞɚ ɜ ɧɟɫɤɨɥɶɤɨ ɪɚɡ), ɨɫɧɨɜɧɵɟ ɩɚɪɚɦɟɬɪɵ ɠɢɜɨɝɨ ɫɟɱɟɧɢɹ ɤɚɧɚɥɨɜ (ɝɥɭɛɢɧɚ, ɲɢɪɢɧɚ) ɨɬɤɥɨɧɟɧɵ ɨɬ ɩɪɨɟɤɬɧɵɯ ɡɧɚɱɟɧɢɣ, ɩɨɬɟɪɢ ɜɨɞɵ ɧɚ ɮɢɥɶɬɪɚɰɢɸ ɭɜɟɥɢɱɟɧɵ, ɄɉȾ ɤɚɧɚɥɨɜ ɡɧɚɱɢɬɟɥɶɧɨ ɭɦɟɧɶɲɟɧɵ, ɨɬɦɟɱɟɧɵ ɨɬɤɚɡɵ ɜ ɢɯ ɪɚɛɨɬɟ (ɩɪɨɪɵɜɵ
ɞɚɦɛ, ɪɚɡɪɭɲɟɧɢɟ ɩɥɢɬ ɨɞɟɠɞ, ɡɚɬɨɩɥɟɧɢɟ ɢ ɩɨɞɬɨɩɥɟɧɢɟ ɩɪɢɥɟɝɚɸɳɢɯ ɤ ɤɚɧɚɥɚɦ ɬɟɪɪɢɬɨɪɢɣ).
Ʉɨɫɦɢɱɟɫɤɢɟ ɫɧɢɦɤɢ ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ ɢ Ƚɟɨɪɝɢɟɜɫɤɨɣ ɂɋ ɩɨɡɜɨɥɢɥɢ ɨɩɪɟɞɟɥɢɬɶ ɧɚɢɛɨɥɟɟ ɩɪɨɛɥɟɦɧɵɣ ɭɱɚɫɬɤɢ ɤɚɧɚɥɨɜ.
ɇɚ ɨɫɧɨɜɚɧɢɢ ɞɚɧɧɵɯ ɞɢɫɬɚɧɰɢɨɧɧɨɝɨ ɡɨɧɞɢɪɨɜɚɧɢɹ Ɂɟɦɥɢ (ȾɁɁ) ɨɩɪɟɞɟɥɟɧɵ ɤɚɧɚɥɵ ɢ ɫɨɨɪɭɠɟɧɢɹ ɞɥɹ ɞɟɬɚɥɶɧɵɯ ɧɚɡɟɦɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ: ɀɚɧɚɤɨɪɝɚɧɫɤɚɹ ɂɋ – ɝɨɥɨɜɧɨɝɨ ɜɨɞɨɡɚɛɨɪɧɨɝɨ ɝɢɞɪɨɭɡɥɚ Ʉɟɥɢɧɬɨɛɢɧɫɤɨɝɨ ɦɚɝɢɫɬɪɚɥɶɧɨɝɨ ɤɚɧɚɥɚ, ɜɨɞɨɪɚɫɩɪɟɞɟɥɢɬɟɥɶɧɵɯ ɝɢɞɪɨɭɡɥɨɜ,
ɚ ɬɚɤɠɟ ɭɱɚɫɬɤɚ ɦɚɝɢɫɬɪɚɥɶɧɨɝɨ ɤɚɧɚɥɚ; Ƚɟɨɪɝɢɟɜɫɤɚɹ ɂɋ – ɝɨɥɨɜɧɨɝɨ ɜɨɞɨɡɚɛɨɪɧɨɝɨ ɝɢɞɪɨɭɡɥɚ
Ƚɟɨɪɝɢɟɜɫɤɨɝɨ ɦɚɝɢɫɬɪɚɥɶɧɨɝɨ ɤɚɧɚɥɚ, ɜɨɞɨɪɚɫɩɪɟɞɟɥɢɬɟɥɶɧɵɯ ɝɢɞɪɨɭɡɥɨɜ, ɚ ɬɚɤɠɟ ɭɱɚɫɬɤɚ ɦɚɝɢɫɬɪɚɥɶɧɨɝɨ ɤɚɧɚɥɚ ɉɪɚɜɨɣ ɜɟɬɤɢ.
Ɉɛɪɚɛɨɬɤɚ ɢ ɚɧɚɥɢɡ ɩɨɥɭɱɟɧɧɵɯ ɞɚɧɧɵɯ ɝɟɨɞɟɡɢɱɟɫɤɢɯ ɫɴɟɦɨɤ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɜɵɫɨɬɧɵɟ ɨɬɦɟɬɤɢ
ȽɌɋ ɢɦɟɸɬ ɩɪɨɫɚɞɤɢ ɢ ɝɨɪɢɡɨɧɬɚɥɶɧɵɟ ɫɦɟɳɟɧɢɹ ɨɬɞɟɥɶɧɵɯ ɤɨɧɫɬɪɭɤɰɢɣ ɧɚ ɞɟɫɹɬɤɢ ɦɢɥɥɢɦɟɬɪɨɜ, ɫɦɟɳɟɧɢɹ ɨɫɢ ɨɪɨɫɢɬɟɥɶɧɵɯ ɤɚɧɚɥɨɜ ɢɧɨɝɞɚ ɩɪɟɜɵɲɚɸɬ ɨɞɢɧ ɦɟɬɪ, ɞɧɨ ɤɚɧɚɥɨɜ ɢɦɟɟɬ ɡɧɚɱɢɬɟɥɶɧɵɟ ɨɬɤɥɨɧɟɧɢɹ ɨɬ ɩɪɨɟɤɬɧɵɯ ɨɬɦɟɬɨɤ, ɧɚ ɜɟɥɢɱɢɧɭ ɫɜɵɲɟ ɩɨɥɭɦɟɬɪɚ, ɬ.ɟ. ɷɬɢ ɩɨɤɚɡɚɬɟɥɢ
ɡɧɚɱɢɬɟɥɶɧɨ ɩɪɟɜɵɲɚɸɬ ɧɨɪɦɚɬɢɜɧɵɟ ɩɚɪɚɦɟɬɪɵ. ɇɟɨɛɯɨɞɢɦɵ ɡɧɚɱɢɬɟɥɶɧɵɟ ɨɛɴɟɦɵ ɛɟɬɨɧɧɵɯ ɢ
ɡɟɦɥɹɧɵɯ) ɪɟɦɨɧɬɧɨ-ɜɨɫɫɬɚɧɨɜɢɬɟɥɶɧɵɯ ɪɚɛɨɬ.
Ɉɰɟɧɤɚ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɂɋ ɢ ȽɌɋ ɨɫɭɳɟɫɬɜɥɹɥɢɫɶ ɧɚ ɨɫɧɨɜɟ ɧɚɛɥɸɞɟɧɢɣ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɝɟɨɮɢɡɢɱɟɫɤɨɝɨ ɦɟɬɨɞɚ: ɧɟɩɪɟɪɵɜɧɨɟ ɝɟɨɪɚɞɢɨɥɨɤɚɰɢɨɧɧɨɟ ɩɪɨɮɢɥɢɪɨɜɚɧɢɟ ɝɟɨɪɚɞɚɪɨɦ
ɈɄɈ-2 [2,3]. ɉɪɨɜɟɞɟɧɵ ɬɟɫɬɨɜɵɟ ɢɫɩɵɬɚɧɢɹ ɦɟɬɨɞɨɦ ɝɟɨɪɚɞɚɪɧɨɝɨ ɡɨɧɞɢɪɨɜɚɧɢɹ ɫɨɫɬɨɹɧɢɹ ɛɟɬɨɧɧɵɯ ɢ ɡɟɦɥɹɧɵɯ ɤɨɧɫɬɪɭɤɰɢɣ ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ ɢ Ƚɟɨɪɝɢɟɜɫɤɨɣ ɂɋ (ɪɢɫ.1).
Ɋɢɫ. 1. Ƚɟɨɪɚɞɚɪɧɵɟ ɩɪɨɮɢɥɹ ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ ɂɋ (2013–14 ɝɝ.)
367
ɋ ɩɨɦɨɳɶɸ ɝɟɨɪɚɞɚɪɧɨɝɨ ɡɨɧɞɢɪɨɜɚɧɢɹ ɤɨɧɫɬɪɭɤɰɢɣ ɝɢɞɪɨɭɡɥɨɜ ɨɛɧɚɪɭɠɟɧɨ ɧɚɥɢɱɢɟ ɡɧɚɱɢɬɟɥɶɧɵɯ ɨɛɴɟɦɨɜ ɪɚɡɭɩɥɨɬɧɟɧɢɣ ɡɟɦɥɹɧɵɯ ɤɨɧɫɬɪɭɤɰɢɣ, ɚ ɬɚɤɠɟ ɧɚɥɢɱɢɟ ɬɪɟɳɢɧ ɢ ɪɚɤɨɜɢɧ
ɜ ɛɟɬɨɧɧɵɯ ɤɨɧɫɬɪɭɤɰɢɹɯ. ɉɨɜɬɨɪɧɨɟ ɝɟɨɪɚɞɚɪɧɨɟ ɨɛɫɥɟɞɨɜɚɧɢɟ ɫ ɩɪɨɮɢɥɢɪɨɜɚɧɢɟɦ ɩɨ ɬɟɦ ɠɟ
ɦɟɫɬɚɦ ɝɞɟ ɩɪɨɜɨɞɢɥɢɫɶ ɪɚɧɟɟ (ɩɪɢɜɹɡɤɚ GPS ɤɨɨɪɞɢɧɚɬɚɦɢ), ɩɨɤɚɡɚɥɨ ɞɢɮɮɟɪɟɧɰɢɚɰɢɸ ɡɨɧ ɪɚɡɭɩɥɨɬɧɟɧɢɣ ɩɨ ɧɟɤɨɬɨɪɵɦ ɝɟɨɪɚɞɚɪɚɝɪɚɦɦɚɦ, , ɱɬɨ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɨɛ ɭɜɟɥɢɱɟɧɧɨɣ ɮɢɥɶɬɪɚɰɢɢ
ɜɨɞɵ ɱɟɪɟɡ ɬɟɥɨ ɡɟɦɥɹɧɵɯ ɫɨɨɪɭɠɟɧɢɣ ɢ, ɨɫɨɛɟɧɧɨ, ɤɨɧɬɚɤɬɧɭɸ ɮɢɥɶɬɪɚɰɢɸ ɜ ɦɟɫɬɚɯ ɫɨɩɪɹɠɟɧɢɹ
ɛɟɬɨɧɧɵɯ ɢ ɡɟɦɥɹɧɵɯ ɤɨɧɫɬɪɭɤɰɢɣ.
ȼɵɱɢɫɥɟɧɧɵɟ ɩɨ ɫɩɟɤɬɪɨɡɨɧɚɥɶɧɵɦ ȾɁɁ ɡɧɚɱɟɧɢɹ ɜɟɝɟɬɚɰɢɨɧɧɨɝɨ ɢɧɞɟɤɫɚ NDVI (Normalize
dDifferenceVegetationIndex) ɹɜɥɹɥɢɫɶ ɨɫɧɨɜɧɵɦɢ ɢɧɞɢɤɚɬɨɪɚɦɢ, ɩɨɡɜɨɥɹɸɳɢɦɢ ɨɩɪɟɞɟɥɢɬɶ ɫɨɫɬɨɹɧɢɟ ɪɚɫɬɢɬɟɥɶɧɨɫɬɢ ɢ ɢɫɩɨɥɶɡɨɜɚɥɢɫɶ ɜ ɤɚɱɟɫɬɜɟ ɢɧɞɢɤɚɰɢɨɧɧɵɯ ɩɪɢɡɧɚɤɨɜ ɬɟɯɧɢɱɟɫɤɨɝɨ
ɫɨɫɬɨɹɧɢɹ ɂɋ. Ⱦɥɹ ɪɚɫɩɨɡɧɚɜɚɧɢɹ ɪɢɫɨɜɵɯ ɱɟɤɨɜ ɫ ɭɞɨɜɥɟɬɜɨɪɢɬɟɥɶɧɨɣ ɢ ɧɢɡɤɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ ɜ ɧɚɫɬɨɹɳɟɣ ɪɚɛɨɬɟ ɢɫɩɨɥɶɡɭɟɬɫɹ ɬɟɯɧɨɥɨɝɢɹ ɤɨɦɩɥɟɤɫɧɨɣ ɨɛɪɚɛɨɬɤɢ ɪɟɡɭɥɶɬɚɬɨɜ ɤɥɚɫɫɢɮɢɤɚɰɢɢ RGB – ɤɨɦɩɨɡɢɬɚ ɢ ɜɵɱɢɫɥɟɧɢɹ ɢɧɞɟɤɫɚ NDVI. ɇɚ ɪɢɫɭɧɤɟ 2 ɩɪɢɜɟɞɟɧɵ – ɫɢɧɬɟɡɢɪɨɜɚɧɧɵɟ ɩɨ ɬɪɟɦ ɫɩɟɤɬɪɚɥɶɧɵɦ ɞɢɚɩɚɡɨɧɚɦ (RGB) ɤɨɫɦɢɱɟɫɤɢɟ ɫɧɢɦɤɢ Landsat ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ ɢ
Ƚɟɨɪɝɢɟɜɫɤɨɣ ɂɋ.
Ɋɢɫ. 2. ɋɢɧɬɟɡɢɪɨɜɚɧɧɵɣ ɩɨ ɬɪɟɦ ɫɩɟɤɬɪɚɥɶɧɵɦ ɞɢɚɩɚɡɨɧɚɦ (R,G,B)
ɤɨɫɦɢɱɟɫɤɢɣ ɫɧɢɦɨɤ Landsat ɀɚɧɚɤɨɝɚɧɫɤɨɣ (ɚ) ɢ Ƚɟɨɪɝɢɟɜɫɤɨɣ (ɛ) ɂɋ
ɇɚ ɪɢɫɭɧɤɟ 3 ɩɪɢɜɟɞɟɧ ɪɟɡɭɥɶɬɚɬ ɞɟɲɢɮɪɢɪɨɜɚɧɢɹ ɫɨɫɬɨɹɧɢɹ ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ ɢ Ƚɟɨɪɝɢɟɜɫɤɨɣ
ɂɋ ɧɚ ɨɫɧɨɜɚɧɢɢ ɪɚɫɱɟɬɚ ɢɧɞɟɤɫɚ NDVI ɩɨ ɞɚɧɧɵɦ ɤɨɫɦɢɱɟɫɤɨɝɨ ɚɩɩɚɪɚɬɚ Landsat.
ɋɪɚɜɧɢɬɟɥɶɧɵɣ ɚɧɚɥɢɡ ɪɟɡɭɥɶɬɚɬɨɜ ɪɚɫɱɟɬɨɜ ɢɧɞɟɤɫɚ NDVI ɩɨ ɞɚɧɧɵɦ ɞɢɫɬɚɧɰɢɨɧɧɨɝɨ
ɡɨɧɞɢɪɨɜɚɧɢɹ ɤɨɫɦɢɱɟɫɤɨɝɨ ɚɩɩɚɪɚɬɚ Landsat ɩɨɤɚɡɵɜɚɟɬ ɡɧɚɱɢɬɟɥɶɧɭɸ ɞɟɝɪɚɞɚɰɢɸ ɡɟɦɟɥɶ
ɀɚɧɚɤɨɪɝɚɧɫɤɨɝɨ ɦɚɫɫɢɜɚ ɨɪɨɲɟɧɢɹ ɜ 2014 ɝ., ɨɛɭɫɥɨɜɥɟɧɧɭɸ ɫɨɤɪɚɳɟɧɢɟɦ ɩɥɨɳɚɞɟɣ, ɡɚɧɹɬɵɯ
ɪɚɫɬɢɬɟɥɶɧɵɦ ɩɨɤɪɨɜɨɦ ɩɪɟɢɦɭɳɟɫɬɜɟɧɧɨ ɜ ɸɠɧɨɣ ɱɚɫɬɢ ɦɚɫɫɢɜɚ.
Ɋɢɫ. 3. Ɋɟɡɭɥɶɬɚɬɵ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɝɨ ɞɟɲɢɮɪɢɪɨɜɚɧɢɹ ɫɨɫɬɨɹɧɢɹ ɩɪɢɪɨɞɧɵɯ ɨɛɴɟɤɬɨɜ
ɀɚɧɚɤɨɪɝɚɧɫɤɨɣ ɢ Ƚɟɨɪɝɢɟɜɫɤɨɣ ɂɋ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɚɥɝɨɪɢɬɦɨɜ ɚɜɬɨɦɚɬɢɱɟɫɤɨɣ ɤɥɚɫɫɢɮɢɤɚɰɢɢ
ɢ ɧɚ ɨɫɧɨɜɟ ɪɚɫɱɟɬɚ ɢɧɞɟɤɫɚ NDVI
368
ȼ ɪɟɡɭɥɶɬɚɬɟ ɜɵɱɢɫɥɟɧɧɵɯ ɩɥɨɳɚɞɟɣ ɫɭɦɦɚɪɧɨɣ ɩɥɨɳɚɞɢ ɪɢɫɨɜɵɯ ɱɟɤɨɜ ɫ ɧɢɡɤɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ (Sp ɤɦ2) ɢ ɨɛɳɟɣ ɩɨɫɟɜɧɨɣ ɩɥɨɳɚɞɢ ɢɫɫɥɟɞɭɟɦɨɝɨ ɭɱɚɫɬɤɚ ɀɚɧɚɤɨɪɝɚɧɫɤɨɝɨ ɂɋ (Sf ɤɦ2)
ɦɨɠɧɨ ɨɩɪɟɞɟɥɢɬɶ ɤɨɷɮɮɢɰɢɟɧɬ P ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɮɭɧɤɰɢɨɧɢɪɨɜɚɧɢɹ ɂɋ: P = Sf / Sp = 260 ɤɦ2 /
25 ɤɦ2 = 10.4. ɑɟɦ ɛɨɥɶɲɟ ɱɟɤɨɜ ɫ ɧɢɡɤɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ, ɬɟɦ ɦɟɧɶɲɟ ɡɧɚɱɟɧɢɟ ɤɨɷɮɮɢɰɢɟɧɬɚ
P. ɋɭɦɦɚɪɧɚɹ ɩɥɨɳɚɞɶ ɪɢɫɨɜɵɯ ɱɟɤɨɜ ɫ ɭɞɨɜɥɟɬɜɨɪɢɬɟɥɶɧɨɣ ɩɪɨɞɭɤɬɢɜɧɨɫɬɶɸ ɫɨɫɬɚɜɥɹɟɬ 24,07
ɤɦ2. Ɋɚɡɪɚɛɨɬɚɧɧɚɹ ɢ ɩɪɨɬɟɫɬɢɪɨɜɚɧɧɚɹ ɧɚ ɬɟɪɪɢɬɨɪɢɢ ɀɚɧɚɤɨɪɝɚɧɫɤɨɝɨ ɦɚɫɫɢɜɚ ɨɪɨɲɟɧɢɹ ɦɟɬɨɞɢɤɚ ɩɪɢɦɟɧɟɧɚ ɞɥɹ ɦɨɧɢɬɨɪɢɧɝɚ ɬɟɯɧɢɱɟɫɤɨɝɨ ɫɨɫɬɨɹɧɢɹ ɢɪɪɢɝɚɰɢɨɧɧɨɣ ɫɢɫɬɟɦɵ Ƚɟɨɪɝɢɟɜɫɤɨɝɨ
ɦɚɫɫɢɜɚ ɨɪɨɲɟɧɢɹ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
3.
Ʉɟɧɟɧɛɚɟɜ Ɍ. Ɍɪɟɛɭɟɬɫɹ ɤɨɦɩɥɟɤɫɧɚɹ ɦɨɞɟɪɧɢɡɚɰɢɹ ɢɪɪɢɝɚɰɢɢ ɢ ɞɪɟɧɚɠɚ ɜ Ʉɚɡɚɯɫɬɚɧɟ. Ɉɪɨɲɟɧɢɟ
ɠɞɟɬ ɤɚɪɞɢɧɚɥɶɧɵɯ ɦɟɪ. Ⱥɝɪɨ ɀɚɪɲɵ, ʋ 38 (216) ɨɬ 28.09.2012 ɝ, ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ. agrozharshy.kz/
index.php?option=com...view.
ɂɡɸɦɨɜ ɋ.ȼ., Ⱦɪɭɱɢɧɢɧ ɋ.ȼ., ȼɨɡɧɟɫɟɧɫɤɢɣ Ⱥ.ɋ. Ɍɟɨɪɢɹ ɢ ɦɟɬɨɞɵ ɝɟɨɪɚɞɢɨɥɨɤɚɰɢɢ. – Ɇ.: ɂɡɞɚɬɟɥɶɫɬɜɨ «Ƚɨɪɧɚɹ ɤɧɢɝɚ», 2008. – 196 ɋ.
Ⱦɭɞɧɢɤ ɉ.ɂ., ɂɥɶɱɭɤ Ⱥ.Ɋ., Ɍɚɬɚɪɫɤɢɣ Ȼ.Ƚ. Ɇɧɨɝɨɮɭɧɤɰɢɨɧɚɥɶɧɵɟ ɪɚɞɢɨɥɨɤɚɰɢɨɧɧɵɟ ɫɢɫɬɟɦɵ: ɭɱɟɛ.
ɩɨɫɨɛɢɟ ɞɥɹ ɜɭɡɨɜ //ɉɨɞ ɪɟɞ. Ȼ.Ƚ. Ɍɚɬɚɪɫɤɨɝɨ. – Ɇ.: «Ⱦɪɨɮɚ», 2007. – 283 ɋ.
ɍȾɄ 616.594.14:615.36
ɏɂɌɈɁȺɇɈȼɕȿ ȽȿɅɂ ȾɅə ɉȺɇɌɈȼɕɏ ȼȺɇɇ
ɄȺɒɂɇȺ Ƚ.ȼ.,* ɆȿɅɖɇɂɄɈȼ ȼ.Ⱥ.,** ɒȿɅȿɉɈȼ ȼ.Ƚ.**,
ɎȽɍɉ ɇɨɜɨɫɢɛɢɪɫɤɚɹ ɡɨɧɚɥɶɧɚɹ ɫɬɚɧɰɢɹ ɫɚɞɨɜɨɞɫɬɜɚ
(ɊɎ. ɩ. Ⱥɝɪɨɥɟɫ, ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ, ɂɫɤɢɬɢɦɫɤɢɣ ɪ-ɨɧ)
ɎȽȻɍ “ɋɢɛɢɪɫɤɨɟ ɨɬɞɟɥɟɧɢɟ ɚɝɪɚɪɧɨɣ ɧɚɭɤɢ”
(ɊɎ, ɩɨɫ. Ʉɪɚɫɧɨɨɛɫɤ ɇɨɜɨɫɢɛɢɪɫɤɨɣ ɨɛɥɚɫɬɢ). vshelepov@yandex.ru
ȼ Ɋɨɫɫɢɢ ɭ ɛɨɥɶɲɟɣ ɱɚɫɬɢ ɠɢɬɟɥɟɣ ɩɪɨɹɜɥɹɸɬɫɹ ɫɢɦɩɬɨɦɵ ɧɟɞɨɫɬɚɬɨɱɧɨɣ ɚɞɚɩɬɚɰɢɢ ɤ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɦ ɮɚɤɬɨɪɚɦ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ, ɮɢɡɢɱɟɫɤɨɣ, ɯɢɦɢɱɟɫɤɨɣ ɢ ɛɢɨɥɨɝɢɱɟɫɤɨɣ ɩɪɢɪɨɞɵ,
ɢɦɦɭɧɨɞɟɮɢɰɢɬɚ, ɜɵɡɜɚɧɧɵɯ ɧɟɩɨɥɧɨɣ ɨɛɟɫɩɟɱɟɧɧɨɫɬɶɸ ɨɪɝɚɧɢɡɦɚ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɦɢ ɜɟɳɟɫɬɜɚɦɢ.
Ⱦɥɹ ɨɩɪɟɞɟɥɟɧɢɹ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɨɡɞɨɪɨɜɢɬɟɥɶɧɵɯ ɢ ɥɟɱɟɛɧɵɯ ɩɪɨɝɪɚɦɦ, ɫɨɫɬɚɜɥɟɧɧɵɯ ɧɚ ɨɫɧɨɜɟ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ, ɜ 2013 ɝ. ɛɵɥɨ ɩɪɨɜɟɞɟɧɨ ɚɧɤɟɬɢɪɨɜɚɧɢɟ ɪɭɤɨɜɨɞɢɬɟɥɟɣ ɫɚɧɚɬɨɪɧɨ-ɤɭɪɨɪɬɧɵɯ ɨɪɝɚɧɢɡɚɰɢɣ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ. ɉɨ ɪɟɡɭɥɶɬɚɬɚɦ ɚɧɤɟɬɢɪɨɜɚɧɢɹ ɢɡ 16 ɭɱɪɟɠɞɟɧɢɣ
ɩɪɨɰɟɞɭɪɭ «ɩɚɧɬɨɜɵɟ ɜɚɧɧɵ» ɢɫɩɨɥɶɡɭɸɬ 15 (93,7 %): ɤɚɤ ɨɡɞɨɪɨɜɢɬɟɥɶɧɭɸ ɩɪɨɰɟɞɭɪɭ – ɜ ɫɟɦɢ
ɫɚɧɚɬɨɪɢɹɯ (43,7 %), ɤɚɤ ɥɟɱɟɛɧɭɸ – ɜ ɱɟɬɵɪɟɯ (25 %) ɤɚɤ ɥɟɱɟɛɧɭɸ ɢ ɨɡɞɨɪɨɜɢɬɟɥɶɧɭɸ – ɜ ɩɹɬɢ
(31,5 %) [1].
Ɍɪɚɞɢɰɢɨɧɧɨ ɩɚɧɬɨɜɵɟ ɜɚɧɧɵ ɝɨɬɨɜɹɬ ɧɚ ɨɫɧɨɜɟ ɜɨɞɧɵɯ ɷɤɫɬɪɚɤɬɨɜ, ɩɨɥɭɱɚɟɦɵɯ ɜ ɩɪɨɰɟɫɫɟ
ɤɨɧɫɟɪɜɢɪɨɜɚɧɢɹ ɩɚɧɬɨɜ. ȼ ɩɪɨɰɟɫɫɟ ɬɟɪɦɢɱɟɫɤɨɣ ɨɛɪɚɛɨɬɤɢ (ɜɚɪɤɢ) ɩɪɨɢɫɯɨɞɢɬ ɟɫɬɟɫɬɜɟɧɧɵɣ
ɩɟɪɟɯɨɞ ɨɩɪɟɞɟɥɟɧɧɨɣ ɱɚɫɬɢ ɜɨɞɨɪɚɫɬɜɨɪɢɦɵɯ ɜɟɳɟɫɬɜ ɩɚɧɬɨɜ ɜ ɝɨɪɹɱɭɸ ɜɨɞɭ. Ɍɚɤɢɦ ɨɛɪɚɡɨɦ,
ɜɚɪɨɱɧɚɹ ɜɨɞɚ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɜɨɞɧɵɣ ɷɤɫɬɪɚɤɬ (ȼɗ) ɢɡ ɩɚɧɬɨɜ, ɫɨɞɟɪɠɚɳɢɣ ɤɨɦɩɥɟɤɫ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ, ɜɵɞɟɥɟɧɧɵɯ ɢɡ ɤɨɠɧɨɝɨ ɩɨɤɪɨɜɚ ɢ ɤɨɫɬɧɨɣ ɬɤɚɧɢ ɩɚɧɬɨɜ.
ɋɨɞɟɪɠɚɧɢɟ ɷɤɫɬɪɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ ɜ ɜɨɞɧɨɦ ɷɤɫɬɪɚɤɬɟ ɫɨɫɬɚɜɥɹɟɬ 0,3 ɝ/ɥɢɬɪ [2].
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɪɢ ɩɪɢɝɨɬɨɜɥɟɧɢɢ ɩɚɧɬɨɜɵɯ ɜɚɧɧ ɩɪɢɦɟɧɹɸɬ ɞɨɩɨɥɧɢɬɟɥɶɧɵɟ ɞɨɛɚɜɤɢ –
ɫɭɯɭɸ ɤɪɨɜɶ ɦɚɪɚɥɚ, ɚɪɨɦɚɬɢɱɟɫɤɢɟ ɜɟɳɟɫɬɜɚ, ɨɬɜɚɪɵ ɪɚɫɬɟɧɢɣ, ɦɢɧɟɪɚɥɶɧɵɟ ɫɨɥɢ ɢ ɩɪɨɱɢɟ ɤɨɦɩɨɧɟɧɬɵ [3].
ɉɚɧɬɨɜɵɟ ɜɚɧɧɵ, ɩɨɥɭɱɟɧɧɵɟ ɢɡ ɜɚɪɨɱɧɨɣ ɜɨɞɵ ɧɚ ɦɚɪɚɥɶɧɢɤɚɯ, ɩɨɞɜɟɪɝɚɸɬɫɹ ɫɢɥɶɧɨɦɭ ɨɛɫɟɦɟɧɟɧɢɸ ɦɢɤɪɨɮɥɨɪɨɣ ɢ ɧɟ ɦɨɝɭɬ ɞɨɥɝɨ ɫɨɯɪɚɧɹɬɶɫɹ. Ⱦɚɠɟ, ɟɫɥɢ ɩɪɢɦɟɧɢɬɶ ɦɨɦɟɧɬɵ ɮɢɥɶɬɪɚɰɢɨɧɧɨɣ ɨɱɢɫɬɤɢ [4], ɬɨ ɷɬɨ ɧɟ ɝɚɪɚɧɬɢɪɭɟɬ ɨɬ ɦɢɤɪɨɛɧɨɝɨ ɡɚɝɪɹɡɧɟɧɢɹ ɪɚɫɬɜɨɪɚ, ɩɨɫɤɨɥɶɤɭ ɬɟɦɩɟɪɚɬɭɪɚ ɜɨɞɵ, ɜ ɤɨɬɨɪɨɣ ɜɚɪɹɬ ɩɚɧɬɵ, ɪɟɞɤɨ ɩɪɟɜɵɲɚɟɬ 70ɨɋ. ɉɪɢ ɷɬɨɦ ɩɚɧɬɨɜɵɟ ɜɚɧɧɵ, ɢɫɯɨɞɹ ɢɡ
ɝɢɝɢɟɧɢɱɟɫɤɢɯ ɩɪɚɜɢɥ, ɞɨɥɠɧɵ ɛɵɬɶ ɫɭɝɭɛɨ ɢɧɞɢɜɢɞɭɚɥɶɧɵ ɞɥɹ ɤɚɠɞɨɝɨ ɱɟɥɨɜɟɤɚ.
Ʉɪɨɦɟ ɭɤɚɡɚɧɧɵɯ ɨɬɪɢɰɚɬɟɥɶɧɵɯ ɦɨɦɟɧɬɨɜ, ɧɟɨɛɯɨɞɢɦɨ ɭɱɢɬɵɜɚɬɶ ɛɢɨɥɨɝɢɱɟɫɤɭɸ ɚɤɬɢɜɧɨɫɬɶ
ɜɚɧɧ ɩɨ ɢɯ ɧɚɫɵɳɟɧɧɨɫɬɢ ɢ ɫɬɟɩɟɧɢ ɞɨɫɬɚɜɤɢ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ ɜ ɨɪɝɚɧɢɡɦ ɱɟɥɨɜɟɤɚ, ɤ ɨɪɝɚɧɚɦ, ɤɨɬɨɪɵɟ ɬɪɟɛɭɸɬ ɤɨɪɪɟɤɰɢɢ. ȼ ɢɡɭɱɚɟɦɨɣ ɧɚɦɢ ɥɢɬɟɪɚɬɭɪɟ ɷɬɢ ɮɚɤɬɨɪɵ ɧɟ ɨɩɢɫɚɧɵ.
Ɋɟɝɥɚɦɟɧɬɢɪɭɟɦɨɟ ɜɪɟɦɹ ɩɪɢɟɦɚ ɜɚɧɧ – 10–20 ɦɢɧɭɬ ɦɟɞɢɰɢɧɫɤɢ ɧɟ ɨɛɨɫɧɨɜɚɧɵ, ɧɟɬ ɞɚɧɧɵɯ,
ɤɚɤɨɣ ɢɡ ɷɥɟɦɟɧɬɨɜ, ɜɤɥɸɱɟɧɧɵɣ ɜ ɤɨɦɩɨɧɟɧɬɵ ɜɚɧɧ, ɫ ɤɚɤɨɣ ɫɤɨɪɨɫɬɶɸ ɩɪɨɧɢɤɚɟɬ ɜ ɨɪɝɚɧɢɡɦ ɢ
ɧɚɱɢɧɚɟɬ ɨɤɚɡɵɜɚɬɶ ɥɟɱɟɛɧɵɣ ɢɥɢ ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɣ ɷɮɮɟɤɬ.
369
ȼ ɫɜɹɡɢ ɫ ɷɬɢɦ ɦɵ ɩɨɫɬɚɜɢɥɢ ɩɟɪɟɞ ɫɨɛɨɣ ɡɚɞɚɱɭ ɨɩɪɟɞɟɥɢɬɶ ɜɨɡɦɨɠɧɨɫɬɶ ɫɨɡɞɚɧɢɹ ɧɨɜɨɝɨ
ɝɟɥɟɜɨɝɨ ɤɨɦɩɥɟɤɫɚ ɧɚ ɨɫɧɨɜɟ ɯɢɬɨɡɚɧɚ, ɫɲɢɬɨɝɨ ɫ ɤɨɧɰɟɧɬɪɚɬɨɦ ɷɤɫɬɪɚɤɬɚ ɩɚɧɬɨɜ, ɫɭɯɨɣ ɤɪɨɜɶɸ
ɦɚɪɚɥɚ ɢ ɞɢɝɢɞɪɨɤɜɟɪɰɢɬɢɧɚ.
Ɂɚɞɚɱɚɦɢ ɪɚɛɨɬɵ ɹɜɥɹɥɨɫɶ:
– ɩɨɥɭɱɢɬɶ ɦɧɨɝɨɮɭɧɤɰɢɨɧɚɥɶɧɵɣ ɤɨɦɩɨɧɟɧɬ ɞɥɹ ɛɚɥɶɧɟɨɥɨɝɢɢ ɢ ɤɨɫɦɟɬɨɥɨɝɢɢ;
– ɩɨɜɵɫɢɬɶ ɚɤɬɢɜɧɨɫɬɶ ɝɟɥɟɜɨɝɨ ɝɢɞɪɨɤɨɦɩɥɟɤɫɚ;
– ɨɩɪɟɞɟɥɢɬɶ ɞɨɩɭɫɬɢɦɵɟ ɞɨɡɵ ɜɧɟɫɟɧɢɹ ɤɨɦɩɨɧɟɧɬɚ ɜ ɜɚɧɧɭ ɧɚ 1 ɤɝ ɜɟɫɚ ɱɟɥɨɜɟɤɚ;
– ɨɛɟɫɩɟɱɢɬɶ ɦɚɤɫɢɦɚɥɶɧɭɸ ɫɨɯɪɚɧɧɨɫɬɶ ɤɨɦɩɥɟɤɫɚ.
Ʉɨɧɰɟɧɬɪɚɬ ɷɤɫɬɪɚɤɬɨɜ ɩɚɧɬɨɜ – ɤɨɦɩɥɟɤɫɧɵɣ ɚɞɚɩɬɨɝɟɧ, ɦɚɬɟɪɢɚɥɵ ɷɤɫɩɟɪɢɦɟɧɬɚɥɶɧɵɯ ɢɫɫɥɟɞɨɜɚɧɢɣ ɫɜɢɞɟɬɟɥɶɫɬɜɭɟɬ ɨ ɬɨɦ, ɱɬɨ ɫɨɞɟɪɠɚɳɢɟɫɹ ɜ ɷɤɫɬɪɚɤɬɚɯ ɩɚɧɬɨɜ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɟ
ɤɨɦɩɨɧɟɧɬɵ ɨɛɥɚɞɚɸɬ ɝɢɩɨɬɟɧɡɢɜɧɵɦ ɢ ɥɢɩɨɬɪɨɩɧɵɦ ɷɮɮɟɤɬɨɦ, ɩɪɨɹɜɥɹɸɬ ɝɨɧɚɞɨɬɪɨɩɧɨɟ ɞɟɣɫɬɜɢɟ ɢ ɚɧɬɢɦɭɬɚɝɟɧɧɵɣ ɷɮɮɟɤɬ, ɢɦɟɸɬ ɢɦɦɭɧɨɫɬɢɦɭɥɢɪɭɸɳɢɟ ɫɜɨɣɫɬɜɚ, ɭɫɢɥɢɜɚɸɬ ɦɟɬɚɛɨɥɢɱɟɫɤɢɟ ɩɪɨɰɟɫɫɵ, ɜ ɬɨɦ ɱɢɫɥɟ ɡɚ ɫɱɟɬ ɚɤɬɢɜɢɡɚɰɢɢ ɨɛɦɟɧɚ ɤɢɫɥɨɪɨɞɚ, ɞɟɣɫɬɜɭɸɬ ɤɚɤ ɜɵɪɚɠɟɧɧɨɟ
ɪɟɩɚɪɚɬɢɜɧɨɟ ɫɪɟɞɫɬɜɨ, ɜɨɡɞɟɣɫɬɜɭɸɬ ɧɚ ɮɭɧɤɰɢɸ ɳɢɬɨɜɢɞɧɨɣ ɠɟɥɟɡɵ, ɦɨɝɭɬ ɪɚɫɫɦɚɬɪɢɜɚɬɶɫɹ
ɤɚɤ ɬɟɬɨɤɫɢɤɚɧɬ. ɉɪɢɦɟɧɟɧɢɟ ɩɪɨɞɭɤɬɨɜ ɨɛɨɝɚɳɟɧɧɵɯ ɩɚɧɬɨɜɨɣ ɩɪɨɞɭɤɰɢɟɣ ɩɨɡɜɨɥɹɟɬ ɩɨɜɵɫɢɬɶ
ɧɟɫɩɟɰɢɮɢɱɟɫɤɭɸ ɪɟɡɢɫɬɟɧɬɧɨɫɬɶ ɨɪɝɚɧɢɡɦɚ ɤ ɜɨɡɞɟɣɫɬɜɢɸ ɧɟɛɥɚɝɨɩɪɢɹɬɧɵɯ ɮɚɤɬɨɪɨɜ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ, ɜɨɫɩɨɥɧɢɬɶ ɞɟɮɢɰɢɬ ɧɭɬɪɢɟɧɬɨɜ, ɩɨɥɭɱɢɬɶ ɦɟɯɚɧɢɡɦ ɛɟɡɨɩɚɫɧɨɝɨ ɩɭɬɢ ɪɟɝɭɥɢɪɨɜɚɧɢɹ
ɢ ɩɨɞɞɟɪɠɤɢ ɮɭɧɤɰɢɣ ɨɬɞɟɥɶɧɵɯ ɨɪɝɚɧɨɜ ɢ ɫɢɫɬɟɦ ɨɪɝɚɧɢɡɦɚ ɱɟɥɨɜɟɤɚ, ɨɛɟɫɩɟɱɢɜɚɹ ɬɟɦ ɫɚɦɵɦ
ɩɨɜɵɲɟɧɢɟ ɭɪɨɜɧɹ ɡɞɨɪɨɜɶɹ, ɫɧɢɠɟɧɢɟ ɡɚɛɨɥɟɜɚɟɦɨɫɬɢ, ɩɪɨɞɥɟɧɢɟ ɠɢɡɧɢ ɱɟɥɨɜɟɤɚ;
Ⱦɢɝɢɞɪɨɤɜɟɪɰɟɬɢɧ ɹɜɥɹɟɬɫɹ ɚɤɬɢɜɧɵɦ ɚɧɬɢɨɤɫɢɞɚɧɬɨɦ ɢ ɨɛɥɚɞɚɟɬ ɤɚɩɢɥɥɹɪɨɩɪɨɬɟɤɬɨɪɧɵɦɢ,
ɩɪɨɬɢɜɨɜɨɫɩɚɥɢɬɟɥɶɧɵɦɢ, ɝɟɩɚɬɨɩɪɨɬɟɤɬɨɪɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɱɬɨ ɞɚɟɬ ɜɨɡɦɨɠɧɨɫɬɶ ɭɫɩɟɲɧɨ
ɩɪɢɦɟɧɹɬɶ ɟɝɨ ɩɪɢ ɩɪɨɢɡɜɨɞɫɬɜɟ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɞɨɛɚɜɨɤ ɤ ɩɢɳɟ, ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɫɪɟɞɫɬɜ,
ɩɪɨɞɭɤɬɨɜ ɩɢɬɚɧɢɹ [5];
Ɇɧɨɝɢɟ ɧɚɡɵɜɚɸɬ ɯɢɬɨɡɚɧ ɜɟɳɟɫɬɜɨɦ 21 ɜɟɤɚ ɢ ɷɬɨ ɧɟ ɫɥɭɱɚɣɧɨ. ɏɢɬɨɡɚɧ ɲɢɪɨɤɨ ɢɡɜɟɫɬɧɵɣ
ɩɪɨɞɭɤɬ. ɏɢɬɢɧ ɢ ɯɢɬɨɡɚɧ, ɩɪɢɪɨɞɧɵɟ ɩɨɥɢɦɟɪɵ, ɩɨɥɭɱɚɟɦɵɟ ɢɡ ɩɚɧɰɢɪɹ ɩɪɨɦɵɫɥɨɜɵɯ ɪɚɤɨɨɛɪɚɡɧɵɯ ɢ ɞɪɭɝɢɯ ɢɫɬɨɱɧɢɤɨɜ, ɨɛɥɚɞɚɸɬ ɦɧɨɠɟɫɬɜɨɦ ɩɨɥɟɡɧɵɯ ɫɜɨɣɫɬɜ, ɱɬɨ ɞɟɥɚɟɬ ɢɯ ɩɪɢɦɟɧɢɦɵɦɢ, ɚ ɜ ɪɹɞɟ ɫɥɭɱɚɟɜ, ɧɟɡɚɦɟɧɢɦɵɦɢ, ɜ ɩɪɨɦɵɲɥɟɧɧɨɫɬɢ, ɦɟɞɢɰɢɧɟ ɢ ɫɟɥɶɫɤɨɦ ɯɨɡɹɣɫɬɜɟ. ɉɨ ɫɜɨɟɣ ɩɪɢɪɨɞɟ ɯɢɬɢɧ ɹɜɥɹɟɬɫɹ ɨɞɧɢɦ ɢɡ ɬɪɺɯ ɧɚɢɛɨɥɟɟ ɱɚɫɬɨ ɜɫɬɪɟɱɚɸɳɢɯɫɹ ɩɨɥɢɫɚɯɚɪɢɞɨɜ, ɤɪɨɦɟ
ɰɟɥɥɸɥɨɡɵ ɢ ɤɪɚɯɦɚɥɚ.
Ȼɥɚɝɨɞɚɪɹ ɩɨɡɢɬɢɜɧɨ ɡɚɪɹɠɟɧɧɵɦ ɦɨɥɟɤɭɥɚɦ ɢ ɫɜɨɣɫɬɜɚɦ ɫɨɪɛɟɧɬɚ ɯɢɬɨɡɚɧ ɤɪɟɩɤɨ ɫɜɹɡɵɜɚɟɬɫɹ
ɫ ɧɟɝɚɬɢɜɧɨ ɡɚɪɹɠɟɧɧɵɦɢ ɦɨɥɟɤɭɥɚɦɢ ɧɚ ɦɟɦɛɪɚɧɚɯ ɦɢɤɪɨɛɨɜ (ɬɟɣɯɨɟɜɵɟ ɤɢɫɥɨɬɵ, ɮɨɫɮɨɪɧɨɤɢɫɥɵɟ ɢ ɤɚɪɛɨɤɫɢɥɶɧɵɟ ɝɪɭɩɩɵ ɫɨɫɬɚɜɥɹɸɬ ɦɢɤɪɨɛɧɵɟ ɫɬɟɧɤɢ). Ɏɢɤɫɚɰɢɹ ɦɟɦɛɪɚɧ ɩɚɪɚɥɢɡɭɟɬ
ɢɯ ɪɚɛɨɬɭ, ɨɫɨɛɟɧɧɨ ɬɪɚɧɫɩɨɪɬ ɢɨɧɨɜ, ɩɨɥɟɡɧɵɯ ɜɟɳɟɫɬɜ, ɱɬɨ ɜɟɞɟɬ ɤ ɭɫɢɥɟɧɢɸ ɱɭɜɫɬɜɢɬɟɥɶɧɨɫɬɢ
ɜɨɡɛɭɞɢɬɟɥɟɣ ɡɚɛɨɥɟɜɚɧɢɣ ɤ ɪɚɡɥɢɱɧɵɦ ɚɧɬɢɛɚɤɬɟɪɢɚɥɶɧɵɦ ɜɟɳɟɫɬɜɚɦ. ɗɬɨɬ ɧɟɫɩɟɰɢɮɢɱɟɫɤɢɣ
ɦɟɯɚɧɢɡɦ ɩɪɨɬɢɜɨɦɢɤɪɨɛɧɨɝɨ ɞɟɣɫɬɜɢɹ ɩɨɡɜɨɥɹɟɬ ɩɨɛɨɪɨɬɶ ɨɫɨɛɟɧɧɨ ɫɬɨɣɤɢɟ ɤ ɚɧɬɢɛɢɨɬɢɤɚɦ ɢɧɮɟɤɰɢɢ : ɫɚɥɶɦɨɧɟɥɥɵ, E colli, ɫɬɚɮɢɥɨɤɨɤ, ɝɪɚɦ(+)ɤɨɤɢ, ɫɢɧɟɝɧɨɣɧɭɸ ɩɚɥɨɱɤɭ, ɝɪɢɛɵ ɤɚɧɞɢɞɚ
[5].
Ⱦɨɫɬɚɜɤɚ ɥɟɤɚɪɫɬɜɟɧɧɨɝɨ ɫɪɟɞɫɬɜɚ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɨɱɟɧɶ ɡɧɚɱɢɬɟɥɶɧɭɸ ɨɛɥɚɫɬɶ ɢɫɫɥɟɞɨɜɚɧɢɣ, ɢ ɛɨɥɶɲɢɟ ɞɟɧɟɠɧɵɟ ɫɪɟɞɫɬɜɚ ɪɚɫɯɨɞɭɸɬɫɹ ɫɟɝɨɞɧɹ ɧɚ ɩɨɢɫɤɢ ɧɨɜɵɯ ɢ ɭɥɭɱɲɟɧɧɵɯ ɤɨɦɩɨɡɢɰɢɣ, ɤɨɬɨɪɵɟ ɞɨɫɬɚɜɥɹɸɬ ɮɚɪɦɚɰɟɜɬɢɱɟɫɤɢɟ ɚɤɬɢɜɧɵɟ ɢɧɝɪɟɞɢɟɧɬɵ, ɬɚɤɢɟ ɤɚɤ ɧɢɡɤɨɦɨɥɟɤɭɥɹɪɧɵɟ ɥɟɤɚɪɫɬɜɟɧɧɵɟ ɫɪɟɞɫɬɜɚ, ɝɟɧɵ ɢ ɜɚɤɰɢɧɵ, ɢ ɜ ɬɨ ɠɟ ɜɪɟɦɹ ɦɢɧɢɦɢɡɢɪɭɸɬ ɧɟɠɟɥɚɬɟɥɶɧɵɟ
ɩɨɛɨɱɧɵɟ ɷɮɮɟɤɬɵ. Ȼɨɥɟɟ ɪɚɧɧɢɟ ɥɟɤɚɪɫɬɜɟɧɧɵɟ ɫɪɟɞɫɬɜɚ ɫɬɚɧɨɜɹɬɫɹ ɧɨɜɵɦɢ ɜ ɧɨɜɵɯ ɢ ɭɥɭɱɲɟɧɧɵɯ ɤɨɦɩɨɡɢɰɢɹɯ.
ɋɜɨɣɫɬɜɚ ɯɢɬɨɡɚɧɚ, ɮɢɡɢɱɟɫɤɢɟ ɢ ɛɢɨɥɨɝɢɱɟɫɤɢɟ, ɫɞɟɥɚɥɢ ɟɝɨ ɧɚɢɛɨɥɟɟ ɩɨɞɯɨɞɹɳɢɦ ɞɥɹ ɞɨɫɬɚɜɤɢ ɮɚɪɦɚɰɟɜɬɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɤɨɦɩɨɧɟɧɬɨɜ ɢ ɜ ɤɚɱɟɫɬɜɟ ɫɪɟɞɫɬɜɚ ɞɨɫɬɚɜɤɢ, ɧɚɩɪɢɦɟɪ, ɞɥɹ
ɜɚɤɰɢɧ, ɮɪɚɝɦɟɧɬɨɜ ɝɟɧɨɜ ɢ ɦɢɤɪɨ-ɊɇɄ. ɉɨɥɟɡɧɵɟ ɢ ɜɚɠɧɵɟ ɨɫɨɛɟɧɧɨɫɬɢ ɯɢɬɨɡɚɧɚ ɡɚɤɥɸɱɚɸɬɫɹ
ɜ ɬɨɦ, ɱɬɨ ɨɧ ɫɨɟɞɢɧɹɟɬɫɹ ɫ ɥɸɛɨɣ ɠɢɜɨɣ ɬɤɚɧɶɸ, ɨɛɥɚɞɚɟɬ ɦɭɤɨɚɞɝɟɡɢɜɧɵɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɪɚɡɥɚɝɚɟɬɫɹ ɢ ɨɬɤɪɵɜɚɟɬ ɩɥɨɬɧɵɟ ɫɨɱɥɟɧɟɧɢɹ ɦɟɠɞɭ ɤɥɟɬɤɚɦɢ. ɋ ɩɨɦɨɳɶɸ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɷɬɢɯ ɫɜɨɣɫɬɜ
ɞɨɫɬɚɜɤɚ ɥɟɤɚɪɫɬɜɟɧɧɨɝɨ ɫɪɟɞɫɬɜɚ ɱɟɪɟɡ ɫɥɢɡɢɫɬɭɸ ɦɟɦɛɪɚɧɭ ɦɨɠɟɬ ɛɵɬɶ ɫɭɳɟɫɬɜɟɧɧɨ ɭɥɭɱɲɟɧɚ.
Ʉɨɦɩɨɡɢɰɢɢ ɥɟɤɚɪɫɬɜɟɧɧɵɯ ɫɪɟɞɫɬɜ ɧɚ ɨɫɧɨɜɟ ɬɟɯɧɨɥɨɝɢɢ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɯɢɬɨɡɚɧɚ ɫɟɝɨɞɧɹ ɪɚɡɪɚɛɚɬɵɜɚɸɬ ɞɥɹ ɪɚɡɥɢɱɧɵɯ ɰɟɥɟɣ, ɧɚɩɪɢɦɟɪ ɜ ɤɚɱɟɫɬɜɟ ɧɨɫɢɬɟɥɟɣ ɜɚɤɰɢɧ, ɝɢɞɪɨɝɟɥɟɣ, ɜɵɫɜɨɛɨɠɞɚɸɳɢɯ ɥɟɤɚɪɫɬɜɟɧɧɨɟ ɫɪɟɞɫɬɜɨ, ɦɟɦɛɪɚɧ, ɫɟɬɱɚɬɨɝɨ ɦɚɬɟɪɢɚɥɚ ɢ ɬɚɤ ɞɚɥɟɟ.
ȼ ɧɚɲɢɯ ɢɫɫɥɟɞɨɜɚɧɢɹɯ ɫɲɢɜɤɚ ɯɢɬɨɡɚɧɚ ɫ ɤɨɧɰɟɧɬɪɢɪɨɜɚɧɧɨɦ ɷɤɫɬɪɚɤɬɨɦ ɩɚɧɬɨɜ, ɤɪɨɜɶɸ ɦɚɪɚɥɨɜ ɢ ɞɢɝɢɞɪɨɤɜɟɪɰɢɬɢɧɚ ɩɪɨɜɨɞɢɬɶɫɹ ɜ ɭɫɥɨɜɢɹɯ ɷɥɟɤɬɪɨɦɚɝɧɢɬɧɨɝɨ ɜɨɡɞɟɣɫɬɜɢɹ ɧɚ ɫɲɢɜɚɟɦɵɟ ɚɝɟɧɬɵ. ɉɪɢ ɷɬɨɦ ɯɢɬɨɡɚɧɚ ɝɢɞɪɨɯɥɨɪɢɞ (ɫɬɟɩɟɧɶ N-ɞɟɚɰɟɬɢɥɢɪɨɜɚɧɢɹ 81 %, MM 145 ɤȾɚ)
ɫɭɫɩɟɧɞɢɪɨɜɚɥɢ ɤɨɧɰɟɧɬɪɚɬɨɦ ɷɤɫɬɪɚɤɬɚ ɩɚɧɬɨɜ.
ɋɨɞɟɪɠɚɧɢɟ ɛɢɨɥɨɝɢɱɟɫɤɢ ɚɤɬɢɜɧɵɯ ɜɟɳɟɫɬɜ ɩɚɧɬɨɜɨɝɨ ɤɨɧɰɟɧɬɪɚɬɚ ɜ 100 ɝ. ɝɢɞɪɨɝɟɥɹ ɫɨɫɬɚɜɥɹɟɬ 12 ɝ., ɱɬɨ ɩɨɡɜɨɥɹɟɬ ɨɛɟɫɩɟɱɢɬɶ ɩɪɢɟɦ 1 ɫɬɚɧɞɚɪɬɧɨɣ ɜɚɧɧɵ ɩɪɢ ɫɚɧɚɬɨɪɧɨ-ɤɭɪɨɪɬɧɨɦ ɥɟɱɟɧɢɢ ɢɥɢ ɜ ɞɨɦɚɲɧɢɯ ɭɫɥɨɜɢɹɯ.
370
ɉɨɥɭɱɟɧɧɵɣ ɝɢɞɪɨɝɟɥɶ ɧɟ ɬɨɤɫɢɱɟɧ, ɩɪɨɹɜɥɹɟɬ ɜɵɫɨɤɭɸ ɛɢɨɥɨɝɢɱɟɫɤɭɸ ɚɤɬɢɜɧɨɫɬɶ ɢ ɦɨɠɟɬ
ɛɵɬɶ ɩɪɢɦɟɧɟɧ ɤɚɤ ɜ ɤɚɱɟɫɬɜɟ ɤɨɫɦɟɬɢɱɟɫɤɨɝɨ ɫɪɟɞɫɬɜɚ ɫ ɥɟɱɟɛɧɨ-ɩɪɨɮɢɥɚɤɬɢɱɟɫɤɢɦɢ ɫɜɨɣɫɬɜɚɦɢ, ɬɚɤ ɢ ɜ ɤɚɱɟɫɬɜɟ ɤɨɦɩɨɡɢɰɢɢ ɞɥɹ ɩɚɧɬɨɜɵɯ ɜɚɧɧ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ:
1.
2.
3.
4.
5.
6.
ɉɨɩɨɜɚ ɂ.ɋ. Ⱥɧɚɥɢɡ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɪɨɞɭɤɰɢɢ ɧɚ ɨɫɧɨɜɟ ɫɵɪɶɹ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ ɜ ɫɚɧɚɬɨɪɧɨɤɭɪɨɪɬɧɵɯ ɨɪɝɚɧɢɡɚɰɢɹɯ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ / ɂ.ɋ. ɉɨɩɨɜɚ, ɍ.Ɏ. ɒɚɪɚɯɨɜɚ/ /Ⱥɤɬɭɚɥɶɧɵɟ ɡɚɞɚɱɢ ɪɚɡɜɢɬɢɹ
ɨɬɟɱɟɫɬɜɟɧɧɨɝɨ ɪɵɧɤɚ ɩɪɨɞɭɤɬɨɜ, ɭɫɥɭɝ ɢ ɬɟɯɧɨɥɨɝɢɣ ɧɚ ɨɫɧɨɜɟ ɫɵɪɶɹ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ ɜ ɢɧɬɟɪɟɫɚɯ ɭɤɪɟɩɥɟɧɢɹ ɡɞɨɪɨɜɶɹ ɧɚɰɢɢ: Ɇɚɬɟɪɢɚɥɵ ɦɟɠɞɭɧɚɪɨɞɧɨɣ ɧɚɭɱɧɨ-ɩɪɚɤɬɢɱɟɫɤɨɣ ɤɨɧɮɟɪɟɧɰɢɢ
(12–13 ɫɟɧɬɹɛɪɹ 2013 ɝɨɞɚ, ɩɨɫ. Ʉɚɬɭɧɶ Ⱥɥɬɚɣɫɤɨɝɨ ɪɚɣɨɧɚ Ⱥɥɬɚɣɫɤɨɝɨ ɤɪɚɹ). – Ȼɢɣɫɤ: ɂɡɞ-ɜɨ Ⱥɥɬ. ɝɨɫ.
ɬɟɯɧ. ɭɧ-ɬɚ, 2013. – ɋ. 26–29.
Ɉɫɢɧɰɟɜ ɇ.ɋ. ɏɢɦɢɱɟɫɤɢɣ ɫɨɫɬɚɜ ɜɨɞɵ ɩɨɫɥɟ ɜɚɪɤɢ ɩɚɧɬɨɜ/ Ɉɫɢɧɰɟɜ ɇ.ɋ., Ȼɨɝɨɦɨɥɨɜɚ Ʌ.ɂ. // ɇɨɜɨɟ ɜ
ɬɟɯɧɨɥɨɝɢɢ ɩɚɧɬɨɜɨɝɨ ɨɥɟɧɟɜɨɞɫɬɜɚ –Ȼɚɪɧɚɭɥ: Ⱥɥɬ. ɤɧ. ɢɡɞ-ɜɨ, 1979. –ɋ. 51–54.
Ɏɪɨɥɨɜ ɇ.Ⱥ. ɉɚɧɬɨɜɵɟ ɩɪɟɩɚɪɚɬɵ: ɩɪɢɨɪɢɬɟɬ ɜ ɫɮɟɪɟ ɢɧɧɨɜɚɰɢɣ ɜ ɩɚɧɬɨɜɨɦ ɨɥɟɧɟɜɨɞɫɬɜɟ/ ɇ.Ⱥ. Ɏɪɨɥɨɜ, ȼ. Ƚ. Ʌɭɧɢɰɵɧ. – Ȼɚɪɧɚɭɥ: ɂɡɞɚɬɟɥɶɫɬɜɨ Ⱥɥɬɚɣɫɤɨɝɨ ɭɧɢɜɟɪɫɢɬɟɬɚ, 2007. – 112 ɫ.
ɍɫɬɪɨɣɫɬɜɨ ɞɥɹ ɩɪɨɜɟɞɟɧɢɹ ɜɚɧɧ /ɋɭɳɟɜɫɤɢɣ ȼ.ɂ.// ɉɚɬ. ɊɎ 2106850. ɨɬ 20.03.1998.
Ɍɟɯɧɨɥɨɝɢɹ ɩɪɨɢɡɜɨɞɫɬɜɚ ɷɬɚɥɨɧɧɨɝɨ ȾȽɄ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ]/ www.lacrona.com
ɉɚɧɬɨɜɵɟ ɜɚɧɧɵ ɜ ɇɨɜɨɫɢɛɢɪɫɤɟ [ɗɥɟɤɬɪɨɧɧɵɣ ɪɟɫɭɪɫ]/ Ⱥɣɛɨɥɢɬ. http://aibolitnsk.ru/services/51/
ɍȾɄ 50.49.31
ɂɇɇɈȼȺɐɂɈɇɇȺə ɌȿɏɇɈɅɈȽɂə SMART CONTROL
ɌɍȿɄȻȺɋɈȼ Ɇ.Ʉ., ɒɄɊɕɅɖ Ⱥ., ɄɈɅɖɐɈȼ Ⱥ.,
ɌɈɈ «ɘɝɨ-Ɂɚɩɚɞɧɵɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ
ɢ ɪɚɫɬɟɧɢɟɜɨɞɫɬɜɚ», ɝ. ɒɵɦɤɟɧɬ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, e-mail: karakul-00@mail.ru
ɉɪɨɛɥɟɦɚ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɠɢɜɨɬɧɵɯ ɜ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɩɪɢɧɢɦɚɟɬ ɜɫɺ ɛɨɥɶɲɭɸ ɚɤɬɭɚɥɶɧɨɫɬɶ.
ȼɩɟɪɜɵɟ ɬɟɯɧɨɥɨɝɢɹ ɩɨ ɷɥɟɤɬɪɨɧɧɨɣ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɠɢɜɨɬɧɵɯ ɛɵɥɚ ɪɚɡɪɚɛɨɬɚɧɚ ɤɨɦɩɚɧɢɟɣ
Texas Instruments. ɋɢɫɬɟɦɚ ɷɥɟɤɬɪɨɧɧɨɝɨ ɦɟɱɟɧɢɹ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ ɦɢɤɪɨɱɢɩ, ɫɤɚɧɟɪ ɢ ɛɚɡɚ
ɞɚɧɧɵɯ. ȼ ɩɚɦɹɬɢ ɦɢɤɪɨɱɢɩɚ ɫɨɞɟɪɠɢɬɫɹ ɤɨɞ, ɫɨɫɬɨɹɳɢɣ ɢɡ ɤɨɦɛɢɧɚɰɢɢ ɰɢɮɪ ɢ ɩɨɡɜɨɥɹɸɳɢɣ
ɢɞɟɧɬɢɮɢɰɢɪɨɜɚɬɶ ɠɢɜɨɬɧɨɟ.
Ȼɚɡɵ ɞɚɧɧɵɯ ɦɨɝɭɬ ɢɦɟɬɶ ɪɚɡɥɢɱɧɭɸ ɮɨɪɦɭ ɜ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɧɚɩɪɚɜɥɟɧɧɨɫɬɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ.
ɇɚ ɞɚɧɧɵɣ ɦɨɦɟɧɬ ɧɟ ɫɭɳɟɫɬɜɭɟɬ ɟɞɢɧɨɣ ɦɟɠɞɭɧɚɪɨɞɧɨɣ ɛɚɡɵ ɞɚɧɧɵɯ, ɫɨɞɟɪɠɚɳɟɣ ɢɧɮɨɪɦɚɰɢɸ ɨɛɨ ɜɫɟɯ ɢɞɟɧɬɢɮɢɰɢɪɨɜɚɧɧɵɯ ɠɢɜɨɬɧɵɯ. Ɉɞɧɨɣ ɢɡ ɩɪɢɱɢɧ ɹɜɥɹɟɬɫɹ ɬɨ, ɱɬɨ ɭɱɪɟɞɢɬɟɥɹɦɢ
ɫɭɳɟɫɬɜɭɸɳɢɯ ɛɚɡ ɞɚɧɧɵɯ ɹɜɥɹɸɬɫɹ ɤɨɦɩɚɧɢɢ-ɩɪɨɢɡɜɨɞɢɬɟɥɢ ɢ ɞɢɫɬɪɢɛɶɸɬɨɪɵ ɨɩɪɟɞɟɥɺɧɧɵɯ
ɫɢɫɬɟɦ ɢɞɟɧɬɢɮɢɤɚɰɢɢ, ɚ ɧɟ ɨɪɝɚɧɢɡɚɰɢɢ ɩɨ ɦɟɠɞɭɧɚɪɨɞɧɨɦɭ ɫɨɬɪɭɞɧɢɱɟɫɬɜɭ. ɇɚ ɞɚɧɧɵɣ ɦɨɦɟɧɬ
ɜ Ɋɨɫɫɢɢ ɫɭɳɟɫɬɜɭɟɬ ɧɟɫɤɨɥɶɤɨ ɛɚɡ ɞɚɧɧɵɯ ɢɞɟɧɬɢɮɢɰɢɪɨɜɚɧɧɵɯ ɠɢɜɨɬɧɵɯ, ɧɟɤɨɬɨɪɵɟ ɢɡ ɧɢɯ
ɫɜɹɡɚɧɵ ɫ ɦɟɠɞɭɧɚɪɨɞɧɵɦɢ ɫɢɫɬɟɦɚɦɢ ɩɨɢɫɤɚ, ɧɚɩɪɢɦɟɪ AnimalFace, Moi-zver.ru, Russiapet.net,
Animal-ID ɜɯɨɞɹɳɢɟ ɜ ɫɨɫɬɚɜ Petmaxx ɢ Europetnet.
ȼ Ʉɚɡɚɯɫɬɚɧɟ ɫɢɬɭɚɰɢɹ ɫ ɷɥɟɤɬɪɨɧɧɨɣ ɢɞɟɧɬɢɮɢɤɚɰɢɟɣ ɠɢɜɨɬɧɵɯ ɧɚɯɨɞɢɬɫɹ ɜ ɫɬɚɞɢɢ ɫɬɚɧɨɜɥɟɧɢɹ. Ɉɞɧɚɤɨ ɭɠɟ ɢɦɟɟɬɫɹ ɩɟɪɜɚɹ ɇɚɰɢɨɧɚɥɶɧɚɹ ɟɞɢɧɚɹ ɛɚɡɚ ɞɚɧɧɵɯ ɷɥɟɤɬɪɨɧɧɨɣ ɢɞɟɧɬɢɮɢɤɚɰɢɢ ɠɢɜɨɬɧɵɯ (PetID.kz), ɤɨɬɨɪɚɹ ɨɛɴɟɞɢɧɹɟɬ ɞɚɧɧɵɟ ɨ ɠɢɜɨɬɧɵɯ, ɢɞɟɧɬɢɮɢɰɢɪɨɜɚɧɧɵɯ ɦɢɤɪɨɱɢɩɚɦɢ ɢ ɢɯ ɜɥɚɞɟɥɶɰɚɯ, ɩɪɨɠɢɜɚɸɳɢɯ ɧɚ ɬɟɪɪɢɬɨɪɢɢ Ɋɟɫɩɭɛɥɢɤɢ Ʉɚɡɚɯɫɬɚɧ, ɚ ɬɚɤɠɟ ɠɢɜɨɬɧɵɯ
ɢɞɟɧɬɢɮɢɰɢɪɨɜɚɧɧɵɯ ɜ ɊɄ, ɧɨ ɩɪɨɠɢɜɚɸɳɢɯ ɡɚɝɪɚɧɢɰɟɣ.
ɇɚɲ ɢɧɫɬɢɬɭɬ ɢɦɟɟɬ ɨɩɪɟɞɟɥɟɧɧɵɣ ɡɚɞɟɥ ɜ ɞɚɧɧɨɣ ɨɛɥɚɫɬɢ, ɩɟɪɜɚɹ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɚɹ ɩɪɨɝɪɚɦɦɚ ɩɥɟɦɟɧɧɨɝɨ ɭɱɟɬɚ ɤɚɪɚɤɭɥɶɫɤɢɯ ɨɜɟɰ ɜ ɋɇȽ ɛɵɥɚ ɪɚɡɪɚɛɨɬɚɧɚ ɧɚɦɢ ɜ 1998 ɝɨɞɭ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɧɚɦɢ ɪɚɡɪɚɛɨɬɚɧɵ ɪɹɞ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɯ ɩɪɨɝɪɚɦɦ ɩɥɟɦɟɧɧɨɝɨ ɭɱɟɬɚ: plemuchet
ɷɥɟɤɬɪɨɧɧɚɹ ɛɚɡɚ ɞɚɧɧɵɯ ɩɥɟɦɟɧɨɝɨ ɭɱɟɬɚ ɫɦɭɲɤɨɜɵɯ ɩɨɪɨɞ ɨɜɟɰ; plemuchet ɷɥɟɤɬɪɨɧɧɚɹ ɛɚɡɚ
ɞɚɧɧɵɯ ɭɱɟɬɚ ɩɥɟɦɟɧɧɵɯ ɦɹɫɨ-ɫɚɥɶɧɵɯ ɤɭɪɞɸɱɧɵɯ ɨɜɟɰ; plemuchet ɷɥɟɤɬɪɨɧɧɚɹ ɛɚɡɚ ɞɚɧɧɵɯ ɭɱɟɬɚ ɩɥɟɦɟɧɧɵɯ ɜɟɪɛɥɸɞɨɜ; ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɣ ɡɨɨɬɟɯɧɢɱɟɫɤɢɣ ɭɱɟɬ ɤɚɪɚɤɭɥɶɫɤɢɯ ɨɜɟɰ, ɷɥɟɤɬɪɨɧɧɚɹ ɛɚɡɚ ɞɚɧɧɵɯ; ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɵɣ ɡɨɨɬɟɯɧɢɱɟɫɤɢɣ ɭɱɟɬ ɝɪɭɛɨɲɟɪɫɬɧɵɯ ɤɭɪɞɸɱɧɵɯ ɨɜɟɰ,
ɷɥɟɤɬɪɨɧɧɚɹ ɛɚɡɚ ɞɚɧɧɵɯ.
Ʉɚɤ ɢɡɜɟɫɬɧɨ, ɩɪɨɝɪɟɫɫ ɧɟ ɫɬɨɢɬ ɧɚ ɦɟɫɬɟ. ɇɚ ɞɚɧɧɵɣ ɩɟɪɢɨɞ ɲɢɪɨɤɨɟ ɩɪɢɦɟɧɟɧɢɟ ɧɚɲɥɚ ɬɟɯɧɨɥɨɝɢɹ NFC (Near Field Communications), ɤɨɬɨɪɚɹ ɩɨɡɜɨɥɹɟɬ ɨɛɟɫɩɟɱɢɜɚɬɶ ɢɞɟɧɬɢɮɢɤɚɰɢɸ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɪɚɞɢɨɫɜɹɡɢ ɧɚ ɧɟ ɛɨɥɶɲɢɯ ɪɚɫɫɬɨɹɧɢɹɯ, ɞɚɧɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɩɨɡɜɨɥɹɟɬ ɜɵɩɨɥɧɹɬɶ
ɛɟɫɩɪɨɜɨɞɧɨɟ ɛɵɫɬɪɨɟ ɫɨɩɪɹɠɟɧɢɟ ɢ ɫɨɟɞɢɧɟɧɢɟ ɫ ɞɪɭɝɢɦɢ ɭɫɬɪɨɣɫɬɜɚɦɢ NFC ɛɟɡ ɜɜɨɞɚ ɩɚɪɨɥɟɣ
ɢ ɩɨɞɬɜɟɪɠɞɟɧɢɹ. ɋɰɟɧɚɪɢɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ NFC ɜɟɥɢɤɢ ɤɚɤ ɩɥɚɬɟɠɧɵɟ ɫɢɫɬɟɦɵ, ɷɥɟɤɬɪɨɧɧɵɟ
371
ɤɨɲɟɥɶɤɢ, ɛɢɥɟɬɵ, ɬɪɚɧɫɩɨɪɬɧɵɟ ɤɚɪɬɵ ɢ ɩɪɨɩɭɫɤɚ. Ⱦɚɧɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɡɚɢɧɬɟɪɟɫɨɜɚɥɚ ɧɚɫ ɢ ɜ
ɷɬɨɦ ɧɚɩɪɚɜɥɟɧɢɢ ɧɚɦɢ ɧɚɱɚɬɵ ɢɫɫɥɟɞɨɜɚɧɢɹ ɩɨ ɩɪɢɦɟɧɟɧɢɸ ɬɟɯɧɨɥɨɝɢɢ NFC ɜ ɠɢɜɨɬɧɨɜɨɞɫɬɜɟ.
Ɋɚɛɨɱɚɹ ɜɟɪɫɢɹ ɩɪɨɟɤɬɚ ɩɨɥɭɱɢɥɚ ɧɚɡɜɚɧɢɟ «Smart Control», ɜ ɢɫɫɥɟɞɨɜɚɧɢɹɯ ɩɪɢɧɢɦɚɸɬ ɭɱɚɫɬɢɟ
ɛɟɥɨɪɭɫɫɤɢɟ ɤɨɥɥɟɝɢ, ɦɵ ɫɱɢɬɚɟɦ, ɱɬɨ ɷɬɨ ɬɟɯɧɨɥɨɝɢɹ ɛɭɞɭɳɟɝɨ.
ɋɚɦɚ ɩɨ ɫɟɛɟ ɬɟɯɧɨɥɨɝɢɹ NFC ɢɦɟɟɬ ɧɟɫɤɨɥɶɤɨ ɨɫɨɛɟɧɧɨɫɬɟɣ, ɤɨɬɨɪɵɟ ɢɦɟɸɬ ɫɜɨɢ ɩɥɸɫɵ ɢ
ɦɢɧɭɫɵ. Ɉɫɧɨɜɧɵɟ ɩɥɸɫɵ: ɛɟɫɤɨɧɬɚɤɬɧɚɹ ɩɟɪɟɞɚɱɚ ɞɚɧɧɵɯ; ɜ ɱɢɩɵ ɜɫɬɪɚɢɜɚɟɬɫɹ ɥɸɛɚɹ ɢɧɮɨɪɦɚɰɢɹ; ɪɚɛɨɱɚɹ ɱɚɫɬɨɬɚ ɧɚɯɨɞɢɬɫɹ ɜ ɧɟ ɬɪɟɛɭɸɳɟɦ ɥɢɰɟɧɡɢɪɨɜɚɧɢɹ ɞɢɚɩɚɡɨɧɟ. Ɉɫɧɨɜɧɵɟ ɦɢɧɭɫɵ:
ɛɟɫɩɪɨɜɨɞɧɚɹ ɫɜɹɡɶ ɧɚ ɤɨɪɨɬɤɢɯ ɪɚɫɫɬɨɹɧɢɹɯ; ɧɢɡɤɚɹ ɫɤɨɪɨɫɬɶ ɩɟɪɟɞɚɱɢ ɞɚɧɧɵɯ (ɞɨɥɢ ɫɟɤɭɧɞɵ)
ɩɨ ɫɪɚɜɧɟɧɢɸ Bluetooth ɢɥɢ Wi-Fi (ɦɝɧɨɜɟɧɧɨ); ɱɢɩ ɪɚɫɯɨɞɭɟɬ ɷɧɟɪɝɢɸ ɜɫɟ ɜɪɟɦɹ, ɚɤɬɢɜɟɧ ɨɧ ɢɥɢ
ɧɟɬ – ɧɟ ɢɦɟɟɬ ɡɧɚɱɟɧɢɹ.
Ɍɟɯɧɨɥɨɝɢɹ NFC ɭɠɟ ɭɜɟɪɟɧɧɨ ɡɚɧɢɦɚɟɬ ɦɟɫɬɨ ɜ ɫɨɜɪɟɦɟɧɧɵɯ ɫɦɚɪɬɮɨɧɚɯ, ɩɥɚɧɲɟɬɚɯ ɫɪɟɞɧɟɝɨ ɭɪɨɜɧɹ. ɉɥɚɬɮɨɪɦɵ Android ɫɟɝɨɞɧɹ ɹɜɥɹɟɬɫɹ ɧɚɢɛɨɥɟɟ ɩɨɩɭɥɹɪɧɨɣ ɞɥɹ NFC-ɭɫɬɪɨɣɫɬɜ, ɜ
iOS ɲɬɚɬɧɵɯ ɫɪɟɞɫɬɜ NFC ɧɟ ɩɪɟɞɭɫɦɨɬɪɟɧɨ, ɚ Windows Phone 8 ɢɦɟɟɬ ɫɭɳɟɫɬɜɟɧɧɨ ɨɝɪɚɧɢɱɟɧɧɵɟ ɜɨɡɦɨɠɧɨɫɬɢ ɪɚɛɨɬɵ ɫ NFC ɞɥɹ ɫɬɨɪɨɧɧɢɯ ɩɪɢɥɨɠɟɧɢɣ. ɍɱɢɬɵɜɚɹ ɜɵɲɟɢɡɥɨɠɟɧɧɨɟ, ɧɚɦɢ
ɪɚɡɪɚɛɚɬɵɜɚɸɬɫɹ ɩɪɢɥɨɠɟɧɢɹ ɞɥɹ ɫɱɢɬɵɜɚɧɢɹ ɱɢɩɨɜ ɫ ɩɨɦɨɳɶɸ ɫɦɚɪɬɮɨɧɚ (ɩɥɚɧɲɟɬɚ), ɤɨɬɨɪɚɹ
ɛɭɞɟɬ ɪɚɛɨɬɚɬɶ ɫɨ ɫɩɟɰɢɚɥɶɧɨɣ ɩɪɨɝɪɚɦɦɨɣ Android Smart Control. ɉɪɢɧɰɢɩ ɪɚɛɨɬɵ ɩɪɨɫɬɨɣ, ɞɥɹ
ɫɨɟɞɢɧɟɧɢɹ ɞɜɭɯ ɭɫɬɪɨɣɫɬɜ ɧɟɨɛɯɨɞɢɦɨ ɩɪɨɫɬɨ ɢɯ ɩɨɞɧɟɫɬɢ ɞɪɭɝ ɤ ɞɪɭɝɭ ɢ ɫɨɟɞɢɧɟɧɢɟ ɩɪɨɢɡɨɣɞɟɬ
ɚɜɬɨɦɚɬɢɱɟɫɤɢ. ɋɦɚɪɬɮɨɧ ɚɜɬɨɦɚɬɢɱɟɫɤɢ ɜɵɩɨɥɧɹɟɬ ɤɨɦɚɧɞɵ, ɤɨɬɨɪɵɟ ɦɵ ɡɚɩɢɫɚɥɢ ɜ ɱɢɩ, ɞɚɧɧɵɟ
ɚɤɤɭɦɭɥɢɪɭɸɬɫɹ ɜ ɛɚɡɟ, ɢɧɮɨɪɦɚɰɢɹ ɧɚ ɱɢɩɟ ɡɚɲɢɮɪɨɜɵɜɚɟɬɫɹ ɢ ɡɚɤɪɵɜɚɟɬɫɹ ɫɩɟɰɢɚɥɶɧɵɦɢ ɤɥɸɱɚɦɢ, ɬɚɤ ɱɬɨ ɢɡɦɟɧɢɬɶ ɢɯ ɩɨɡɞɧɟɟ ɧɟɜɨɡɦɨɠɧɨ.
ɍȾɄ 628.112.2
ɂɇɇɈȼȺɐɂɈɇɇȺə ɌȿɏɇɈɅɈȽɂə ɗɄɋɉɅɍȺɌȺɐɂɂ
ɈȻȼɈȾɇɂɌȿɅɖɇɕɏ ɒȺɏɌɇɕɏ ɄɈɅɈȾɐȿȼ
ɌɍɆɅȿɊɌ ȼ.Ⱥ., ɌȿɅɖȽȺɊȺȿȼȺ Ƚ.ȿ., ȺɆȺɇȽȿɅɖȾɂȿȼ ɋ.ɋ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɜɨɞɧɨɝɨ ɯɨɡɹɣɫɬɜɚ»,
ɝ.Ɍɚɪɚɡ, Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, ɟ-mail: kiwr-t@mail.ru, iwre@bk.ru
Ɉɛɜɨɞɧɟɧɢɟ ɩɚɫɬɛɢɳ ɜ ɩɭɫɬɵɧɧɨɣ ɢ ɩɨɥɭɩɭɫɬɵɧɧɨɣ ɡɨɧɟ ɊɄ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɜ ɨɫɧɨɜɧɨɦ ɲɚɯɬɧɵɦɢ ɤɨɥɨɞɰɚɦɢ ɢ ɜɨɞɨɡɚɛɨɪɧɵɦɢ ɫɤɜɚɠɢɧɚɦɢ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ 70 % ɤɨɥɨɞɰɟɜ ɡɚɢɥɟɧɵ ɢ
ɧɟ ɨɛɟɫɩɟɱɢɜɚɸɬ ɜɨɞɨɣ ɩɪɢɥɟɝɚɸɳɢɟ ɩɚɫɬɛɢɳɚ ɞɥɹ ɰɟɥɟɣ ɠɢɜɨɬɧɨɜɨɞɫɬɜɚ. Ⱦɥɹ ɩɪɟɞɨɬɜɪɚɳɟɧɢɹ
ɞɟɝɪɚɞɚɰɢɢ ɩɚɫɬɛɢɳ ɢ ɨɫɜɨɟɧɢɹ ɨɬɞɚɥɟɧɧɵɯ ɩɚɫɬɛɢɳɧɵɯ ɭɱɚɫɬɤɨɜ ɧɟɨɛɯɨɞɢɦɨ ɜɨɫɫɬɚɧɨɜɥɟɧɢɟ ɢ
ɨɪɝɚɧɢɡɚɰɢɹ ɷɮɮɟɤɬɢɜɧɨɣ ɷɤɫɩɥɭɚɬɚɰɢɢ ɨɛɜɨɞɧɢɬɟɥɶɧɵɯ ɫɨɨɪɭɠɟɧɢɣ.
Ɉɞɧɢɦ ɢɡ ɧɚɢɛɨɥɟɟ ɬɪɭɞɨɟɦɤɢɯ ɩɪɨɰɟɫɫɨɜ ɩɪɢ ɷɤɫɩɥɭɚɬɚɰɢɢ ɲɚɯɬɧɨɝɨ ɤɨɥɨɞɰɚ ɹɜɥɹɟɬɫɹ ɨɱɢɫɬɤɚ ɨɬ ɩɟɫɱɚɧɧɵɯ ɧɚɧɨɫɨɜ ɢ ɢɧɨɪɨɞɧɵɯ ɬɟɥ ɧɚɤɚɩɥɢɜɚɸɳɢɯɫɹ ɜ ɜɨɞɨɩɪɢɟɦɧɨɣ ɱɚɫɬɢ.
ɇɚ ɩɪɚɤɬɢɤɟ ɲɚɯɬɧɵɟ ɤɨɥɨɞɰɵ ɞɢɚɦɟɬɪɨɦ ɨɬ 0,8 ɢ ɛɨɥɟɟ 1ɦ ɩɪɟɢɦɭɳɟɫɬɜɟɧɧɨ ɨɱɢɳɚɸɬ ɨɬ
ɡɚɢɥɟɧɢɹ ɢ ɦɭɫɨɪɚ ɬɪɨɟ ɪɚɛɨɱɢɯ, ɨɞɢɧ ɢɡ ɤɨɬɨɪɵɯ ɧɚɯɨɞɢɬɫɹ ɜ ɤɨɥɨɞɰɟ, ɚ ɞɜɨɟ ɞɪɭɝɢɯ ɧɚ ɩɨɜɟɪɯɧɨɫɬɢ ɡɟɦɥɢ. ȼ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɫɬɟɩɟɧɢ ɡɚɢɥɟɧɢɹ ɛɪɢɝɚɞɚ ɨɱɢɳɚɟɬ ɡɚ ɫɦɟɧɭ 1–3 ɤɨɥɨɞɰɚ.
Ɇɚɥɨɩɪɨɢɡɜɨɞɢɬɟɥɶɧɵɣ ɪɭɱɧɨɣ ɬɪɭɞ ɢ ɪɚɫɫɪɟɞɨɬɨɱɟɧɧɨɫɬɶ ɨɛɴɟɤɬɨɜ ɪɚɛɨɬ ɧɚ ɛɨɥɶɲɨɣ ɬɟɪɪɢɬɨɪɢɢ ɜɵɹɜɢɥɢ ɨɫɬɪɭɸ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɫɤɨɪɟɣɲɟɝɨ ɪɚɡɪɟɲɟɧɢɹ ɩɪɨɛɥɟɦɵ ɦɟɯɚɧɢɡɚɰɢɢ ɨɱɢɫɬɤɢ
ɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ.
Ⱦɥɹ ɩɪɨɜɟɞɟɧɢɹ ɨɱɢɫɬɤɢ ɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ ɲɢɪɨɤɨɟ ɩɪɢɦɟɧɟɧɢɟ ɧɚɲɟɥ ɨɱɢɫɬɢɬɟɥɶ ɲɚɯɬɧɵɯ
ɤɨɥɨɞɰɟɜ ɦɟɯɚɧɢɱɟɫɤɨɝɨ ɞɟɣɫɬɜɢɹ ɈɒɄ-30Ⱥ, ɪɚɛɨɱɢɦɢ ɨɪɝɚɧɚɦɢ ɤɨɬɨɪɨɝɨ ɹɜɥɹɸɬɫɹ ɜɢɛɪɨɛɚɞɶɹ
ɢ ɜɢɛɪɨɝɪɟɣɮɟɪ [1]. ȼ ɧɟɦ ɫɛɨɪ ɢ ɜɵɧɨɫ ɩɟɫɱɚɧɵɯ ɨɬɥɨɠɟɧɢɣ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɡɚ ɫɱɟɬ ɜɢɛɪɚɰɢɢ
ɪɚɛɨɱɟɝɨ ɨɪɝɚɧɚ. ɉɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ ɈɒɄ-30Ⱥ ɩɨ ɝɪɭɧɬɭ ɤɨɥɟɛɥɟɬɫɹ ɜ ɩɪɟɞɟɥɚɯ 0,40-0,55 ɦ3/ɱɚɫ.
Ɉɞɧɚɤɨ, ɭɫɬɚɧɨɜɤɟ ɩɪɢɫɭɳɢ ɧɟɤɨɬɨɪɵɟ ɧɟɞɨɫɬɚɬɤɢ, ɤɚɤ ɫɦɟɳɟɧɢɟ ɤɨɥɟɰ ɤɨɥɨɞɰɚ ɩɪɢ ɜɢɛɪɚɰɢɢ,
ɰɢɤɥɢɱɧɨɫɬɶ ɜɵɧɨɫɚ ɞɨɧɧɵɯ ɨɬɥɨɠɟɧɢɣ, ɫɥɨɠɧɨɫɬɶ ɩɪɨɜɟɞɟɧɢɹ ɨɱɢɫɬɧɵɯ ɪɚɛɨɬ ɢ ɤɨɧɫɬɪɭɤɰɢɢ,
ɡɚɬɪɭɞɧɟɧɢɹ ɜ ɩɪɢɨɛɪɟɬɟɧɢɢ ɢ ɷɤɫɩɥɭɚɬɚɰɢɢ ɢɧɞɢɜɢɞɭɚɥɶɧɵɦ ɮɟɪɦɟɪɚɦ.
Ⱦɥɹ ɨɱɢɫɬɤɢ ɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ ɫ ɫɟɪɟɞɢɧɵ 90-ɯ ɝɨɞɨɜ ɩɪɨɲɥɨɝɨ ɜɟɤɚ ɫɬɚɥɢ ɩɪɢɦɟɧɹɬɶ ɤɨɧɬɟɣɧɟɪɧɭɸ ɬɟɯɧɨɥɨɝɢɸ ɋɭɳɧɨɫɬɶ ɷɬɨɣ ɬɟɯɧɨɥɨɝɢɢ ɨɱɢɫɬɤɢ ɡɚɤɥɸɱɚɟɬɫɹ ɜ ɫɥɟɞɭɸɳɟɦ: ɫɴɟɦɧɵɣ
ɤɨɧɬɟɣɧɟɪ ɫ ɩɨɦɨɳɶɸ ɝɪɭɡɨɩɨɞɴɟɦɧɨɝɨ ɭɫɬɪɨɣɫɬɜɚ ɨɩɭɫɤɚɟɬɫɹ ɜ ɤɨɥɨɞɟɰ ɢ ɭɫɬɚɧɚɜɥɢɜɚɟɬɫɹ ɜ ɟɝɨ
ɨɬɫɬɨɣɧɨɣ ɱɚɫɬɢ ɩɪɢ ɫɬɪɨɢɬɟɥɶɫɬɜɟ ɢɥɢ ɜɨ ɜɪɟɦɹ ɷɤɫɩɥɭɚɬɚɰɢɢ [2]. ɉɨ ɦɟɪɟ ɧɚɩɨɥɧɟɧɢɹ ɫɴɟɦɧɨɝɨ
ɤɨɧɬɟɣɧɟɪɚ ɢɧɨɪɨɞɧɵɦɢ ɬɟɥɚɦɢ ɢ ɩɟɫɱɚɧɵɦɢ ɨɬɥɨɠɟɧɢɹɦɢ ɟɝɨ ɩɨɞɵɦɚɸɬ ɧɚ ɩɨɜɟɪɯɧɨɫɬɶ, ɨɩɨɪɨɠɧɹɸɬ ɢ ɭɫɬɚɧɚɜɥɢɜɚɸɬ ɨɛɪɚɬɧɨ.
ɇɟɞɨɫɬɚɬɤɨɦ ɞɚɧɧɨɣ ɬɟɯɧɨɥɨɝɢɢ ɹɜɥɹɟɬɫɹ ɡɚɬɪɭɞɧɟɧɧɨɟ ɩɨɝɪɭɠɟɧɢɟ ɩɨɞ ɭɪɨɜɟɧɶ ɜɨɞɵ ɫɴɟɦ372
ɧɨɝɨ ɤɨɧɬɟɣɧɟɪɚ ɩɪɢ ɫɩɭɫɤɟ ɧɚ ɞɧɨ ɤɨɥɨɞɰɚ ɢɡ-ɡɚ ɤɨɧɫɬɪɭɤɰɢɢ
ɧɢɠɧɟɣ ɱɚɫɬɢ ɤɨɧɬɟɣɧɟɪɚ, ɜɵɩɨɥɧɟɧɧɨɝɨ ɜɵɫɨɬɨɣ 0,2-0,25 ɦ ɢɡ
ɫɩɥɨɲɧɨɝɨ ɦɟɬɚɥɥɢɱɟɫɤɨɝɨ ɥɢɫɬɚ, ɢɦɟɸɳɟɝɨ ɜɵɫɨɤɭɸ ɫɬɟɩɟɧɶ
ɩɥɚɜɭɱɟɫɬɢ.
Ⱦɥɹ ɪɟɲɟɧɢɹ ɞɚɧɧɨɣ ɩɪɨɛɥɟɦɵ ɜ Ʉɚɡɇɂɂȼɏ ɪɚɡɪɚɛɨɬɚɧɨ
ɭɫɬɪɨɣɫɬɜɨ ɞɥɹ ɨɱɢɫɬɤɢ ɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ.
ɍɫɬɪɨɣɫɬɜɨ ɞɥɹ ɨɱɢɫɬɤɢ ɲɚɯɬɧɨɝɨ ɤɨɥɨɞɰɚ (ɪɢɫɭɧɨɤ 1) ɫɨɫɬɨɢɬ ɢɡ ɤɨɪɩɭɫɚ 1 (ɜɟɪɯɧɟɣ ɢ ɧɢɠɧɟɣ ɱɚɫɬɢ), ɷɥɚɫɬɢɱɧɨɣ ɤɪɭɝɥɨɣ ɦɚɧɠɟɬɵ ɩɨ ɜɧɟɲɧɟɦɭ 2, ɤɪɨɧɲɬɟɣɧɚ 3, ɧɨɠɟɤ 4, ɤɪɭɝɥɨɝɨ
ɭɡɤɨɩɨɥɨɫɨɝɨ ɮɥɚɧɰɚ 5. ȼ ɧɢɠɧɟɣ ɞɨɧɧɨɣ ɱɚɫɬɢ ɤɨɪɩɭɫɚ ɩɪɟɞɭɫɦɨɬɪɟɧɵ ɬɪɢ ɤɪɭɝɥɵɯ ɨɬɜɟɪɫɬɢɹ 6, ɫɜɟɪɯɭ ɩɪɢɤɪɵɬɵɟ ɚɪɦɢɪɨɜɚɧɧɵɦɢ ɪɟɡɢɧɨɜɵɦɢ ɤɥɚɩɚɧɚɦɢ 7, ɤɨɬɨɪɵɟ ɩɪɢ ɞɨɫɬɢɠɟɧɢɢ
ɭɪɨɜɧɹ ɜɨɞɵ ɜ ɤɨɥɨɞɰɟ ɡɚ ɫɱɟɬ ɞɚɜɥɟɧɢɹ ɜɨɞɵ ɩɪɢɩɨɞɧɢɦɚɸɬɫɹ
ɢ ɨɬɤɪɵɜɚɸɬ ɨɬɜɟɪɫɬɢɹ ɜ ɞɨɧɧɨɣ ɱɚɫɬɢ ɤɨɧɬɟɣɧɟɪɚ, ɨɛɟɫɩɟɱɢɜɚɹ
ɛɟɫɩɪɟɩɹɬɫɬɜɟɧɧɨɟ ɩɪɨɧɢɤɧɨɜɟɧɢɟ ɜɨɞɵ ɜɨ ɜɧɭɬɪɟɧɧɸɸ ɱɚɫɬɶ
ɤɨɧɬɟɣɧɟɪɚ ɢ ɬɟɦ ɫɚɦɵɦ ɫɩɨɫɨɛɫɬɜɭɸɬ ɛɵɫɬɪɨɦɭ ɩɨɝɪɭɠɟɧɢɸ
ɤɨɧɬɟɣɧɟɪɚ ɩɪɢ ɫɩɭɫɤɟ ɜ ɤɨɥɨɞɟɰ 8.
ȼɟɪɯɧɹɹ ɰɢɥɢɧɞɪɢɱɟɫɤɚɹ ɱɚɫɬɶ ɤɨɪɩɭɫɚ 1 ɜɵɩɨɥɧɟɧɚ ɩɟɪɮɨɪɢɪɨ-ɜɚɧɧɨɣ (ɞɵɪɱɚɬɚɹ, ɳɟɥɟɜɚɹ, ɫɟɬɱɚɬɚɹ), ɚ ɧɢɠɧɹɹ ɱɚɫɬɶ ɜ
Ɋɢɫ.1. ɍɫɬɪɨɣɫɬɜɨ ɞɥɹ ɨɱɢɫɬɤɢ
ɮɨɪɦɟ ɭɫɟɱɟɧɧɨɝɨ ɤɨɧɭɫɚ ɜɵɫɨɬɨɣ 0,2-0,25 ɦ ɜɵɩɨɥɧɟɧɚ ɫɩɥɨɲɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ
ɧɨɣ ɢɡ ɦɟɬɚɥɥɢɱɟɫɤɨɝɨ ɥɢɫɬɚ.
ɗɥɚɫɬɢɱɧɚɹ ɤɪɭɝɥɚɹ ɦɚɧɠɟɬɚ 2 ɤ ɤɨɪɩɭɫɭ 1 ɩɪɢɤɪɟɩɥɹɟɬɫɹ ɫ
ɩɨɦɨɳɶɸ ɤɪɭɝɥɵɯ ɭɡɤɨɩɨɥɨɫɵɯ ɮɥɚɧɰɟɜ 5 ɢ ɨɛɟɫɩɟɱɢɜɚɟɬ ɩɪɢ
ɪɚɛɨɬɟ ɝɟɪɦɟɬɢɡɚɰɢɸ ɦɟɠɞɭ ɫɬɟɧɤɨɣ ɤɨɥɨɞɰɚ 8 ɢ ɟɦɤɨɫɬɶɸ 1, ɱɬɨɛɵ ɩɪɟɞɨɬɜɪɚɬɢɬɶ ɩɨɩɚɞɚɧɢɟ
ɢɧɨɪɨɞɧɵɯ ɬɟɥ ɜ ɤɨɥɶɰɟɜɨɟ ɩɪɨɫɬɪɚɧɫɬɜɨ.
Ʉɪɨɧɲɬɟɣɧ 3 ɢɡ ɦɟɬɚɥɥɢɱɟɫɤɨɝɨ ɫɬɟɪɠɧɹ ɩɪɢɤɪɟɩɥɹɟɬɫɹ ɜ ɜɟɪɯɧɸɸ ɱɚɫɬɶ ɤɨɪɩɭɫɚ ɜ ɮɨɪɦɟ
ɩɢɪɚɦɢɞɵ. ɗɬɨ ɩɨɡɜɨɥɹɟɬ ɡɚɰɟɩɢɬɶ ɢ ɩɨɞɧɹɬɶ ɨɱɢɫɬɧɨɟ ɭɫɬɪɨɣɫɬɜɨ ɥɸɛɵɦ ɝɪɭɡɨɩɨɞɴɟɦɧɵɦ ɦɟɯɚɧɢɡɦɨɦ (ɬɪɟɧɨɝɚ ɢ ɬ.ɞ.) ɧɚ ɩɨɜɟɪɯɧɨɫɬɶ ɡɟɦɥɢ ɛɟɡ ɫɩɭɫɤɚ ɱɟɥɨɜɟɤɚ ɜ ɤɨɥɨɞɟɰ.
ɇɨɠɤɢ-ɩɨɞɫɬɚɜɤɢ 4 ɤɨɧɬɟɣɧɟɪɚ ɫɨɡɞɚɸɬ ɫɜɨɛɨɞɧɨɟ ɩɪɨɫɬɪɚɧɫɬɜɨ ɦɟɠɞɭ ɞɧɢɳɟɦ ɤɨɥɨɞɰɚ ɢ
ɭɫɬɪɨɣɫɬɜɚ, ɱɬɨ ɨɫɨɛɟɧɧɨ ɧɟɨɛɯɨɞɢɦɨ ɜ ɤɨɥɨɞɰɚɯ ɫ ɞɨɧɧɵɦɢ ɮɢɥɶɬɪɚɦɢ.
ɍɫɬɪɨɣɫɬɜɨ ɢɦɟɟɬ ɫɥɟɞɭɸɳɢɟ ɤɨɧɫɬɪɭɤɬɢɜɧɵɟ ɩɚɪɚɦɟɬɪɵ:
ɦɚɤɫɢɦɚɥɶɧɚɹ ɜɵɫɨɬɚ, ɦ
0,5…0,6
ɞɢɚɦɟɬɪ ɤɨɪɩɭɫɚ, ɦ
ɩɨ ɜɟɪɯɭ
0,8…0,85
ɩɨ ɧɢɡɭ
0,5…0,6
ɜɧɟɲɧɢɣ ɞɢɚɦɟɬɪ
ɷɥɚɫɬɢɱɧɨɣ ɦɚɧɠɟɬɵ, ɦ
0,98…1,08
ɜɵɫɨɬɚ ɤɪɨɧɲɬɟɣɧɚ ɞɥɹ
ɩɨɞɴɟɦɚ-ɫɩɭɫɤɚ ɭɫɬɪɨɣɫɬɜɚ
0,3...0,35
ɜɟɫ ɭɫɬɪɨɣɫɬɜɚ, ɤɝ
30
ɦɚɤɫɢɦɚɥɶɧɵɣ ɪɚɫɱɟɬɧɵɣ
ɜɟɫ ɨɬɥɨɠɟɧɢɣ, ɤɝ
500
ɜɪɟɦɹ ɭɫɬɚɧɨɜɤɢ ɜ ɤɨɥɨɞɟɰ, ɱɚɫ
0,5
Ɉɱɢɫɬɤɚ ɲɚɯɬɧɨɝɨ ɤɨɥɨɞɰɚ ɨɬ ɢɧɨɪɨɞɧɵɯ ɬɟɥ (ɤɚɦɧɢ, ɩɪɟɞɦɟɬɵ ɞɨɦɚɲɧɟɝɨ ɨɛɢɯɨɞɚ, ɬɪɭɩɵ
ɩɬɢɰ ɢ ɝɪɵɡɭɧɨɜ ɢ ɬ.ɞ.) ɢ ɩɟɫɱɚɧɵɯ ɨɬɥɨɠɟɧɢɣ ɫ ɢɫɩɨɥɶɡɨɜɚɧɢɟɦ ɭɫɬɪɨɣɫɬɜɚ ɩɪɟɞɫɬɚɜɥɹɟɬ ɫɨɛɨɣ
ɤɨɦɩɥɟɤɫ ɬɟɯɧɨɥɨɝɢɱɟɫɤɢɯ ɨɩɟɪɚɰɢɣ ɪɚɡɨɛɳɟɧɧɵɯ ɩɨ ɜɪɟɦɟɧɢ ɜɵɩɨɥɧɟɧɢɹ, ɨɫɧɨɜɧɵɦɢ ɢɡ ɤɨɬɨɪɵɯ ɹɜɥɹɸɬɫɹ:
- ɭɫɬɚɧɨɜɤɚ (ɦɨɧɬɚɠ) ɭɫɬɪɨɣɫɬɜɚ ɜ ɲɚɯɬɧɵɣ ɤɨɥɨɞɟɰ;
- ɫɛɨɪ ɨɬɥɨɠɟɧɢɣ;
- ɢɡɜɥɟɱɟɧɢɟ ɭɫɬɪɨɣɫɬɜɚ ɢɡ ɤɨɥɨɞɰɚ ɢ ɨɩɨɪɨɠɧɟɧɢɟ ɨɬ ɧɚɤɨɩɢɜɲɢɯɫɹ ɨɬɥɨɠɟɧɢɣ;
- ɨɛɪɚɬɧɚɹ ɭɫɬɚɧɨɜɤɚ ɭɫɬɪɨɣɫɬɜɚ ɜ ɤɨɥɨɞɟɰ.
ɉɪɚɤɬɢɱɟɫɤɢ ɜɨɫɫɬɚɧɨɜɢɬɟɥɶɧɵɟ ɦɟɪɨɩɪɢɹɬɢɹ ɪɟɤɨɦɟɧɞɭɸɬ ɜɵɩɨɥɧɹɬɶ ɩɪɢ ɫɧɢɠɟɧɢɢ ɞɟɛɢɬɚ
ɧɚ 10–15 % ɨɬ ɩɟɪɜɨɧɚɱɚɥɶɧɨɝɨ. ȼ ɬɟɯ ɫɥɭɱɚɹɯ, ɤɨɝɞɚ ɧɟ ɪɟɝɢɫɬɪɢɪɭɸɬ ɢɡɦɟɧɟɧɢɟ ɭɞɟɥɶɧɨɝɨ ɞɟɛɢɬɚ, ɱɬɨ ɢɦɟɟɬ ɦɟɫɬɨ ɜ ɩɚɫɬɛɢɳɧɨɦ ɜɨɞɨɫɧɚɛɠɟɧɢɢ, ɰɟɥɟɫɨɨɛɪɚɡɧɨ ɜɵɩɨɥɧɹɬɶ ɜɨɫɫɬɚɧɨɜɢɬɟɥɶɧɵɟ
ɦɟɪɨɩɪɢɹɬɢɹ ɧɟ ɪɟɠɟ ɨɞɧɨɝɨ ɪɚɡɚ ɜ ɝɨɞ. ɂɡ ɪɚɫɫɦɨɬɪɟɧɢɹ ɬɟɯɧɨɥɨɝɢɢ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɩɚɫɬɛɢɳ ɩɪɢ
ɨɬɝɨɧɧɨ-ɩɚɫɬɛɢɳɧɨɣ ɫɢɫɬɟɦɟ ɫɨɞɟɪɠɚɧɢɹ ɠɢɜɨɬɧɵɯ ɰɟɥɟɫɨɨɛɪɚɡɧɨ ɨɱɢɫɬɤɭ ɲɚɯɬɧɨɝɨ ɤɨɥɨɞɰɚ
ɩɪɨɢɡɜɨɞɢɬɶ ɩɨɫɥɟ ɪɚɫɤɨɧɫɟɪɜɚɰɢɢ, ɩɟɪɟɞ ɩɪɢɝɨɧɨɦ ɫɤɨɬɚ ɧɚ ɨɛɜɨɞɧɹɟɦɭɸ ɢɦ ɬɟɪɪɢɬɨɪɢɸ.
ɇɚ ɧɚɱɚɥɶɧɨɦ ɷɬɚɩɟ ɩɪɢɦɟɧɟɧɢɹ ɞɚɧɧɨɣ ɬɟɯɧɨɥɨɝɢɢ ɨɱɢɫɬɤɢ, ɩɨɫɥɟ ɪɚɫɤɨɧɫɟɪɜɚɰɢɢ ɧɚɞ ɲɚɯ373
ɬɧɵɦ ɤɨɥɨɞɰɟɦ ɦɨɧɬɢɪɭɟɬɫɹ ɝɪɭɡɨɩɨɞɴɟɦɧɨɟ ɩɪɢɫɩɨɫɨɛɥɟɧɢɟ. ɍɫɬɪɨɣɫɬɜɨ ɨɩɭɫɤɚɟɬɫɹ ɜ ɤɨɥɨɞɟɰ
ɢ ɭɫɬɚɧɚɜɥɢɜɚɟɬɫɹ ɧɚ ɞɧɨ. Ƚɪɭɡɨɩɨɞɴɟɦɧɨɟ ɩɪɢɫɩɨɫɨɛɥɟɧɢɟ ɞɟɦɨɧɬɢɪɭɟɬɫɹ ɢ ɢɫɩɨɥɶɡɭɟɬɫɹ ɞɥɹ
ɩɪɨɜɟɞɟɧɢɹ ɚɧɚɥɨɝɢɱɧɵɯ ɪɚɛɨɬ ɧɚ ɞɪɭɝɢɯ ɤɨɥɨɞɰɚɯ ɢɥɢ ɯɪɚɧɢɬɫɹ. Ɇɨɧɬɢɪɭɟɬɫɹ ɜɨɞɨɩɨɞɴɟɦɧɨɟ
ɨɛɨɪɭɞɨɜɚɧɢɟ ɢ ɨɪɝɚɧɢɡɭɟɬɫɹ ɜɨɞɨɩɨɣ ɠɢɜɨɬɧɵɯ. Ɂɚ ɜɪɟɦɹ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɲɚɯɬɧɨɝɨ ɤɨɥɨɞɰɚ ɞɥɹ
ɨɛɟɫɩɟɱɟɧɢɹ ɜɨɞɨɩɨɹ ɠɢɜɨɬɧɵɯ ɢ ɜ ɦɟɠɫɟɡɨɧɶɟ ɜ ɭɫɬɪɨɣɫɬɜɟ ɫɤɚɩɥɢɜɚɸɬɫɹ ɢɧɨɪɨɞɧɵɟ ɬɟɥɚ ɢ ɩɟɫɱɚɧɵɟ ɨɬɥɨɠɟɧɢɹ.
ɉɟɪɟɞ ɧɚɱɚɥɨɦ ɫɥɟɞɭɸɳɟɝɨ ɩɚɫɬɛɢɳɧɨɝɨ ɫɟɡɨɧɚ ɧɚɞ ɤɨɥɨɞɰɟɦ ɦɨɧɬɢɪɭɟɬɫɹ ɝɪɭɡɨɩɨɞɴɟɦɧɨɟ
ɩɪɢɫɩɨɫɨɛɥɟɧɢɟ ɢ ɢɡɜɥɟɤɚɟɬɫɹ ɧɚ ɩɨɜɟɪɯɧɨɫɬɶ ɭɫɬɪɨɣɫɬɜɨ. ɉɪɢ ɷɬɨɦ ɜ ɤɚɱɟɫɬɜɟ ɬɹɝɨɜɨɝɨ ɫɪɟɞɫɬɜɚ
ɜɨɡɦɨɠɧɨ ɢɫɩɨɥɶɡɨɜɚɧɢɟ ɬɪɚɤɬɨɪɚ, ɚɜɬɨɦɨɛɢɥɹ, ɜɟɪɛɥɸɞɚ, ɥɨɲɚɞɢ. ɍɫɬɪɨɣɫɬɜɨ ɨɩɨɪɨɠɧɹɟɬɫɹ ɨɬ
ɫɨɞɟɪɠɢɦɨɝɨ, ɱɢɫɬɢɬɫɹ, ɪɟɦɨɧɬɢɪɭɟɬɫɹ ɢ ɜɧɨɜɶ ɨɩɭɫɤɚɟɬɫɹ ɜ ɤɨɥɨɞɟɰ. ɐɢɤɥ ɩɨɜɬɨɪɹɟɬɫɹ.
ɉɪɢɟɦɨɱɧɵɟ ɢɫɩɵɬɚɧɢɹ ɢ ɜɧɟɞɪɟɧɢɟ ɭɫɬɪɨɣɫɬɜɚ ɜ ɌɈɈ «ɢɦ.Ⱥɛɞɢɪɚ ɋɚɝɢɧɬɚɟɜɚ» Ɍɚɥɚɫɫɤɨɝɨ
ɪɚɣɨɧɚ ɀɚɦɛɵɥɫɤɨɣ ɨɛɥɚɫɬɢ ɩɨɤɚɡɚɥɢ, ɱɬɨ ɞɚɧɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɨɱɢɫɬɤɢ ɨɛɟɫɩɟɱɢɜɚɟɬ ɪɚɛɨɱɢɣ ɞɟɛɢɬ ɲɚɯɬɧɨɝɨ ɤɨɥɨɞɰɚ ɢ ɭɥɭɱɲɚɟɬ ɟɝɨ ɪɟɠɢɦ ɪɚɛɨɬɵ. ɇɟɡɧɚɱɢɬɟɥɧɚɹ ɜɵɫɨɬɚ ɭɫɬɪɨɣɫɬɜɚ ɩɨɡɜɨɥɹɟɬ ɫɜɨɛɨɞɧɨ ɭɫɬɚɧɨɜɢɬɶ ɧɚɞ ɧɢɦ ɩɨɝɪɭɠɧɨɟ ɜɨɞɨɩɨɞɴɟɦɧɨɟ ɨɛɨɪɭɞɨɜɚɧɢɟ, ɧɚɩɪɢɦɟɪ ɥɟɧɬɨɱɧɵɟ
ɢ ɜɢɧɬɨɜɵɟ ɜɨɞɨɩɨɞɴɟɦɧɢɤɢ. Ɍɟɯɧɨɥɨɝɢɹ ɩɪɨɫɬɚ ɜ ɢɫɩɨɥɧɟɧɢɢ ɢ ɝɚɪɚɧɬɢɪɭɟɬ ɜɵɫɨɤɭɸ ɫɬɟɩɟɧɶ
ɨɱɢɫɬɤɢ.
Ȼɢɛɥɢɨɝɪɚɮɢɱɟɫɤɢɣ ɫɩɢɫɨɤ
1.
2.
Ɉɱɢɫɬɢɬɟɥɶ ɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ ɈɒɄ-30Ⱥ //ɉɪɨɫɩɟɤɬ Ɇɚɲɢɧɨ-ɷɤɫɩɟɪɬ. – Ɇ: ȼɇɂɂɬɨɪɝɢɡɞɚɬ, 1982.–5 ɫ.
Ʉɚɫɵɦɛɟɤɨɜ ɀ.Ʉ. Ʉɨɧɬɟɣɧɟɪɧɚɹ ɬɟɯɧɨɥɨɝɢɹ ɨɱɢɫɬɤɢ ɲɚɯɬɧɵɯ ɤɨɥɨɞɰɟɜ ɢ ɦɟɬɨɞɢɤɚ ɪɚɫɱɟɬɚ ɨɱɢɫɬɧɨɝɨ
ɭɫɬɪɨɣɫɬɜɚ //ȼɨɞɧɨɟ ɯɨɡɹɣɫɬɜɨ Ʉɚɡɚɯɫɬɚɧɚ.- 2007.- ʋ3.- ɋ.2–4.
ɍȾɄ 631.585:626.84
ɂɇɇɈȼȺɐɂɈɇɇȺə ɌȿɏɇɈɅɈȽɂə ɈɉɊȿɋɇȿɇɂə
ɆɂɇȿɊȺɅɂɁɈȼȺɇɇɕɏ ɉɈȾɁȿɆɇɕɏ ȼɈȾ
ɌɍɆɅȿɊɌ ȿ.ȼ.,
ɌɈɈ «Ʉɚɡɚɯɫɤɢɣ ɧɚɭɱɧɨ-ɢɫɫɥɟɞɨɜɚɬɟɥɶɫɤɢɣ ɢɧɫɬɢɬɭɬ ɜɨɞɧɨɝɨ ɯɨɡɹɣɫɬɜɚ»,
Ɋɟɫɩɭɛɥɢɤɚ Ʉɚɡɚɯɫɬɚɧ, ɝ.Ɍɚɪɚɡ, E-mail – iwre@bk.ru
Ɉɞɧɢɦ ɢɡ ɪɟɡɟɪɜɨɜ ɜ ɭɥɭɱɲɟɧɢɢ ɜɨɞɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɢ ɪɚɰɢɨɧɚɥɶɧɨɦ ɢɫɩɨɥɶɡɨɜɚɧɢɢ ɜɨɞɧɵɯ
ɪɟɫɭɪɫɨɜ ɜ Ʉɚɡɚɯɫɬɚɧɟ ɹɜɥɹɟɬɫɹ ɨɩɪɟɫɧɟɧɢɟ ɧɟ ɬɪɨɧɭɬɵɯ ɡɚɩɚɫɨɜ ɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɜɨɞ.
ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɪɚɡɜɢɬɢɟ ɨɩɪɟɫɧɢɬɟɥɶɧɨɣ ɬɟɯɧɢɤɢ ɨɫɭɳɟɫɬɜɥɹɟɬɫɹ ɜ ɨɫɧɨɜɧɨɦ ɧɚ ɩɨɢɫɤɟ
ɫɩɨɫɨɛɨɜ ɩɨɜɵɲɟɧɢɹ ɷɮɮɟɤɬɢɜɧɨɫɬɢ ɨɩɪɟɫɧɟɧɢɹ ɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɜɨɞ, ɩɭɬɺɦ ɭɜɟɥɢɱɟɧɢɹ ɦɨɳɧɨɫɬɢ ɨɩɪɟɫɧɢɬɟɥɶɧɵɯ ɭɫɬɚɧɨɜɨɤ, ɫɨɤɪɚɳɟɧɢɹ ɷɧɟɪɝɨɡɚɬɪɚɬ ɧɚ ɨɩɪɟɫɧɟɧɢɟ ɢ ɪɚɡɪɚɛɨɬɤɟ ɩɪɢɧɰɢɩɢɚɥɶɧɨ ɧɨɜɵɯ ɦɟɬɨɞɨɜ ɞɟɦɢɧɟɪɚɥɢɡɚɰɢɢ, ɭɫɨɜɟɪɲɟɧɫɬɜɨɜɚɧɢɹ ɦɟɦɛɪɚɧɧɨɣ ɬɟɯɧɨɥɨɝɢɢ.
Ɋɚɡɜɢɬɢɟ ɯɨɡɹɣɫɬɜɟɧɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɜɵɡɵɜɚɟɬ ɰɟɥɵɣ ɪɹɞ ɧɟɠɟɥɚɬɟɥɶɧɵɯ ɩɨɫɥɟɞɫɬɜɢɣ, ɧɚɢɛɨɥɟɟ ɨɩɚɫɧɨɟ ɢɡ ɤɨɬɨɪɵɯ ɡɚɤɥɸɱɚɟɬɫɹ ɜ ɡɚɝɪɹɡɧɟɧɢɢ ɜɨɞɧɵɯ ɨɛɴɟɤɬɨɜ. ɇɚɢɛɨɥɶɲɭɸ ɨɩɚɫɧɨɫɬɶ
ɞɥɹ ɡɚɝɪɹɡɧɟɧɢɹ ɩɪɢɪɨɞɧɵɯ ɜɨɞ ɩɪɟɞɫɬɚɜɥɹɸɬ ɜɵɦɵɜɚɟɦɵɟ ɢɡ ɩɨɱɜɨɝɪɭɧɬɨɜ ɫɨɥɢ, ɭɞɨɛɪɟɧɢɹ, ɩɟɫɬɢɰɢɞɵ. ȼ ɪɟɡɭɥɶɬɚɬɟ ɢɧɬɟɧɫɢɜɧɨɣ ɞɟɹɬɟɥɶɧɨɫɬɢ ɱɟɥɨɜɟɤɚ ɩɪɢɪɨɞɧɵɟ ɜɨɞɵ ɡɚɝɪɹɡɧɹɸɬɫɹ ɧɟɨɱɢɳɟɧɧɵɦɢ ɢɥɢ ɧɟɞɨɫɬɚɬɨɱɧɨ ɨɱɢɳɟɧɧɵɦɢ ɫɬɨɱɧɵɦɢ ɜɨɞɚɦɢ, ɱɬɨ ɨɝɪɚɧɢɱɢɜɚɟɬ ɢɯ ɢɫɩɨɥɶɡɨɜɚɧɢɟ.
Ɋɚɫɬɺɬ ɫɩɢɫɨɤ ɢɫɩɨɥɶɡɭɟɦɵɯ ɜ ɧɚɪɨɞɧɨɦ ɯɨɡɹɣɫɬɜɟ ɹɞɨɯɢɦɢɤɚɬɨɜ, ɯɢɦɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɡɚɳɢɬɵ
ɪɚɫɬɟɧɢɣ ɢ ɠɢɜɨɬɧɵɯ. ȼ ɧɟɤɨɬɨɪɵɯ ɪɟɝɢɨɧɚɯ ɪɟɫɩɭɛɥɢɤɢ ɭɠɟ ɜɨɡɧɢɤɥɚ ɧɟɨɛɯɨɞɢɦɨɫɬɶ ɩɪɢɦɟɧɟɧɢɹ ɪɚɡɥɢɱɧɵɯ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɢ ɬɟɯɧɨɥɨɝɢɣ ɩɨ ɨɱɢɫɬɤɟ ɫɛɪɨɫɧɵɯ ɜɨɞ ɞɥɹ ɬɨɝɨ, ɱɬɨɛɵ ɩɨɜɬɨɪɧɨ ɢɫɩɨɥɶɡɨɜɚɬɶ ɢɯ ɞɥɹ ɨɪɨɲɟɧɢɹ ɢɥɢ ɩɟɪɟɞ ɫɛɪɨɫɨɦ ɜ ɩɨɜɟɪɯɧɨɫɬɧɵɟ ɜɨɞɨɬɨɤɢ.
ȼ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɩɨɞɡɟɦɧɵɟ, ɞɪɟɧɚɠɧɨ-ɫɛɪɨɫɧɵɟ ɢ ɫɬɨɱɧɵɟ ɜɨɞɵ ɜ ɪɟɫɩɭɛɥɢɤɟ ɫɬɚɥɢ ɲɢɪɨɤɨ
ɢɡɭɱɚɬɶɫɹ, ɩɪɨɜɟɞɟɧɵ ɡɧɚɱɢɬɟɥɶɧɵɟ ɪɚɛɨɬɵ ɩɨ ɜɨɞɨɫɧɚɛɠɟɧɢɸ ɫɟɥɶɫɤɢɯ ɧɚɫɟɥɺɧɧɵɯ ɩɭɧɤɬɨɜ ɢ ɨɛɜɨɞɧɟɧɢɸ ɩɚɫɬɛɢɳ, ɧɨ ɩɪɨɛɥɟɦɚ ɞɟɮɢɰɢɬɚ ɤɚɱɟɫɬɜɟɧɧɨɣ ɜɨɞɵ ɨɫɬɚɺɬɫɹ. Ɉɝɪɚɧɢɱɟɧɧɨɫɬɶ ɜɨɞɧɵɯ
ɪɟɫɭɪɫɨɜ ɢ ɩɪɨɛɥɟɦɚ ɨɯɪɚɧɵ ɜɨɞɧɵɯ ɢɫɬɨɱɧɢɤɨɜ ɨɬ ɡɚɝɪɹɡɧɟɧɢɹ ɬɪɟɛɭɸɬ ɩɪɢɦɟɧɟɧɢɹ ɬɟɯɧɨɥɨɝɢɣ
ɢ ɬɟɯɧɢɱɟɫɤɢɯ ɫɪɟɞɫɬɜ ɞɥɹ ɨɱɢɫɬɤɢ ɢ ɩɟɪɟɪɚɛɨɬɤɢ ɩɪɢɪɨɞɧɵɯ, ɞɪɟɧɚɠɧɵɯ ɢ ɫɛɪɨɫɧɵɯ ɜɨɞ ɫ ɰɟɥɶɸ
ɩɨɥɭɱɟɧɢɹ ɤɚɱɟɫɬɜɟɧɧɨɣ ɜɨɞɵ ɞɥɹ ɜɨɞɨɫɧɚɛɠɟɧɢɹ ɢ ɩɨɜɬɨɪɧɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɞɥɹ ɨɪɨɲɟɧɢɹ.
Ɉɞɧɢɦ ɢɡ ɷɮɮɟɤɬɢɜɧɵɯ ɩɭɬɟɣ ɪɟɲɟɧɢɹ ɩɪɨɛɥɟɦɵ ɜɨɞɨɨɛɟɫɩɟɱɟɧɧɨɫɬɢ ɧɚɫɟɥɟɧɧɵɯ ɩɭɧɤɬɨɜ ɢ
ɨɪɨɲɚɟɦɵɯ ɡɟɦɟɥɶ ɹɜɥɹɟɬɫɹ ɨɩɪɟɫɧɟɧɢɟ ɢɦɟɸɳɢɯɫɹ ɜ ɢɡɨɛɢɥɢɢ ɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɩɪɢɪɨɞɧɵɯ ɢ
ɞɪɟɧɚɠɧɨ-ɫɛɪɨɫɧɵɯ ɜɨɞ.
ɇɚɢɛɨɥɟɟ ɫɨɜɟɪɲɟɧɧɵɦ, ɢɡɭɱɟɧɧɵɦ ɢ ɬɟɯɧɢɱɟɫɤɢ ɨɮɨɪɦɥɟɧɧɵɦ ɦɟɬɨɞɨɦ ɨɩɪɟɫɧɟɧɢɹ ɹɜɥɹɟɬɫɹ
ɨɩɪɟɫɧɟɧɢɟ ɧɚ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɨɣ ɭɫɬɚɧɨɜɤɟ. ȼ ɧɚɫɬɨɹɳɟɟ ɜɪɟɦɹ ɜ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɵɯ ɭɫɬɚɧɨɜɤɚɯ
374
ɩɪɢɦɟɧɹɸɬɫɹ ɝɨɦɨɝɟɧɧɵɟ ɢɨɧɢɬɨɜɵɟ, ɝɟɬɟɪɨɝɟɧɧɵɟ ɢɨɧɢɬɨɜɵɟ ɢ ɩɪɨɩɢɬɨɱɧɵɟ ɢɨɧɢɬɨɜɵɟ ɦɟɦɛɪɚɧɵ.
ȼɨɞɚ, ɩɨɞɚɜɚɟɦɚɹ ɜ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɭɸ ɨɩɪɟɫɧɢɬɟɥɶɧɭɸ ɭɫɬɚɧɨɜɤɭ, ɞɨɥɠɧɚ ɛɵɬɶ ɨɫɜɨɛɨɠɞɟɧɚ
ɨɬ ɜɡɜɟɲɟɧɧɵɯ ɢ ɤɨɥɥɨɢɞɧɵɯ ɡɚɝɪɹɡɧɟɧɢɣ, ɦɢɤɪɨɨɪɝɚɧɢɡɦɨɜ ɢ ɝɢɞɪɨɛɢɨɧɬɨɜ. ɋɨɞɟɪɠɚɧɢɟ ɠɟɥɟɡɚ
ɢ ɦɚɪɝɚɧɰɚ ɡɚɦɟɬɧɨ ɭɯɭɞɲɚɟɬ ɪɚɛɨɬɭ ɦɟɦɛɪɚɧ («ɨɬɪɚɜɥɟɧɢɟ ɦɟɦɛɪɚɧ»), ɩɨɷɬɨɦɭ ɞɥɹ ɢɯ ɭɞɚɥɟɧɢɹ
ɞɨ 0,02 ɦɝ/ɥ ɩɪɟɞɭɫɦɨɬɪɟɧɚ ɨɛɪɚɛɨɬɤɚ ɜɨɞɵ.
ɉɪɢ ɨɛɟɫɫɨɥɢɜɚɧɢɢ ɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɩɪɢɪɨɞɧɵɯ ɢ ɤɨɥɥɟɤɬɨɪɧɨ-ɞɪɟɧɚɠɧɵɯ ɜɨɞ ɜ ɰɟɥɹɯ ɩɨɜɬɨɪɧɨɝɨ ɢɫɩɨɥɶɡɨɜɚɧɢɹ ɞɥɹ ɨɪɨɲɟɧɢɹ ɧɟɬ ɧɟɨɛɯɨɞɢɦɨɫɬɢ ɭɛɢɪɚɬɶ ɜɫɟ ɢɨɧɵ, ɚ ɬɨɥɶɤɨ ɧɚɢɛɨɥɟɟ ɬɨɤ), ɩɨɷɬɨɦɭ ɫɬɚɧɞɚɪɬɧɵɟ ɦɟɦɛɪɚɧɵ ɜ ɞɚɧɧɨɦ ɫɥɭɱɚɟ ɧɟ ɩɨɞɯɨɫɢɱɧɵɟ (ɢɨɧɵ
ɞɹɬ; ɬɪɟɛɭɸɬɫɹ ɦɟɦɛɪɚɧɵ, ɨɛɥɚɞɚɸɳɢɟ ɢɡɛɢɪɚɬɟɥɶɧɨɣ ɩɪɨɧɢɰɚɟɦɨɫɬɶɸ ɤ ɨɩɪɟɞɟɥɺɧɧɵɦ ɜɢɞɚɦ
ɢɨɧɨɜ. ȼ ɩɨɫɥɟɞɧɢɟ ɝɨɞɵ ɧɚ ɦɢɪɨɜɨɦ ɪɵɧɤɟ ɩɨɹɜɢɥɢɫɶ ɦɟɦɛɪɚɧɵ ɫɩɟɰɢɚɥɶɧɨɝɨ ɧɚɡɧɚɱɟɧɢɹ, ɜ
ɱɚɫɬɧɨɫɬɢ, ɢɡɛɢɪɚɬɟɥɶɧɵɟ ɤ ɨɞɧɨɡɚɪɹɞɧɵɦ ɢɨɧɚɦ, (ɁɋɆ).
ɋɟɣɱɚɫ ɧɚɢɛɨɥɟɟ ɚɤɬɭɚɥɶɧɨɣ ɹɜɥɹɟɬɫɹ ɡɚɞɚɱɚ ɨɩɪɟɫɧɟɧɢɹ ɦɚɥɨɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɜɨɞ, ɩɨɫɤɨɥɶɤɭ ɜɫɺ ɭɜɟɥɢɱɢɜɚɸɳɢɣɫɹ ɢɯ ɫɛɪɨɫ ɨɤɚɡɵɜɚɟɬ ɧɟɛɥɚɝɨɩɪɢɹɬɧɨɟ ɜɨɡɞɟɣɫɬɜɢɟ ɧɚ ɜɨɞɨɺɦɵ ɢ ɭɯɭɞɲɚɟɬ ɷɤɨɥɨɝɢɱɟɫɤɨɟ ɫɨɫɬɨɹɧɢɟ ɨɤɪɭɠɚɸɳɟɣ ɫɪɟɞɵ. Ⱦɥɹ ɢɯ ɨɩɪɟɫɧɟɧɢɹ ɷɥɟɤɬɪɨɞɢɚɥɢɡ ɧɚɢɛɨɥɟɟ
ɩɪɢɟɦɥɟɦ.
ɒɢɪɨɤɨɦɭ ɜɧɟɞɪɟɧɢɸ ɗȾɍ ɩɪɟɩɹɬɫɬɜɭɟɬ ɧɟɜɵɫɨɤɚɹ ɫɬɟɩɟɧɶ ɤɨɧɰɟɧɬɪɢɪɨɜɚɧɢɹ ɪɚɫɫɨɥɚ ɩɪɢ
ɨɩɪɟɫɧɟɧɢɢ (ɜ 3-5 ɪɚɡ), ɨɬɫɭɬɫɬɜɢɟ ɫɩɨɫɨɛɨɜ ɭɬɢɥɢɡɚɰɢɢ ɪɚɫɫɨɥɨɜ, ɧɟɞɨɫɬɚɬɨɱɧɵɦ ɚɫɫɨɪɬɢɦɟɧɬɨɦ ɢ ɤɚɱɟɫɬɜɨɦ ɩɪɨɦɵɲɥɟɧɧɨ ɜɵɩɭɫɤɚɟɦɵɯ ɫɬɚɧɞɚɪɬɧɵɯ ɝɟɬɟɪɨɝɟɧɧɵɯ ɦɟɦɛɪɚɧ (ɆɄ-40, ɆȺ-40,
ɆȺ-41). ɋɨɡɞɚɧɢɟ ɦɟɦɛɪɚɧ, ɢɡɛɢɪɚɬɟɥɶɧɨ ɩɪɨɧɢɰɚɟɦɵɯ ɞɥɹ ɨɞɧɨɡɚɪɹɞɧɵɯ ɤɚɬɢɨɧɨɜ ɢ ɚɧɢɨɧɨɜ,
ɩɨɡɜɨɥɢɬ ɡɧɚɱɢɬɟɥɶɧɨ ɪɚɡɪɟɲɢɬɶ ɩɪɨɛɥɟɦɵ ɩɟɪɟɪɚɛɨɬɤɢ ɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɜɨɞ. Ȼɥɚɝɨɞɚɪɹ ɫɩɨɫɨɛɧɨɫɬɢ ɁɋɆ ɭɞɚɥɹɬɶ ɢɡ ɨɩɪɟɫɧɹɟɦɨɝɨ ɪɚɫɬɜɨɪɚ ɨɞɧɨɡɚɪɹɞɧɵɟ ɢɨɧɵ, ɩɪɨɢɫɯɨɞɢɬ ɩɪɨɰɟɧɬɧɨɟ
ɨɛɨɝɚɳɟɧɢɟ ɞɢɚɥɢɡɚɬɚ ɫɨɥɹɦɢ ɠɺɫɬɤɨɫɬɢ, ɩɪɢɫɭɬɫɬɜɢɟ ɤɨɬɨɪɵɯ ɧɟɨɛɯɨɞɢɦɨ ɜ ɜɨɞɟ ɞɥɹ ɩɨɥɢɜɚ ɫ-ɯ
ɤɭɥɶɬɭɪ.
ɉɪɟɢɦɭɳɟɫɬɜɚ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɨɝɨ ɨɛɨɪɭɞɨɜɚɧɢɹ:
ɗɤɨɧɨɦɢɱɧɨɫɬɶ – ɦɢɧɢɦɚɥɶɧɵɟ ɤɚɩɢɬɚɥɶɧɵɟ ɡɚɬɪɚɬɵ ɢ ɧɢɡɤɢɟ ɭɞɟɥɶɧɵɟ ɷɧɟɪɝɨɡɚɬɪɚɬɵ ɩɪɢ
ɷɤɫɩɥɭɚɬɚɰɢɢ;
Ɍɟɯɧɨɥɨɝɢɱɧɨɫɬɶ – ɨɛɨɪɭɞɨɜɚɧɢɟ ɹɜɥɹɟɬɫɹ ɩɪɨɫɬɵɦ ɜ ɨɛɫɥɭɠɢɜɚɧɢɢ ɢ ɧɚɞɺɠɧɵɦ ɜ ɷɤɫɩɥɭɚɬɚɰɢɢ;
ɗɤɨɥɨɝɢɱɧɨɫɬɶ – ɜ ɩɪɨɰɟɫɫɟ ɷɤɫɩɥɭɚɬɚɰɢɢ ɧɟ ɩɪɟɞɭɫɦɚɬɪɢɜɚɟɬɫɹ ɩɪɢɦɟɧɟɧɢɟ ɯɢɦɢɱɟɫɤɢɯ ɪɟɚɝɟɧɬɨɜ;
Ɇɨɞɭɥɶɧɨɟ ɢɫɩɨɥɧɟɧɢɟ – ɨɛɨɪɭɞɨɜɚɧɢɟ ɢɡɝɨɬɨɜɥɟɧɨ ɜ ɜɢɞɟ ɦɨɞɭɥɶɧɵɯ ɤɨɧɫɬɪɭɤɰɢɣ ɢ ɦɨɠɟɬ
ɛɵɬɶ ɪɚɡɦɟɳɟɧɨ ɧɚ ɫɪɚɜɧɢɬɟɥɶɧɨ ɧɟɛɨɥɶɲɨɣ ɩɥɨɳɚɞɢ ɢ ɜ ɥɸɛɨɣ ɤɨɧɮɢɝɭɪɚɰɢɢ;
ɍɧɢɜɟɪɫɚɥɶɧɨɫɬɶ – ɫɬɟɩɟɧɶ ɨɛɟɫɫɨɥɢɜɚɧɢɹ ɦɨɠɟɬ ɛɵɬɶ ɥɸɛɨɣ, ɜɤɥɸɱɚɹ ɩɨɥɭɱɟɧɢɟ «ɫɜɟɪɯɱɢɫɬɨɣ» ɜɨɞɵ; ɤɪɨɦɟ ɬɨɝɨ, ɥɟɠɚɳɢɣ ɜ ɨɫɧɨɜɟ ɪɚɛɨɬɵ ɨɛɨɪɭɞɨɜɚɧɢɹ ɩɪɢɧɰɢɩ ɷɥɟɤɬɪɨɞɢɚɥɢɡɚ ɩɨɡɜɨɥɹɟɬ ɪɟɲɚɬɶ ɬɚɤɠɟ ɢ ɨɛɪɚɬɧɭɸ ɡɚɞɚɱɭ ɩɨɥɭɱɚɬɶ ɜɵɫɨɤɨɤɨɧɰɟɧɬɪɢɪɨɜɚɧɧɵɟ ɪɚɫɫɨɥɵ ɢɡ ɩɪɢɪɨɞɧɵɯ
ɦɢɧɟɪɚɥɢɡɨɜɚɧɧɵɯ ɜɨɞ.
Ɍɟɯɧɨɥɨɝɢɱɟɫɤɚɹ ɫɯɟɦɚ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɨɣ ɭɫɬɚɧɨɜɤɢ ɜɤɥɸɱɚɟɬ ɜ ɫɟɛɹ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɵɣ ɚɩɩɚɪɚɬ, ɢɦɩɭɥɶɫɧɵɣ ɢɫɬɨɱɧɢɤ ɩɢɬɚɧɢɹ ɩɨɫɬɨɹɧɧɨɝɨ ɬɨɤɚ, ɛɥɨɤ ɚɜɬɨɦɚɬɢɡɢɪɨɜɚɧɧɨɝɨ ɭɩɪɚɜɥɟɧɢɹ ɩɪɨɰɟɫɫɨɦ ɨɩɪɟɫɧɟɧɢɹ, ɚ ɬɚɤɠɟ ɮɢɥɶɬɪ ɩɪɟɞɜɚɪɢɬɟɥɶɧɨɣ ɨɱɢɫɬɤɢ ɢɫɯɨɞɧɨɣ ɜɨɞɵ, ɮɢɥɶɬɪ ɞɥɹ ɭɥɭɱɲɟɧɢɹ ɨɪɝɚɧɨɥɟɩɬɢɱɟɫɤɢɯ ɫɜɨɣɫɬɜ ɨɩɪɟɫɧɺɧɧɨɣ ɜɨɞɵ ɢ ɭɥɶɬɪɚɮɢɨɥɟɬɨɜɵɣ ɫɬɟɪɢɥɢɡɚɬɨɪ, ɨɛɟɫɩɟɱɢɜɚɸɳɢɣ ɷɤɨɥɨɝɢɱɟɫɤɢ ɱɢɫɬɨɟ ɨɛɟɡɡɚɪɚɠɢɜɚɧɢɟ.
Ɉɫɧɨɜɧɨɣ ɷɥɟɦɟɧɬ ɭɫɬɚɧɨɜɤɢ – ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɵɣ ɚɩɩɚɪɚɬ, ɩɪɟɞɫɬɚɜɥɹɸɳɢɣ ɫɨɛɨɣ ɦɟɦɛɪɚɧɧɵɣ ɩɚɤɟɬ ɮɢɥɶɬɪ-ɩɪɟɫɫɧɨɝɨ ɬɢɩɚ. Ʉɨɥɢɱɟɫɬɜɨ ɦɟɦɛɪɚɧ ɜ ɚɩɩɚɪɚɬɟ ɨɬ 200 ɞɨ 600 ɲɬ. Ⱦɥɹ ɛɨɪɶɛɵ
ɫ ɦɟɠɦɟɦɛɪɚɧɧɵɦɢ ɨɬɥɨɠɟɧɢɹɦɢ ɫɨɥɟɣ ɢɡɝɨɬɚɜɥɢɜɚɟɦɵɟ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɵɟ ɚɩɩɚɪɚɬɵ ɤɨɦɩɥɟɤɬɭɸɬɫɹ ɢɫɬɨɱɧɢɤɚɦɢ ɬɨɤɚ ɫ ɢɦɩɭɥɶɫɧɵɦ ɢɥɢ ɫɢɦɦɟɬɪɢɱɧɵɦ ɪɟɜɟɪɫɢɪɨɜɚɧɢɟɦ ɩɨɥɹɪɧɨɫɬɢ.
ȼ ɡɚɜɢɫɢɦɨɫɬɢ ɨɬ ɧɟɨɛɯɨɞɢɦɨɣ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɢ ɬɪɟɛɭɟɦɨɣ ɫɬɟɩɟɧɢ ɨɩɪɟɫɧɟɧɢɹ ɩɪɢ ɤɨɦɩɥɟɤɬɚɰɢɢ ɫɬɚɧɰɢɢ ɦɨɝɭɬ ɜɚɪɶɢɪɨɜɚɬɶɫɹ ɤɨɥɢɱɟɫɬɜɨ ɫɬɭɩɟɧɟɣ ɜ ɚɩɩɚɪɚɬɟ, ɤɨɥɢɱɟɫɬɜɨ ɷɥɟɤɬɪɨɞɢɚɥɢɡɧɵɯ ɚɩɩɚɪɚɬɨɜ, ɚ ɬɚɤɠɟ ɩɪɢɦɟɧɹɬɶɫɹ ɪɚɡɥɢɱɧɵɟ ɬɢɩɵ ɦɟɠɦɟɦɛɪɚɧɧɵɯ ɩɪɨɤɥɚɞɨɤ.
Ɉɛɟɫɩɟɱɟɧɢɟ ɫɟɥɶɫɤɢɯ ɧɚɫɟɥɺɧɧɵɯ ɩɭɧɤɬɨɜ ɤɚɱɟɫɬɜɟɧɧɨɣ ɩɢɬɶɟɜɨɣ ɜɨɞɨɣ ɷɤɨɧɨɦɢɱɟɫɤɢ ɰɟɥɟɫɨɨɛɪɚɡɧɨ ɨɫɭɳɟɫɬɜɥɹɬɶ ɫ ɩɨɦɨɳɶɸ ɚɜɬɨɧɨɦɧɵɯ ɫɢɫɬɟɦ ɜɨɞɨɫɧɚɛɠɟɧɢɹ – ɥɨɤɚɥɶɧɵɯ ɫɬɚɧɰɢɣ
ɨɱɢɫɬɤɢ ɜɨɞɵ (ɅɋɈ.
Ɂɚ 2001–2004 ɝ.ɝ. ɅɋɈ ɪɚɡɥɢɱɧɨɣ ɩɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɢ ɛɵɥɢ ɭɫɬɚɧɨɜɥɟɧɵ ɜ 72 ɫɟɥɶɫɤɢɯ ɧɚɫɟɥɺɧɧɵɯ ɩɭɧɤɬɚɯ ɉɚɜɥɨɞɚɪɫɤɨɣ, Ⱥɤɦɨɥɢɧɫɤɨɣ, ɋɟɜɟɪɨ-Ʉɚɡɚɯɫɬɚɧɫɤɨɣ ɢ Ɇɚɧɝɢɫɬɚɭɫɤɨɣ ɨɛɥɚɫɬɟɣ.
Ɉɛɨɪɭɞɨɜɚɧɢɟ ɩɨ ɨɱɢɫɬɤɟ, ɨɩɪɟɫɧɟɧɢɸ ɢ ɨɛɟɡɡɚɪɚɠɢɜɚɧɢɸ ɜɨɞɵ ɢɡɝɨɬɚɜɥɢɜɚɟɬɫɹ ɜ ɦɨɞɭɥɶɧɨɦ
ɢɫɩɨɥɧɟɧɢɢ ɢ ɦɨɧɬɢɪɭɟɬɫɹ ɜ ɭɬɟɩɥɺɧɧɨɦ 20-ɬɢ ɢɥɢ 40-ɮɭɬɨɜɨɦ ɤɨɧɬɟɣɧɟɪɟ. ɉɪɨɢɡɜɨɞɢɬɟɥɶɧɨɫɬɶ
ɨɞɧɨɣ ɫɬɚɧɰɢɢ